US08942983B2
The present invention relates to a method of text-based speech synthesis, wherein at least one portion of a text is specified; the intonation of each portion is determined; target speech sounds are associated with each portion; physical parameters of the target speech sounds are determined; speech sounds most similar in terms of the physical parameters to the target speech sounds are found in a speech database; and speech is synthesized as a sequence of the found speech sounds. The physical parameters of said target speech sounds are determined in accordance with the determined intonation. The present method, when used in a speech synthesizer, allows improved quality of synthesized speech due to precise reproduction of intonation.
US08942979B2
An acoustic processing apparatus is provided. The acoustic processing apparatus including a first extracting unit configured to extract a first acoustic model that corresponds with a first position among positions set in a speech recognition target area, a second extracting unit configured to extract at least one second acoustic model that corresponds with, respectively, at least one second position in proximity to the first position, and an acoustic model generating unit configured to generate a third acoustic model based on the first acoustic model, the second acoustic model, or a combination thereof.
US08942970B2
A method is disclosed for configuring an intelligent electronic device (IED) that includes enabling dynamic capability of the IED by a flexible data modeling technique to dynamically adapt a data model based on an application requirement using a configuration tool. A substation automation system is also disclosed which includes a local system equipment having a plurality of IEDs associated with the local system equipment and an IED configuration tool configured to interact with the firmware of each IED to configure the IED based on application requirements. The application configuration tool can include dynamic capability information of the IED to enable a flexible data model in the IED.
US08942968B2
A computer-readable, non-transitory medium stores a program that causes a computer to execute a process including acquiring a unique coefficient that is unique to a device in a circuit under test and is included in a function expressing fluctuation of leak current of the device; detecting as a group and based on the unique coefficient, devices having an identical or similar characteristic; converting first random variables into a single second random variable, the first random variables expressing fluctuation of leak current unique to each of the detected devices; yielding a function that expresses fluctuation of leak current of the detected devices, using the second random variable; and outputting the yielded function.
US08942967B2
The invention is a method for real-time updating of a geological model using dynamic data while maintaining the coherence thereof with static observations. An initial set of reservoir property maps, obtained from stochastic simulations of a random function, are available. Parameters providing new realizations of the random function when applied to the set are selected. New maps are created using initial values of the parameters. As soon as new dynamic data are available, the parameters are modified to reduce a difference between the simulated data for perturbed models and the measured data. Finally, the reservoir is developed using a modified development scheme to account for the deformed maps.
US08942955B2
A monitoring system capable of being operationalized. Power consumption in electrical devices is monitored by the use of new and innovative consumption power monitoring device in accordance with the present invention. Power consumption information is collected by an intelligent power hub that is communicatively coupled to a remote server that presents overall power usage displays. A method of operationalizing a power usage monitoring system comprises powering up an energy pump device when the energy pump device is plugged into a first power socket, setting the energy pump device automatically to a SET mode to acquire new monitoring devices, and discovering the presence of a power consumption monitoring device.
US08942954B2
Fault location on a non-homogeneous electric power line that includes a plurality of sections by determining a section in which negative-sequence voltage magnitude profiles calculated from each terminal of the power line intersect. The fault location may determine the faulted section and determine the location of the fault within the faulted section. To determine the fault location, the negative-sequence voltage magnitude profiles may be calculated from measurements taken at each terminal of the power line and compared to determine a point where the profiles intersect. The profiles may be calculated using power line properties and measurements from each terminal.
US08942946B2
Provided is a test apparatus that tests a device under test, comprising a test unit that sends and receives signals to and from the device under test; a control apparatus that controls the test unit; and a relay apparatus that relays between the control apparatus and the test unit. The relay apparatus includes a first communicating section that receives a command from the control apparatus to the relay apparatus and transmits the command to the test unit; a second communicating section that receives a return command that is transmitted back to the relay apparatus by the test unit that received the command; and an executing section that executes a process designated by the return command, in response to the second communicating section receiving the return command.
US08942940B2
Implementing a portable articulated arm coordinate measuring machine includes receiving a first request to perform a function. The portable AACMM includes a manually positionable articulated arm portion having opposed first and second ends, the arm portion including a plurality of connected arm segments, each arm segment including at least one position transducer for producing a position signal, a measurement device attached to a first end of the AACMM, and an electronic circuit which receives the position signals from the transducers and provides data corresponding to a position of the measurement device. Implementing the portable articulated arm coordinate measuring machine also includes identifying a source device from which the first request is received, implementing the function pursuant to the first request, selecting a destination device as the source device of the first request by identifying from which of a first and second port the first request is received, and transmitting information derived from implementing the function to the destination device.
US08942936B2
A system includes, in at least one aspect, a first circuit configured to be coupled to a load, and a second circuit configured to perform operations including receiving a digital voltage signal representing a voltage supplied to a first circuit, identifying a first time stamp associated with a voltage value representing an extrema in the digital voltage signal, receiving a digital current signal representing a current drawn by the load in response to the supplied voltage, identifying a second time stamp associated with the digital current signal, the second time stamp being within a threshold time of the first time stamp, and identifying a current value associated with the second time stamp as the current drawn by the load.
US08942935B2
This disclosure describes techniques for estimating an amount of charge on a power source. A processor may determine an uncertainty value associated with a first charge level of a power source and an uncertainty value associated with a second charge level of the power source. Based on the uncertainties, the processor may adjust the first charge level to generate an adjusted charge level. The processor may further adjust the adjusted charge level based on the behavior of the power source.
US08942929B2
A method for taking field measurements of a cone type fluid flow meter including a meter body and a cone-type fluid displacement member to determine when to calibrate or replace the fluid flow meter. The method includes taking measurements of dimensions of the fluid displacement member and the meter body, evaluating the dimension measurements and ascertaining whether the dimension measurements are within designated dimension limits. The present method saves significant time and costs by taking measurements in the field determining whether to calibrate or replace the fluid flow meter.
US08942927B2
A system and method for measuring elemental concentrations of a material from a sample containing several elements by LIES analysis is provided. The material is heated to generate plasma and its chemical composition is determined from spectral analysis of its radiation. The spectral lines of interest are identified among those emitted by constituents of each element composing sample, and their intensities are measured. The chemical composition of the plasma is calculated. The absorption coefficient according to wavelength is calculated for the spectral zones of the lines of interest. The spectral radiance of the plasma is calculated for the same spectral zones and then a comparison of the intensity and shape of the spectrum thus calculated with those of the spectrum measured is performed. These calculations and this comparison are repeated iteratively in order to adjust the temperature, electron density, relative values of the elemental concentrations and width of the plasma.
US08942922B2
A system is provided that may mark and communicate a location to a navigation system via a portable device. The portable device may include a user interface, a first GPS device, a first memory device and a transmitter. The user interface may selectively allow the first GPS device to acquire geographical coordinates of a current location of the portable device and store the geographical coordinates in the first memory device. The navigation system may include a second GPS device, a second memory device, a receiver, and a display. The transmitter of the portable device may communicate the geographical coordinates to the receiver of the navigation system.
US08942919B2
A battery electric vehicle (BEV) navigation routing system and routing methods are presented, in which a traveling route is determined from the current vehicle location to the destination location by preferentially selecting low speed routes over higher speed routes if the present state of charge of the vehicle battery is insufficient to reach the destination location using shortest time or shortest distance routes.
US08942911B2
A control system for a vehicle includes an error detection module and a remedial control module. The error detection module detects whether an accelerator of the vehicle is stuck is based on vehicle speed, a position of the accelerator, and one of a pressure applied to a brake of the vehicle and a status of a parking brake of the vehicle. The remedial control module, when the accelerator is stuck, at least one of resets the position of the accelerator and decreases torque output of a powertrain system.
US08942902B2
An apparatus, method and computer for actuating a disconnect clutch which is arranged between a first drive unit and a second drive unit of a hybrid drive and which can be actuated by means of a hydraulic actuating element in order to couple or decouple the first drive unit to or from the rest of a powertrain. This is accomplished by adapting a transmission hydraulic pressure level to a disconnect clutch hydraulic pressure level required for actuating the disconnect clutch by a pressure converter arranged between the actuating element and a hydraulic medium supply for a transmission.
US08942901B2
A hydraulic control system for a dual clutch transmission includes a plurality of solenoids and valves in fluid communication with a plurality of clutch actuators and with a plurality of synchronizer actuators. The clutch actuators are operable to actuate a plurality of torque transmitting devices and the synchronizer actuators are operable to actuate a plurality of synchronizer assemblies. Selective activation of combinations of the solenoids allows for a pressurized fluid to activate at least one of the clutch actuators and synchronizer actuators in order to shift the transmission into a desired gear ratio.
US08942898B2
In a range switchover control apparatus, a microcomputer checks, under a state that driving force of a motor is released, whether a range switchover mechanism is at rest and whether the range switchover mechanism is at rest in a bottom position, that is, whether an engagement member is fitted deep into a bottom of a range holding recess. If the range switchover mechanism is at rest in the bottom position, an encoder count value at a reference position (bottom position of a P-range) is calculated based on a present range and an encoder count value. By using the present range and the calculated encoder count value, an encoder count value of the bottom position of the present range can be determined. Based on this encoder count value, the encoder count value at the reference position can be calculated.
US08942895B2
A display system in a hydraulic shovel has a calculation unit and a display unit. The calculation unit is configured to calculate a distance between a design surface and a position closest to the design surface among positions of a blade edge of a bucket in a widthwise direction of the blade edge based on positional information for the blade edge and the design surface. The display unit is configured and arranged to display a guidance picture. The guidance picture includes an image showing the positional relationship between the design surface and the blade edge of the bucket, and information indicating the distance between the design surface and the position closest to the design surface.
US08942893B2
A boom is attached to an application vehicle for applying a product during an agricultural application. The boom includes one or more sections that can be dynamically adjusted to satisfy one or more adjustment criteria. A boom controller communicates actuation commands to a boom adjustment system to dynamically adjust the shape of the boom.
US08942883B2
A pressure sensor module for a vehicle includes a sensing element module, a sampling module, a filtering module, and a monitoring module. The sensing element module measures a pressure of a fluid and outputs a pressure signal based on the pressure. The sampling module samples the pressure signal. The filtering module receives at least one filter coefficient from a control module and determines a filtered pressure based on at least one of the samples. The monitoring module receives a condition monitoring request from the control module, receives a predetermined value from the control module, and notifies the control module when a condition is satisfied based on a comparison of the predetermined value and one of the filtered pressure and a parameter determined based on the pressure signal.
US08942882B2
Systems and methods for managing the exchange of vehicle information between software modules with different safety importance. In one embodiment, a vehicle health management system includes a mission critical software module, a flight critical software module and a gatekeeper. The mission critical software module receives vehicle state information and provides it to the flight critical software module if the gatekeeper confirms the validity of the vehicle information.
US08942878B2
A method provides information relating to the operational state of a motor vehicle to a driver. The motor vehicle has at least one electric motor operating with a fixed gear ratio for driving the motor vehicle. During operation of the electric motor a virtual speed and a virtual gear-shift stage are continuously determined from at least one first operating parameter describing the operational state of the motor vehicle and an acoustic output, in particular an output of an engine noise, takes place on the basis of the virtual speed and the virtual gear-shift stage.
US08942864B2
A vehicle control system includes: a communication device provided in a vehicle to receive information relating to another vehicle from outside the vehicle; and a control device that performs travel control on the vehicle on the basis of information pertaining to a transfer function for a control target value used during travel control of the other vehicle and the control target value of the other vehicle, which is obtained via the communication device of the vehicle. Further, a vehicle control system includes: a communication device provided in a vehicle; and a control device that performs travel control using information relating to another vehicle, which is received from outside the vehicle via the communication device, wherein the communication device transmits information pertaining to a transfer function for a control target value used during the travel control.
US08942863B2
A position control system for use with a mobile machine at a worksite is disclosed. The control system may have a location receiver configured to generate a location signal indicative of an actual location of a base station, a communication device configured to wirelessly communicate with the mobile machine, and a controller in communication with the location receiver and the communication device. The controller may be configured to store an assumed location of the base station in memory, make a comparison of the location signal with the assumed location, and selectively generate a control instruction for the mobile machine based on the comparison.
US08942862B2
The present invention relates to a method (400) and a system (100) for guiding a robotic garden tool to a predetermined position. The robotic garden tool includes a control unit (104) and a sensor unit (102) to detect guiding signals. The sensor unit (102) detects a first guiding signal (110) from a first signal source (106) and the robotic garden tool follows the first guiding signal (110) at a variable distance from the first signal source (106) towards the predetermined position. While within a predetermined distance (D) from the predetermined position, the sensor unit (102) detects a second guiding signal (112) from a second signal source (108). Within the predetermined distance (D), the robotic garden tool follows one of the first and the second guiding signals (110 or 112) towards the predetermined position at a pre-configured distance from the corresponding signal source.
US08942860B2
A wireless communication system for agricultural vehicles, in which each vehicle has a global positioning system (GPS), a multi-channel transmitter/receiver module having a limited communication range, and a signal processor connected to the transmitter/receiver module. The transmitter is controlled by the signal processor to transmit on a predetermined communication channel a signal comprising a unique vehicle identifier and a signal indicating the current positional coordinates of the vehicle. The signal processor also analyzes the signals received from other vehicles within the communication range and determines from the identifier and the positional coordinates data when another vehicle is ready to perform a joint operation with the vehicle. Prior to initiation of a joint operation, the communication system is switched to a different communication channel.
US08942859B2
The present invention provides a guidance and security system for transport means, in particular complex mass transport systems, in which automatic passenger counting, security monitoring, for example, against fire, crime and terrorism, control of the use of individual elements of the transport system, such as vehicles, trains etc., automatic monitoring of the track and passenger information are connected with each other by an electronic “backbone”. The system comprises at least one guidance means for at least one transport means an/or for people, several recording units and a central unit. The central unit is connected to the recording units and the guidance means. The recording units are for determining the number of people located at a particular time and in a particular spatial area such that the central unit can control the guidance means depending thereon, in order that the appropriate number of vehicles is automatically provided with the necessary frequency and to guide passengers to the vehicle entrances.
US08942854B2
Some embodiments relate to a method of identifying electrical devices in a power management system. The method includes accessing a controller using a server that includes identifiers of the electrical devices. The controller is electrically connected (directly or indirectly) to the electrical devices. The method further includes exchanging data between the server and the controller to correlate the identifiers with the electrical devices. The potential identifiers that may be used to correlate the identifiers with the electrical devices may be stored in an identifier database on the server. In some embodiments, the identifiers of the electrical devices may also be stored in an identifier database on the controller.
US08942852B2
A sample processing system comprising: a sample processing apparatus configured to process a sample in a sample container; a transporting apparatus configured to transport a sample container to the sample processing apparatus; a first computer configured to perform information processing for the sample processing apparatus; a second computer connected to the first computer through a communication network and configured to control a transporting operation performed by the transporting apparatus; an input unit and a display commonly used for the first and second computers, wherein the first computer configured to control the display to show a first computer screen image, and to control the display to show a second computer screen image upon receiving a switching instruction via the input unit, and the second computer receives an input from the input unit via the second computer screen image shown on the display.
US08942848B2
A control system for a bipedal humanoid robot that utilizes certain fundamental characteristics of bipedal motion to provide a robust and relatively simple balancing and walking mechanism. The system primarily utilizes the concept of “capturability,” which is defined as the ability of the robot to come to a stop without falling by taking N or fewer steps. This ability is considered crucial to legged locomotion and is a useful, yet not overly restrictive criterion for stability. In the preferred embodiment, the bipedal robot is maintained in a 1-step capturable state. This means that future step-locating and driving decisions are made so that the robot may always be brought to a balanced halt with the taking of one step. Other embodiments maintain the bipedal robot in an N-step capturable state, in which the robot may always be brought to a balanced halt by taking N or fewer steps.
US08942841B2
The present invention provides for a programmable processor in a ophthalmic lens storage unit for contact lenses. The processor can be in logical connection with a plurality of sensors that can provide data and a digital storage for storing the data and using it via executable software for lens monitoring. In some embodiments, the processor is additionally operative via the executable software to correlate geo-social phenomena with the optical performance of a lens.
US08942840B2
A system and method for manufacturing semiconductor devices is disclosed. An embodiment comprises using desired device parameters to choose an initial manufacturing recipe. Once chosen, the initial manufacturing recipe may be modified by determining and applying an offset adjustment based on previous manufacturing to tune the recipes for the particular equipment to be utilized in the manufacturing process.
US08942836B2
A control signal generating means of a sound effect generating device sets the reference volume that is the reference value of the volume of a sound effect when a vehicle is in a predetermined travel state, compares the measured volume of the sound effect detected by a sound effect detecting means when the vehicle is in the predetermined travel state and the reference volume, and corrects the gain of a control signal on the basis of the result of the comparison.
US08942830B2
An automatic external defibrillator configured to deliver electrical pulses and/or shocks to a heart of a patient during a cardiac emergency includes a housing supporting an electrical connector; a defibrillator electrode delivery system supported on the housing and a pair of defibrillation electrode pads supported by the defibrillator electrode delivery system. Each of the pair of defibrillation electrode pads is pre-connected to the electrical connector of the housing. A hydrogel layer of each defibrillation electrode pad is retained by the defibrillator electrode delivery system in such a manner so as to reduce a moisture vapor transmission rate thereof.
US08942827B2
A multizone epicardial pacing lead (10) having a lead body (12) with a proximal connector (14) for coupling to a generator of an active implantable medical device and, distally, an anchor to an epicardium wall and an active part comprising a plurality of stimulation electrodes, coming into contact with, or penetrating, the epicardium wall. This active part comprises a distributor housing (16) and a network of flexible microcables (18) radiating from the housing. Each microcable is formed of an electrically insulated conductor comprising at least one denuded area (20), each of these areas forming a stimulation electrode.
US08942818B2
A system and method are described for delivering an implantable medical device in a patient and through a catheter. The delivery catheter comprises telemetry means for communicatively coupling the implantable medical device with an external instrumentation during implantation.
US08942803B1
A system and method for use during the administration of CPR chest compressions and defibrillating shock on a cardiac arrest victim. The system analyzes compression waveforms from a compression depth monitor to determine the source of chest compressions, and enables the delivery of defibrillating shock during a compression cycle if the compression waveforms are characteristic of an automated CPR chest compression device.
US08942801B2
A surgical access system including a tissue distraction assembly and a tissue refraction assembly, both of which may be equipped with one or more electrodes for use in detecting the existence of (and optionally the distance and/or direction to) neural structures before, during, and after the establishment of an operative corridor to a surgical target site.
US08942790B2
An optical spectroscopic injection needle assembly. According to one embodiment, the assembly may include an injection needle, a light source, a spectrometer, a computer and an indicator. The injection needle, in turn, may include a hollow outer needle, a hollow inner needle, a pair of optical fibers, an inner catheter, an outer catheter, an inner hub and an outer hub. The proximal end of the outer needle may be fixedly mounted within the distal end of the inner catheter. The distal end of the inner hub may be fixedly mounted on the proximal end of the inner catheter, the proximal end of the inner hub being suited for connection to a syringe. The inner needle, as well as the distal ends of the optical fibers, may be positioned within the outer needle and may be held in place by an optical bonding material. The proximal ends of the optical fibers may extend from a side arm of the inner hub, one fiber may be coupled to the light source, the other fiber may be coupled to the spectrometer. The inner catheter and the outer needle may be slidably mounted within the outer catheter to permit the outer needle to be selectively extended or retracted from the distal end of the outer catheter. The outer hub may be fixedly mounted on the proximal end of the outer catheter. In use, as the outer needle may be inserted into a tissue, the tissue may be illuminated and the reflected light may be detected and compared to standards for various tissue types. The results of the comparison may then be indicated.
US08942782B2
An image display apparatus includes a first radiographic image acquirer for acquiring a first radiographic image captured in the scout image capturing process, a second radiographic image acquirer for acquiring a plurality of second radiographic images captured in the stereographic image capturing process, a first display controller for displaying the first radiographic image on a display unit, and a second display controller for displaying the second radiographic images on the display unit and, in case that the biopsy region is selected in the displayed first radiographic image, displaying, in the second radiographic images, respective guide lines passing through positions in the second radiographic images which correspond to the position of the biopsy region selected in the first radiographic image and extending parallel to or substantially parallel to a prescribed direction.
US08942772B2
This disclosure provides systems, methods, and apparatus for antenna selection for different radio access technologies. An apparatus can include a plurality of antennas and a plurality of radio access technology modules each configured to communicate according to a different radio access technology. The apparatus further includes a controller configured to switch communication circuits of each of the radio access technology modules to communicate via a corresponding one or more of the plurality of antennas. The apparatus further includes a switching manager configured to manage a plurality of switch configurations each defining a mapping between each of the radio access technology modules and the antennas. The switching manager is further configured to store a switch configuration used for a first radio access technology module and cause the controller to maintain the switch configuration in place in response to a network handover. Other aspects, embodiments, and features are also claimed and described.
US08942771B1
The frequency with which data is refreshed for an application executed by a mobile device may be dynamically set based on one or more of the state of the battery or the network access of the device, or the frequency with which the application is used. The data refresh frequency may also be dynamically set based on additional parameters, including, e.g., the strength of the signal of the network over which the mobile device is communicating.
US08942770B2
A mobile terminal including a wireless communication unit configured to wirelessly communicate using at least two different communication systems; a display unit including a backlight configured to apply light to a display screen of the display unit; a sensing unit configured to measure a temperature of the mobile terminal if the at least two different communication systems are simultaneously used; and a controller configured to adjust a brightness of the backlight based on the measured temperature and a preset temperature.
US08942765B2
When a user performs a playback operation, an imaging unit starts taking images, and video data based on the image data obtained from that imaging is stored in a buffer of a memory unit. A control unit writes the video data stored in the buffer in a newly opened image file. When the capacity of the image file reaches a limit capacity, the control unit closes that image file and opens a new image file. The control unit also writes video data to the opened image file. The control unit creates information (image file information) for the generated image file and enters that information in an image management table. When a plurality of image files is generated, the control unit stores information indicating the playback order of the image files in the image management table.
US08942764B2
Systems and methods are provided for a media device including one or more movement-based interfaces for interfacing with or controlling the media device.
US08942751B2
Disclosed is an apparatus for reporting transmission power. The apparatus for reporting transmission power includes a transmission power normalization unit, a message generation unit, and a transmission unit. The transmission power normalization unit normalizes a first transmission power at a current Modulation and Coding Scheme (MCS) level into a second transmission power at a reference MCS level, the current MCS level being an MCS level of a burst which is intended to comprise a transmission power report of a terminal. The message generation unit generates a message comprising the transmission power report of the terminal with the second transmission power defined therein. The transmission unit transmits the generated message to a base station.
US08942736B2
A method and system for determining the position of a moving wireless communication device, the method comprising: recording moving path of the wireless communication device in cells of a cellular wireless communication network; recording moving path and GPS information of a GPS wireless communication device moving in the cellular wireless communication network in cells of the cellular wireless communication network; determining the GPS wireless communication device whose moving path matches with the moving path of the wireless communication device; and determining the position of the wireless communication device based on the GPS information of the matching GPS wireless communication device.
US08942735B2
This invention provides an apparatus that associates a location where a terminal uses communication or travel route in use of the communication, with a connection destination of the terminal. The apparatus includes a communication log analyzer that aggregates communication logs collected by network apparatuses that constitute the mobile network and analyzes it. The communication log analyzer estimates travel route of the terminal connected the network using: log information generated by a base station to be connected to the terminal at the time of starting the connection, log information generated by a base station to be connected to the terminal at the time of a handover of the connection, and log information generated by a base station connected to the terminal at the time of detaching the connection.
US08942734B2
An apparatus and a method for a peripheral device control in a portable terminal are provided. In the method for the peripheral device control in the portable terminal, the method includes selectively changing a communication path between a communication modem and a storage to a communication path between a controller and the storage by controlling a switch when the communication modem is turned off, determining information necessary for the peripheral device control through the communication path between the controller and the storage and controlling the peripheral device when the information satisfies a control condition.
US08942733B2
Provided is a distributed system and method for enabling new and useful location dependent features and functionality to mobile data processing systems. Mobile data processing systems (MSs) interact with each other as peers in communications and interoperability. Data is shared between mobile data processing systems to carry out novel Location Based eXchanges (LBX) of data for new mobile applications. Information which is transmitted inbound to, transmitted outbound from, or is in process at, a mobile data processing system, is used to trigger processing of actions in accordance with user configured permissions, charters, and other configurations. In a preferred embodiment, a user configurable platform is provided for quickly building well behaving LBX applications at MSs and across a plurality of interoperating MSs.
US08942729B2
Methods, program products, and systems for location-based reminders are disclosed. A first user device can receive an input specifying that a reminder be presented at a given location. The first user device can provide a reminder request, including type and content of the reminder and the location, to a server computer for pushing to one or more user devices. A second user device, upon receiving the reminder request, can determine a device location of the second user device. If the given location matches the device location, the second user device can present the reminder in a user interface.
US08942726B2
A controlling device such as a remote control has programming for transmitting a signal response to a plurality of control environments, each environment including a signaling device. Each signaling device in receipt of the signal request sends a signal response having a unique ID which is chosen to be characteristically attenuated by the surroundings of the environment. Because the controlling device can only be in one environment at a given time, and given the attenuation characteristics of the signal response from each signaling device, only one signal response will be received by the controlling device in each environment. Location definitions associated with the received unique ID may be used by programming in the controlling device to recall saved devices states, commands sets, macros, and even to dynamically generate commands based on the location information.
US08942720B2
Methods in a user equipment (UE) for enabling positioning of the UE in a radio communication network having a radio network node and a positioning node. The UE is served in a first cell controlled by the radio network node, and the UE knows or can obtain a system frame number of at least one cell. The UE receives, from the positioning node, a message having positioning assistance data, which includes information associated with the at least one cell for which the system frame number is known or can be obtained by the UE. The UE also performs a positioning measurement using the positioning assistance data and the system frame number of the at least one cell to enable positioning of the UE.
US08942712B2
A fractional frequency reuse method for assigning physical resource units of a contiguous frequency band to sectors of cells is disclosed. Each cell includes at least one base station, for transmission of data to users in the sectors The method comprises, for each cell, segmenting the frequency band such that each separate segment includes a first contiguous portion of physical resource units dedicated to all sectors of the cell in vicinities of the center of the cell and a second contiguous portion of physical resource units dedicated for use in only one of the sectors in the cell in an outer area of the cell, assigning each cell with a physical resource unit configuration such that the second contiguous portion of physical resource units of a sector of a given cell partially overlaps with the first contiguous portion of physical resource units in a segment including the second contiguous portion dedicated to the same sector of a cell neighboring the given cell, and transmitting the data to the users in the sectors in accordance with the assigned physical resource unit configurations. Other methods, apparatuses, and systems also are disclosed.
US08942707B2
A method of handover of a User Equipment (UE) from first to second Radio Access Network (RANs), the second RAN coupled to a Mobility Controller (MC) and having an association with the first RAN, the UE capable of communication with a Session Transfer Controller (STC) via the first and second RANs, includes receiving a first message at the MC from the first RAN requesting handover of the UE to the second RAN, sending a second message from the MC to the STC subscribing the MC to status updates from the STC, said status updates relating to status of a call, receiving one of said status updates at the MC originated by the STC, dependent on a communication via the first RAN from the UE to the STC of a change in the status, and in response to receipt of said status update, updating a call status indicator of the MC.
US08942697B2
The disclosure relates to a method for uploading network information, and User Equipment (UE), network side equipment and system thereof. The method comprises the following steps: a network side equipment receives power supply capacity information reported by a UE; the network side equipment instructs the UE to upload needed network information according to the power supply capacity information; the network side equipment receives the network information, which is uploaded by the UE. The method for uploading network information by using the power supply capacity information of UE, and UE, network side equipment and system thereof, according to example embodiments of the present invention, avoid the problems of short standby time and the interruption of ongoing service for a user caused by uploading the network information, and reduces the operation cost, by uploading the network information according to the power supply capacity of the UE.
US08942687B2
Communication networks and methods are disclosed for selectively applying call forwarding between a mobile device and a fixed line device based on the location of the mobile device. A communication network includes a call control function that receives a call attempt to a mobile directory number. Responsive to the call attempt, the call control function identifies a location of the mobile device, and determines whether to apply call forwarding based on the location of the mobile device. If call forwarding is applied, then the call control function forwards the call attempt to the fixed line device instead of the mobile device. A similar process is performed for a call attempt to the fixed line device for forwarding the call to the mobile device.
US08942685B2
A communication device includes a transceiver configured to communicate with other communication devices over a cellular network, and circuitry coupled to the transceiver, the circuitry configured to detect a lost communication session with another communication device and generate a menu of options regarding the lost communication session.
US08942684B2
Systems, methods, and computer program products for adaptively scaffolding of levels of connectivity between one or more customer devices during customer service conference are provided. The system includes various applications and features executable on a computing and/or mobile computing device. The system includes a user interface configured to present tools and features that allows a customer, during a digital conference with a bank representative, to manipulate the channels of communication, levels of connectivity or other features of the digital conference. In some instances, a scaffolding application on the bank's server may be provided to dynamically adjust the levels of connectivity and/or channels of communication of an ongoing digital conference session between a customer and a bank representative based on prior conferences involving the customer and/or a bank representative. As such, the system allows for self-directed and/or computer-aided adjustment of levels of connectivity during a conference.
US08942682B2
A network element comprises a radio frequency (RF) transceiver module and a signal processing module operably coupled to the RF transceiver module and arranged to enable at least one telephony connection to be established over a first communication network between the network element and a plurality of local wireless communication units. The signal processing module is further arranged to enable a piconet to be established where the piconet comprises the network element and the plurality of wireless communication units. The signal processing module is further arranged to establish a common telephony connection between the piconet and at least one remote device over a second communication network.
US08942669B2
One or more servers may: receive information regarding a content file stored by a device; provide information associated with a first cost value corresponding to a cost to deliver the content file from the device to a user device; receive a delivery instruction directing the one or more servers to provide a portion of the content file to the user device via one or more ports or via one or more access points, each of the one or more ports or the one or more access points being associated with respective one or more second cost values; generate a key associated with the information regarding the content file and with the delivery instruction; receive an indication of selection of the key by the user device; deliver, to the user device, the portion of the content file via the one or more ports or the one or more access points.
US08942668B2
IMS networks and associated methods are disclosed that provide charging for CAMEL services provided in the IMS network. If a CAMEL service is provided by an application server for a session in an IMS network, then the application server generates CAMEL charging data for the service provided and also generates a charging message, such as a Diameter ACR message. The application server includes the CAMEL charging data in the charging message and transmits the charging message to a charging collector system. The charging collector system generates a CDR for the session, and maps the CAMEL charging data from the charging message to the CDR. The charging collector system then transmits the CDR to a billing system. The billing system may then charge for the CAMEL service provided in the IMS network.
US08942667B2
The subject matter disclosed herein relates in one particular implementation to a method, apparatus, and/or system for transmitting, by a location server, a location identifier to a mobile device. The location identifier may be transmitted from the mobile device to one or more trusted entities. Access to a location estimate of the mobile device may be selectively authorized at least partially in response to a request received at the mobile device from the location server including the location identifier.
US08942666B2
The present invention is directed to systems and methods for providing emergency messages to a mobile device. In an exemplary embodiment, a system for communicating emergency messages is provided comprising a mobile device comprising an emergency message application and a personal emergency message transceiver, an emergency message control center, wherein the emergency message application is enabled to receive a plurality of emergency messages generated by the emergency message control center.
US08942663B2
Methods and apparatus for supporting emergency communications are provided. A method for a Radio Access Network (RAN) serving at least one Core Network (CN) to support emergency communications of a User Equipment (UE) includes determining whether at least one CN in a shared network environment supports emergency communications, if it is determined that the at least one CN in the shared network environment supports emergency communications, transmitting an emergency call support indication to the UE indicating that emergency communications are supported, receiving a request for emergency communications from the UE, and routing the request for emergency communications to another CN that supports emergency communications in the shared network environment, if a given CN does not support emergency communications.
US08942643B2
An apparatus is provided. A plurality of transceiver antennas are arranged to form a phased array, where each antenna include a differential transmit antenna and a differential receive antenna arranged in a first pattern. A plurality of transceivers are arranged in a second pattern that is substantially symmetrical, and each transceiver is associated with at least one of the transceiver antennas and includes a feed network. Each feed network has a power amplifier (PA), a first matching network that is coupled between the PA and its associated transmit antenna so as to translate the phase of each differential transmit signal, a low noise amplifier (LNA), and a second matching network that is coupled between the LNA and its associated receive antenna so as to translate the phase of each differential receive signal.
US08942641B2
According to one embodiment, an antenna apparatus comprises an antenna element connected to a feeding point, a grounded first lumped constant element connected to the antenna element, and a grounded second and third lumped constant elements connected to the antenna element through a selector. The selector is configured to connect the grounded second lumped constant element to the antenna element in order to lower a resonant frequency of the antenna element, and to connect the grounded third lumped constant element to the antenna element in order to raise the resonant frequency of the antenna element.
US08942639B2
For interference control, a sector m estimates interference observed from terminals in neighbor sectors and obtains an interference estimate. Sector m may generate an over-the-air (OTA) other-sector interference (OSI) report and/or an inter-sector (IS) OSI report based on the interference estimate. Sector m may broadcast the OTA OSI report to the terminals in the neighbor sectors. These terminals may adjust their transmit powers based on the OTA OSI report. Sector m may send the IS OSI report to the neighbor sectors, receive IS OSI reports from the neighbor sectors, and regulate data transmissions for terminals in sector m based on the received IS OSI reports. Sector m may control admission of terminals to sector m, de-assign admitted terminals, schedule terminals in sector m in a manner to reduce interference to the neighbor sectors, and/or assign the terminals in sector m with traffic channels that cause less interference to the neighbor sectors.
US08942623B2
Methods, apparatuses, systems, and computer-readable media for reducing Near Field Communication (NFC) Peer Mode connection times are presented. According to one or more aspects, a mode switching interval associated with an NFC device discovery loop may be defined. A first portion of the mode switching interval may be assigned to polling operations. A second portion of the mode switching interval may be assigned to listening operations. The first portion and the second portion of the mode switching interval respectively may occupy less than all of the mode switching interval, and the second portion of the mode switching interval may be shifted in position within the mode switching interval for respective iterations of the NFC device discovery loop.
US08942617B2
A drive transmission unit includes a rotation input shaft to bear rotatably and coaxially a first input rotary body that rotates in a first direction and a second input rotary body, and a rotation output shaft to bear rotatably and coaxially a first output rotary body disposed in a radial direction of the first input rotary body and a second output rotary body disposed in the radial direction of the second input rotary body. A first switching device is disposed on the rotation input shaft and switches between a power transmitting state and a non-transmitting state between the first input rotary body and the second input rotary body. A second switching device is disposed on the rotation output shaft and switches between the power transmitting state and the non-transmitting state between the first output rotary body and the second output rotary body.
US08942611B2
A fixing device includes: a fixing member that transports a recording medium on which a toner image has been transferred to fix the toner image to the recording medium; an endless belt member that rotates with a front surface of the belt member contacting the fixing member; a guide member that guides the belt member to a contact portion at which the belt member and the fixing member contact each other; plural rotational-direction projections formed on a guide surface of the guide member facing a back surface of the belt member and disposed at intervals in a rotational axis direction of the belt member, the rotational-direction projections extending in a rotational direction of the belt member and projecting toward the back surface; and an intersecting-direction projection formed on the guide surface, the intersecting-direction projection extending along an intersecting direction that intersects the rotational-direction projections and projecting toward the back surface.
US08942609B2
A mounting structure for a bearing member comprises the bearing member, bearing a rotary shaft; a frame body that includes a mounting hole; and a plurality of projections, each of the projections being formed at one of three or more positions on at least one of an outer circumferential surface of the bearing member and an inner circumferential surface of the mounting hole, the positions extending radially from a center of the rotary shaft, the bearing member being press fitted into the mounting hole via the projections, each of the projections being formed at a circumferential position having no other projection formed at a position 180° therefrom with respect to the center of the rotary shaft.
US08942592B2
A process cartridge usable with an electrophotographic image forming apparatus, a main assembly of which is not provided with a mechanism for moving a main assembly side engaging portion provided in the main assembly to transmit a rotational force to an image bearing member in the direction of the rotational axis of the image bearing member by an opening and closing operation of a cover member for the main assembly. The process cartridge can be mounted to the main assembly in a direction substantially perpendicular to the rotational axis of the image bearing member without deterioration of the usability performance. With the process cartridge, the electrophotographic image forming apparatus can be downsized. in accordance with the movement of the process cartridge when the process cartridge is dismounted from the main assembly of the electrophotographic image forming apparatus, a coupling member which is inclinable and translatable relative to a rotational axis of a rotational force transmitted member enters an inside of the recess of the main assembly side engaging portion to receive the rotational force from the main assembly engaging portion.
US08942589B2
A fixing apparatus includes a film, a heater that contacts the inner face of the film and is capable of changing heat distribution, and a pressure member that forms the nip portion with the heater via the film, the pressure member including a region on which a diameter is increased from a center portion toward an end portion, wherein the fixing apparatus performs heater control so that a ratio of an amount of heat generation at the end portion of the heater to an amount of heat generation at the center portion of the heater is changed based on a temperature of the end portion of the pressure member, during a period at least from when the warm-up of the fixing apparatus is started until the recording material reaches the nip portion.
US08942585B2
An image forming apparatus includes an image forming part that forms a developer image, transfers the developer image to an intermediate transfer belt at a first transfer position and the developer image on the intermediate transfer belt to a sheet at a second transfer position. The image forming apparatus includes a detection part located between the first transfer position and the second transfer position and configured to detect a concentration of the developer image; and a controller configured to start a transfer of a concentration detection pattern that is a developer image for concentration detection during a period from when the developer image for print is transferred to the intermediate transfer belt to when the developer image for print is transferred to the sheet, and then to control the detection part to read the concentration detection pattern.
US08942571B2
In a light communication system, a data embedding unit arranged between a transmitter-side communication data processing unit and a light emitting device driver embeds a communication processed data at a spatial domain of an original image according to a modulation scheme, and gets multiple RGB values for a communication data embedded image. A receiving apparatus detects a transmitter-side communication data embedded image, generates a receiver-side communication data embedded image, compensate a deformation of the receiver-side communication data embedded image, outputs a warped communication data embedded image, and extracts a communication processed data from the warped communication data embedded image.
US08942564B2
Methods and apparatus for communicating information using visible light signals and/or radio signals
A user equipment (UE) device includes a VLC receiver including a photodiode and a radio receiver. The UE device supports a plurality of alternative technologies, communications protocols, and/or frequencies. During a first mode of operation, e.g., a discovery mode, a low reverse bias voltage value is applied to the photodiode. The low reverse bias voltage is adequate to support the recovery of small amounts of communicated information, and the power consumed by the battery of the UE device is relatively low. During discovery, information communicated includes, e.g., a light transmitter ID, an access point ID, services available at the access point, configuration information for a light receiver and/or for an auxiliary radio receiver. During a second mode of operation, e.g., a data traffic mode, the reverse bias voltage applied to the photodiode is set to a high reverse bias voltage to support higher data rate using VLC.
US08942557B2
Methods and systems are disclosed including receiving, by circuitry of a node conforming to GMPLS protocol, a signal comprising at least one of an optical signal attribute indicative of parameters of a super-channel, the super-channel including a plurality of optical carriers, each of which having a corresponding one of a plurality of wavelengths and being modulated to carry a corresponding one of a plurality of data streams, the super-channel being provisioned in the optical network as one optical channel, wherein the optical signal attribute is one of: quantity of wavelengths of the super-channel, wavelength center frequency of the super-channel, wavelength modulation of the super-channel, wavelength baudrate of the super-channel, and wavelength FEC type of the super-channel. The node further receiving information indicative of frequency slices in use by the super-channel and calculating, using algorithms conforming to CSPF-TE protocol, a path of a second super-channel.
US08942555B2
A system and method for Passive Optical Networks (PON) providing integration (cross-correlation) of powersave and fiber protection, optionally with encryption, facilitating the successful operation and/or benefits that can be gained when operating a PON system with these features. A major problem with power save is the detection, since both the OLT and the ONUs rely on a valid signal in order to detect fiber failure. However, the OLT may not detect this for sleeping ONUs, and an ONU in Tx/Rx sleep-mode, may not detect a fiber failure, and may not be aware of the OLTs switchover. In addition to solving the problem of combined fiber protection and power savings, a solution is also needed for providing security for this combination.A current embodiment is a system and method for Passive Optical Networks (PON) providing integration (cross-correlation) of powersave and fiber protection, optionally with encryption.
US08942554B2
A camera viewfinder viewer accessory mountable on a camera includes an elongated body portion having first and second ends and a longitudinal axis extending from the first end to the second end. A light-transmitting passageway extends through the body portion from the first end to the second end. A connector is disposed adjacent to the first end. The body portion second end includes an angled face disposed at a generally 45° angle relative to the longitudinal axis. An eyepiece is connected to the body portion second end adjacent the angled face. The eyepiece has a longitudinal axis generally disposed at an angle that is 45 degrees relative to the longitudinal axis of the body portion. A viewfinder image is directed from the camera viewfinder along the longitudinal axis of the body portion, the image is redirected along the longitudinal axis of the eyepiece, to be viewed through the eyepiece.
US08942552B2
A pipe having at least two steel pipe elements with internal lining that are assembled together end to end, with the ends of the two pipe elements being welded together. A tubular junction sleeve is interposed inside the pipe at the abutting ends of the two pipe elements so that the end terminal portions of the sleeve are at least in part in leaktight contact with respective ones of the terminal portions at the ends of the internal linings of the two pipe elements. The leaktight contact zone is a zone of fusion welding together the materials in mutual contact constituting at least a portion of each terminal portion of the sleeve and of each respective terminal portion of the lining. At each of the terminal portions of the sleeve in the leaktight contact zone, the tubular junction sleeve presents a Joule effect heater wire arranged in a double spiral on the outer surface of each terminal portion at the ends of the sleeve.
US08942550B1
A kit for supporting and multi-directionally aiming a heat source. The kit includes a heat air gun, a tripod, and an extension arm. The tripod and/or the extension arm support(s) the heat air gun so as to allow the heat air gun to be supported while having multi-directional aiming.
US08942548B2
Playback and distribution systems and methods for multimedia files are provided. The multimedia files are encoded with flags associated with the content data of the multimedia files. Through the use of the flags, playback of the content is enhanced without significantly increasing the file size of the multimedia file.
US08942543B1
Methods, systems, and software are provided herein that allow for storing a data file in a storage device. The storage system splits a video data file into a plurality of data segments, generates a plurality of recovery headers for the data segments, and combines ones of the recovery headers with ones of the data segments to form a plurality of storage packets.
US08942533B2
A system and method allows a user to enter a command capture audio, video, and/or still pictures that commence at a moment in time earlier than entering the command.
US08942532B2
The invention relates to a cable gland (1) having a flange (3) and a plug-in part (2) suited for an operational connection to the flange (3). The plug-in part (2) comprises a locking sleeve (4), and a fastener (7) for a connector (8), said fastener being operatively connected to said locking sleeve by way of a control slide (10). The control slide (10) is configured such that a rotation of the locking sleeve (4) around the longitudinal axis (x) of the plug-in part (2) results in an axial displacement of the fastener (7) in a longitudinal direction.
US08942520B2
In the optical waveguide board, simultaneously with pattern formation of mirror members at arbitrary positions on a clad layer 11, guiding patterns 14 having convex shapes are formed respectively at arbitrary positions on peripheral parts of mirror patterns 13, and the mirror patterns 13 are worked into tapered shapes. Next, in a state that a mask member 100 having through holes at desired positions, and the guiding patterns 14 are guided by mating, a metal film is formed on surfaces of slope parts 22 of the mirror patterns and the guiding patterns 14. Furthermore, in a state that the guiding patterns 14 and the photomask 16 are guided, wiring core patterns 20 are formed on the clad layer 11 adjacent to the mirror patterns 13.
US08942519B2
A polarization splitter and rotator of a wafer chip, an opto-electronic device and method of use is disclosed. The first waveguide of the wafer chip is configured to receive an optical signal from an optical device and propagate a transverse electric eigenstate of the received optical signal. The second waveguide is configured to receive a transverse magnetic eigenstate of the received optical signal from the first waveguide. The second waveguide includes a splitter end, a middle section and a rotator end, wherein the splitter end includes a layer of polycrystalline silicon, a layer of silicon oxide and a layer of silicon nitride, the rotated end includes a layer single crystal silicon, a layer silicon oxide and a layer of silicon nitride, and the middle section includes layers of single crystal silicon, silicon oxide polycrystalline silicon and silicon nitride.
US08942516B2
An optical circulator includes a first optical isolator including a first port and a second port and a plurality of optical isolators coupled to the second port of the first optical isolator. Each of the plurality of optical isolators comprise a first port and a second port.
US08942507B2
The signal processing method of the present invention produces interpolated signal values in an image signal by an inverse discrete cosine transformation with a set of frequency coefficients by decreasing an interval for reproduction of pixel signal values, wherein a set of frequency coefficients is provided by a discrete cosine transformation and is compensated for the frequency response caused by dividing pixels. According to the invention, an image signal similar to that obtained with a solid-state imaging device constructed by divided pixels is provided. Hence, even when the number of horizontal pixels and/or the number of vertical pixels of the solid-state imaging device are a half of that of a display apparatus used, an image signal suitable to the display apparatus can be produced.
US08942495B2
Methods and devices for encoding and decoding data using transform domain filtering are described. The encoder determines a set of transform domain filter coefficients to be applied to a transform domain prediction. The filtering may, in some cases, also apply to transform domain reconstructions. Rate-distortion optimization may be used to determine the optimal filter coefficients on a frame-basis, coding-unit-basis, or other basis. Multiple filters may be developed and communicated from the encoder to the decoder for different combinations of transform block size, coding mode, prediction mode, and texture type. In other cases, the filtering is applied in the pixel-domain to a pixel-domain prediction or a pixel-domain reconstruction of a block of samples.
US08942490B2
A method of compressing an image is provided by saving compressed color components into temporary buffers. In different time slots, compressed color components are stored in different temporary buffer. When data in the temporary buffers reach a predetermined size, data are moved to a second buffer larger than the temporary buffers. When the second buffer stores a predetermined amount of data, data are moved to an external memory.
US08942489B2
A vector graphics classification engine and associated method for classifying vector graphics in a fixed format document is described herein and illustrated in the accompanying figures. The vector graphics classification engine defines a pipeline for categorizing vector graphics parsed from the fixed format document as font, text, paragraph, table, and page effects, such as shading, borders, underlines, and strikethroughs. Vector graphics that are not otherwise classified are designated as basic graphics. By sequencing the detection operations in a selected order, misclassification is minimized or eliminated.
US08942485B2
An electronic device stores haar-like features and geometrical features of an object. A reference image of the object is created according to the geometrical features of the object. An outline image is obtained from each image of the object. The electronic device calculates derivatives of each two adjacent points on the reference image and each outline image. A derivative matrix of the reference image and a derivative matrix of each outline image are generated. The electronic device generates a first derivative curve corresponding to the derivative matrix of the reference image and a second derivative curve corresponding to each derivative matrix of the outline image. When all the second derivative curves are the same as the first derivative curve, the electronic device determines whether each outline image is corresponding to the object by using the haar-like features of the object.
US08942480B2
A system is provided to correlate a medication package with a prescribed medication for a patient. The medication package accommodates an intended patient medication. The system includes an optical imager adapted to read an encoded symbol character comprising encoded patient information and further adapted to image an attribute of the medication package. The optical imager comprises a two-dimensional image sensor array and an imaging lens for focusing an image on the two-dimensional image sensor array. The two-dimensional image sensor array has a plurality of pixels formed in a plurality of rows and columns of pixels. The optical imager further includes a digital link to transmit a segment of data. The segment of data includes the patient information encoded in the encoded symbol character and the attribute of the medication package.
US08942470B2
Providing sentiment classification of out of domain data are disclosed herein. In some aspects, a source domain having a trained classifier is matched to a target domain having a target classifier. The trained classifier may include identifiers that may be used to predict the sentiment of opinion data for the source domain. The target classifier may use the identifiers of the trained classifier to determine the sentiment of opinion data for the target domain.
US08942461B2
A banknote detector device for an automatic teller machine, for differentiating between non-accepted and accepted banknotes, includes a banknote image sensor to receive and scan at least one face of an input banknote and to store a banknote image (BI) of each scanned. The image includes image data in the form of a number of pixels; and a reference banknote image (RBI) storage where one reference banknote image, being processed from a predetermined number of banknote images from accepted banknotes, is stored for each face of each banknote. The device includes an alignment, a banknote face classification unit, a printed pattern positioning unit and a comparison unit where, for at least one face of the banknote, the BI and RBI, being in exact pattern position in relation to each other, are compared pixel per pixel according to a predefined comparison procedure to classify the banknote as accepted or non-accepted.
US08942452B2
A method and apparatus for smoothing random event data obtained from a Positron Emission Tomography (PET) scanner. The method includes obtaining initial random event data u(s, φ, t=0)=u0(s, φ), corresponding to t=0, calculating second-order central differences uss, uφφ with respect to s, φ, calculating a gradient ut, using ut=2(uss+uφφ)−λ(u−u0), where λ is a constant parameter, and updating the random event data using u(s, φ, t2)=u(s, φ, t1)+Δt ut, where Δt=t2−t1, t1=0 in a first iteration, and Δt is greater than 0. The method repeats the steps of calculating the second-order central differences, calculating the gradient, and updating the random event data until a change in u(s, φ, t) from a previous iteration is less than a predetermined threshold value.
US08942451B2
The current invention provides a method of identifying a ischemic lesion. The method includes loading perfusion imaging data into an electronic memory element and deriving perfusion maps from the perfusion imaging data, where the perfusion maps include a cerebral blood volume (CBV) map and an arterial delay time (DT) map, which utilize arterial delay and dispersion effects. Ischemic pixels are determined from the perfusion imaging data, where the DT is greater than a predetermined first threshold value and the CBV is below a second threshold value and the infarct portion of the ischemic lesion is determined, where DT is greater than a predetermined third threshold value and/or the CBV is below a forth threshold value. A cluster analysis is applied to all of the determined ischemic lesion and infarct pixels and the penumbra is then determined, where mismatch regions between the ischemic lesion and the infarct core define the penumbra.
US08942449B2
A method of providing image data for constructing an image of a region of a target object, comprising providing a reference diffraction pattern of a reference target object; determining an initial guess for a probe function based upon the reference diffraction pattern; and determining, by an iterative process based on the initial guess for the probe function and an initial guess for an object function, image data for a target object responsive to an intensity of radiation detected by at least one detector.
US08942448B2
There is provided an image processing device including a body hair detection unit that detects a body hair region corresponding to body hair from a process target image that includes skin, a texture structure estimation unit that estimates a structure of skin texture in the process target image, and an interpolation unit that interpolates the body hair region detected by the body hair detection unit based on the structure of the skin texture estimated by the texture structure estimation unit.
US08942444B2
An imaging system includes an analog-to-digital converter configured to convert an analog pixel value into a first digital pixel value. The imaging system also includes an index value source configured to receive the first digital pixel value from the analog-to-digital converter and to generate a digital index value based on a comparison of the first digital pixel value to a digital reference value. In addition, the imaging system includes a transmitter in communication with the index value source and configured to transmit the digital index value. Further, the imaging system includes an image processing component configured to receive the digital index value and to generate a second digital pixel value based at least in part on the received digital index value and a lookup table of the image processing component.
US08942432B2
The present invention relates to a system and a method for comparing information contained on at least two documents belonging to an entity. The present invention includes at least one device configured to receive information from at least one first document and at least one second document; then, compare at least one first document information and at least one second document information; and determine whether at least one second document contains at least one first document information. The present invention then outputs a result of whether the at least one second document contains at least one first document information.
US08942427B2
A three-dimensional (3D) image display device may display a perceived 3D image. A location tracking unit may determine a viewing distance from a screen to a viewer. An image processing unit may calculate a 3D image pixel period based on the determined viewing distance, may determine a color of at least one of pixels and sub-pixels displaying the 3D image based on the calculated 3D image pixel period, and may control the 3D image to be displayed based on the determined color.
US08942424B2
A method of image processing. An expected band-averaged spectral radiances image vector is simulated from training hyperspectral data and at least one filter transmittance function corresponding to the at least one optical filter. A simulated measured band-averaged spectral radiances image vector is simulated from the training hyperspectral data and the at least one transmittance function. A realistic measured band-averaged spectral radiances image vector is provided from at least one optical filter. A cross-correlation matrix of the expected band-averaged spectral radiances image vector and the realistic measured band-averaged spectral radiances image vector is calculated. An auto-correlation matrix of the simulated measured band-averaged spectral radiances image vector is calculated. An optimal out-of-band transform matrix is generated by matrix-multiplying the cross-correlation matrix and an inverse of the auto-correlation matrix. A realistic recovered band-averaged spectral radiances image vector is generated by matrix-multiplying the optimal out-of-band transform matrix and the realistic measured band-averaged spectral radiances image vector, the realistic recovered band-averaged spectral radiances image vector being free of out-of-band effects.
US08942413B2
A digital watermark embedding apparatus includes an interface circuit which acquires video data and digital watermark information, and a processor which embeds the digital watermark information into the video data. The processor is adapted to, for each symbol contained in the digital watermark information, set a time segment, cause the area of a watermark pattern formed by a plurality of pixels having a prescribed value, and superimposed on each image contained in the video data, to vary in periodic fashion over time in the time segment according to the value of the symbol contained in the digital watermark information, and correct, using the prescribed value, the value of each pixel contained in a region where each image in the video data and the watermark pattern corresponding to that image overlap each other.
US08942401B2
It is an object to provide an electro-acoustic converter which can be subjected to air leakage test allowing a gas to pass through a waterproof film in such a condition that the waterproof film is attached to the electro-acoustic converter. An electro-acoustic converter is produced, which includes: a casing having a sound hole; and a diaphragm provided in the casing, wherein the sound hole is covered with the waterproof film to form a closed space, and the closed space is in communication with the outside of the casing through a vent for air leakage test.
US08942398B2
Disclosed herein, among other things, are methods and apparatus for improved feedback cancellation for hearing assistance devices. In various embodiments the present acoustic feedback cancellation system is configured to identify the onset of acoustic feedback. This early detection is accomplished in a variety of ways, including detection of an exponential rise in a periodic signal which is associated with early acoustic feedback. The present system is very rapid and so it can operate when the conditions surrounding the hearing aid change quickly. It also is useful to not impose feedback cancellation to longer notes that will “fool” less sophisticated acoustic feedback cancellers into thinking the sound is feedback.
US08942397B2
A method and apparatus for adding audible noise with time varying volume to audio devices are disclosed which makes the time varying volume envelope of the added audible noise proportional to the time varying volume envelope of sound for frequencies where an individual has a restricted range of perception. The method and apparatus are used to improve the audibility, speech intelligibility, and word recognition characteristics in audio devices.
US08942385B1
A headphone comprises a plurality of actuatable equalization selectors. Each of the selectors corresponds to an equalization setting that includes a preset distribution of relative amplitudes of sounds in predetermined frequency ranges. In one embodiment, each of the plurality of actuatable equalization selectors is a button-type switch. A knob-type switch or a voice recognition mechanism could also actuate an equalization setting. In a preferred embodiment, an equalizer identification indicator produces a communication perceivable to a headphone wearer and which corresponds to an equalization setting. The communication can be audible, preferably a human voice, or tactile, preferably vibration patterns corresponding to equalization settings.
US08942383B2
Techniques associated with an acoustic vibration sensor are described, including a first detector that receives a first signal and a second detector that receives a second signal and a third signal, wherein the first signal comprises a skin surface microphone signal, a static equalization filter coupled to the first detector and configured to generate an equalized first signal, a voice activity detector coupled to the first detector, and a wind detector coupled to the second detector, the wind detector configured to correlate the second signal and the third signal and to derive from the correlation a plurality of wind metrics associated with a wind noise, the wind detector is further configured to determine a magnitude associated with the wind noise, to determine whether to suspend an activity of the system, and to determine a duration of time that the magnitude associated with the wind noise exceeds a threshold.
US08942367B1
A method and apparatus for routing a call based on electronic calendar entries in a communications network is described. In one embodiment, a call request to establish a connection with a subscriber of network services is received. An electronic calendar associated with the subscriber is subsequently accessed. Afterwards, the call request is routed to a phone number associated to a present agenda activity detailed in the electronic calendar.
US08942364B2
A centralized network system allows users at different remote sources to initiate a process to disable recording of different communication signals from the different remote sources. The communication signals are received from the different remote sources during conferences. A user request is also received from one of the remote sources to disable recording of one of the different communication signals. Users at multiple of the different remote sources are simultaneously authorized and enabled to begin a process to disable recording of one of the different communication signals.
US08942361B2
A method of controlling free phone calls places from within a secured premises through an institutional phone system generally includes assigning a unique access identifier to an individual caller upon entry into the secured premises; receiving a destination number from the individual caller within the secured premises, the destination number being associated with a telephone located outside the secured premises; determining if the destination number is a per se free number, and, if the destination number is not determined to be a per se free number: receiving the unique access identifier from the individual caller; validating the unique access identifier; and, if the unique access identifier is valid, processing a telephone call to the destination number.
US08942360B2
Methods and computer-readable media provide presenting a customized message to an incoming calling party and for allowing the calling party to save or forward the customized message. A called party submits a customized message to an intelligent network component of her telecommunications service provider along with identifiers for specified incoming callers who are to receive the customized message upon calling the called party. After the customized message is prepared, incoming callers who have been associated with the customized message are presented with the customized message before being connected to the called party. If the incoming call is not from a telephone directory number associated with the customized message, the incoming call is processed according to normal call processing methods.
US08942358B2
A unified messaging system which can provide messaging services for a plurality of different “message types” is disclosed. The unified messaging system can serve as a single interface to a number of messaging services provided by various messaging components which use different message types (e.g., mail server). A unified message type is implemented and presented to a user as an abstract message. In addition, the unified messaging system can automatically determine, based on a first selected feature, if one or more message types should be used. A particular message type can also be automatically selected as a “best message type” based on one or more selected options.
US08942353B2
A system and method for x-ray tube components is disclosed. The method of fabricating an x-ray tube component includes providing a powder into an electrically conductive die constructed to have a cavity shaped as the x-ray tube component being fabricated and simultaneously applying a mechanical pressure and an electric field to the die so as to cause sintering of the powder and thereby fabricate the x-ray tube component, wherein the electric field applied to the die directly passes through the die to the powder, so as to generate heat internally within the powder responsive to the applied electric field.
US08942351B2
Provided herein are systems and methods for operating a traveling wave linear accelerator to generate stable electron beams at two or more different intensities by varying the number of electrons injected into the accelerator structure during each pulse by varying the width of the beam pulse, i.e., pulse width. The electron beams may be used to generate x-rays having selected doses and energies, which may be used for cargo scanning or radiotherapy applications.
US08942346B2
Systems and methods for obtaining and displaying a collimated X-ray image are described. The methods can include providing an X-ray device having an X-ray source, a square or rectangular X-ray detector, and a collimator. The collimator can be sized and shaped to collimate an X-ray beam from the X-ray source that exposes a receptor region on the detector. The collimator can allow the X-ray image received by the X-ray detector to have any suitable shape that allows a relatively large view of the image to be displayed and rotated on the display device without changing the shape or size of the image as it rotated. In some instances, the collimator provides the image with superellipse shapes or cornerless shapes having four substantially straight edges with a 90 degree corner missing between at least two edges that run substantially perpendicular to each other. Other embodiments are described.
US08942344B2
A method for determining the concentration of an element in a material includes irradiating the material with an X-ray beam having a continuum in the area of an absorption edge of the element to be measured. The intensity of the transmitted X-ray beam is measured with an energy dispersive sensor. The intensity of the transmitted X-ray beam in an energy interval above the absorption edge and in an energy interval below the absorption edge is determined. The concentration of the element is computed on the basis of said intensities.
US08942343B2
Systems and methods for automatically and dynamically modifying an image acquisition parameter for use in tomosynthesis breast imaging. A selected image acquisition parameter is modified in response to a measured characteristic of an imaged object such as a breast, and thus tailored to provide the highest quality image for the particular object. For example, image quality in a breast tomosynthesis system can be improved by dynamically varying motion and other acquisition parameters of the tomosynthesis system in response to physical characteristics of the breast to be imaged (determined during image acquisition), such as the breast thickness, density or composition. Dynamically varying acquisition or processing methods helps to customize the system for each particular patient, thereby improving image quality and identification and assessment of potential pathologies and abnormalities, and lower radiation dose, and thus a reduced the risk of long-term adverse health effects due to lifetime accumulated radiation dose.
US08942340B2
A tetrahedron beam computed tomography system including an x ray source array that sequentially emits a plurality of x ray beams at different positions along a scanning direction and a collimator that intercepts the plurality of x-ray beams so that a plurality of fan-shaped x-ray beams emanate from the collimator towards an object. The system includes a first detector receiving a first set of fan-shaped x ray beams after they pass through the object, the first detector generating a first imaging signal for each of the received first set of fan-shaped x-ray beams and a second detector receiving a second set of fan-shaped x ray beams after they pass through the object, the second detector generating a second imaging signal for each of the received second set of fan-shaped x-ray beams. Each detector and source pair form a tetrahedral volume. In other embodiments, the system may also have more than two detectors arrays and/or more than one source array. Each pair of source array and detector array forms a tetrahedral volume. Using multiple detector arrays and source arrays can increase field of view, reduce the length of detector and source arrays so that the imaging system is more compact and mobile.
US08942339B2
A shift register is disclosed, which can prevent malfunctioning of device by decreasing the load on a discharging voltage source line, and can decrease a size of stage. The shift register comprises a plurality of stages to sequentially output scan pulses through respective output terminals, wherein each of the stages comprises a pull-up switching unit controlled based on a signal state of node, and connected between the output terminal and any one among a plurality of clock transmission lines to transmit the clock pulses provided with sequential phase differences; and a node controller to control the signal state of node, and to discharge the node by using the clock pulse from any one among the plurality of clock transmission line.
US08942327B2
The present invention employs hierarchical modulation to simultaneously transmit information on different modulation layers using a carrier RF signal. Initially, first data to be transmitted is assigned to a first modulation layer and second data is assigned to a second modulation layer. In one embodiment of the present invention, the first and second data are assigned based on reliability criteria. The first and second modulation layers are hierarchical modulation layers of the carrier RF signal. Once assigned, the first data is transmitted using the first modulation layer of the carrier RF signal and the second data is transmitted using the second modulation layer of the carrier RF signal. In one embodiment of the present invention, information may be transmitted to one end user using one modulation layer, and information may be transmitted to a different end user using a different modulation layer.
US08942320B2
A method includes receiving a data unit that includes a signal (SIG) field and a data field. The SIG field provides information for interpreting the data field. The method also includes detecting a first symbol constellation rotation of at least a first orthogonal frequency division multiplexing (OFDM) symbol in the SIG field of the data unit, determining, based at least in part on the detected first symbol constellation rotation, a number of information bits per OFDM symbol in the SIG field of the data unit, processing the SIG field of the data unit according to the determined number of information bits per OFDM symbol in the SIG field, and processing the data field of the data unit according to the information for interpreting the data field as provided in the SIG field of the data unit.
US08942318B1
Briefly, a method and apparatus to calculate cross-correlation values of complex binary sequences are provided. The apparatus may include a transformation unit and a cross-correlator. The cross-correlator may include a cross-correlation controller to provide, based on a type bit and a sign bit, a real component and/or an imaginary component of signals of complex binary sequences to a real accumulator and/or to an imaginary accumulator.
US08942316B2
A method of operation of a wireless communication system includes: receiving a received signal; generating concurrently a first modulation data and a second modulation data from the received signal; calculating an error energy for the first modulation data and the second modulation data; and removing a residual Direct Current (DC) offset from the received signal based on determining a minimum of the error energy for the first modulation data or the second modulation data.
US08942313B2
An open loop envelope tracking system calibration technique and circuitry are proposed. A radio frequency power amplifier receives a modulated signal. An envelope tracker power converter generates a modulated power amplifier supply voltage for the radio frequency power amplifier based on a control signal derived from the modulated signal. A first output power and a second output power of the radio frequency power amplifier are measured when the control signal is respectively delayed by a first delay period and a second delay period. A sensitivity of the output power of the radio frequency power amplifier is near a maximum near the first delay period and the second delay period. The first delay period and/or the second delay period are adjusted until the first output power substantially equals the second output power. The first delay period and the second delay period are used to obtain a calibrated fine tuning delay offset.
US08942308B2
A multi-level coding and iterative decoding scheme using sparse space codes as the inner-code and codes amenable to belief propagation decoding methods (such as low-density parity-check (LDPC) codes, turbo codes, and trellis codes) as the outer-code is proposed for MIMO communication channels.
US08942301B2
In one embodiment, a transmitting device monitors transmission activity of each of a plurality of subcarriers in a communication network, and determines a set of unutilized subcarriers of the plurality of subcarriers. As such, the transmitting device may then transmit a data frame on one or more of the unutilized subcarriers to a receiving device while transmission activity is present on one or more utilized subcarriers within the network. In another embodiment, the transmitting device may also determine timing information associated with the transmission activity, and may correspondingly schedule the transmitting to optimize network performance based on the timing information.
US08942290B2
A system, apparatus, and method of compressing video data having at least one frame having at least one block having an array of pixels. The method includes transforming the pixels of the at least one block into coefficients, creating a default transmission order of the coefficients, creating an optimal transmission order of the coefficients, comparing a coefficient position of at least one of the coefficients in the optimal transmission order with a coefficient position of the at least one of the coefficients in the default transmission order; determining an update value based on the comparison, and selectively encoding position information of the at least one of the coefficients in the optimal transmission order based on the update value.
US08942285B2
Coding techniques for a video image compression system involve improving an image quality of a sequence of two or more bi-directionally predicted intermediate frames, where each of the frames includes multiple pixels. One method involves determining a brightness value of at least one pixel of each bi-directionally predicted intermediate frame in the sequence as an equal average of brightness values of pixels in non-bidirectionally predicted frames bracketing the sequence of bi-directionally predicted intermediate frames. The brightness values of the pixels in at least one of the non-bidirectionally predicted frames is converted from a non-linear representation.
US08942283B2
Systems and methods of processing video data are provided. Video data having a series of video frames is received and processed. One or more instances of a candidate feature are detected in the video frames. The previously decoded video frames are processed to identify potential matches of the candidate feature. When a substantial amount of portions of previously decoded video frames include instances of the candidate feature, the instances of the candidate feature are aggregated into a set. The candidate feature set is used to create a feature-based model. The feature-based model includes a model of deformation variation and a model of appearance variation of instances of the candidate feature. The feature-based model compression efficiency is compared with the conventional video compression efficiency.
US08942282B2
This disclosure describes techniques for coding video data. As one example, this disclosure describes a coded block pattern (CBP) for a coding unit (CU) of video data that indicates whether or not each of a luminance component (Y), a first chrominance component (U), and a second chrominance component (V) include at least one non-zero coefficient. According to another example, this disclosure describes a CBP that indicates whether respective blocks of a CU include at least on non-zero coefficient. The CBP described herein may be mapped to a single variable length code (VLC) code word. The VLC code word may be used by a coder to code the CU of video data.
US08942281B2
A method for processing signals transmitted via a connection and received by a digital interface, where individual data frames are transmitted by the signals as a sequence of modulated symbols, and where the received signals are corrected by an equalizer; the equalizer sampling the received signals, and an adaptation of the equalizer only taking place in particular time intervals in a manner controlled by a protocol.
US08942277B2
To improve throughput by reducing the resource used for transmitting a parameter relating to retransmission control and decreasing overhead of retransmission control signaling. Where a retransmission control method is employed with adaptive MCS control in which the encoding rate can be changed, the scheduling section sets the MCS in accordance with CQI notified from the communication counterpart apparatus. When transmission data is encoded, the RV parameter bit-number setting section sets the number of bits used for signaling the RV parameter to decrease as the encoding rate of the first transmission is decreased and sets the RV parameter based on the number of bits. For example, in a case where the encoding rate R is R>⅔, two bits are set. In a case where the encoding rate ⅓
US08942266B2
Embodiments are directed to systems and methods for correcting lateral and angular displacement of laser beams within a laser cavity. For some embodiments, such systems and methods are used to correct angular displacement of laser beams within a laser cavity that result from varying the lasing wavelength in a tunable laser system.
US08942265B2
In one embodiment, the instant invention provides a method that includes: outputting a first laser beam having: a beam quality factor (M2) between 1 and 5, and a spectral width of less than 0.15 nm, where the outputting is performed by a laser generating component that includes a alexandrite laser oscillator; converting the first laser beam through a first Raman cell to produce a second laser beam, where the first Raman cell is filled with a first gas; and converting the second laser beam through a second Raman cell to produce a final laser beam, where the second Raman cell is filled with a second gas and is operationally positioned after the first Raman cell, where the first gas and the second gas are different gasses, and where the final laser beam having: a second energy of at least 1 mJ, and at least one wavelength longer than 2.5 micron.
US08942264B2
A multiplexer is capable of multiplexing at least two signals selected from the first signal, the second signal and the null code signal. In a first mode, the multiplexer multiplexes the first signal and the null code signal consistent with a predetermined time sequence for expression of the null code in first precursor signal In a second mode, the multiplexer multiplexes the first signal and the second signal to provide a second precursor signal. A correlator can correlate the digital received composite signal to the locally generated reference signal to decode at least a first portion of the received composite signal or the entire received composite signal, depending upon the mode (e.g., operation in the first or second mode).
US08942263B2
A method for the transmission of data in a synchronous digital hierarchy (SDH) network comprising the steps of transmitting to a node of the network a form of data signal from outside the network, converting the signal into a virtually concatenated information structure and transporting the signal through the network in the virtually concatenated information structure; means for carrying out the method and tributary cards arranged and configured to process signals received in contiguously concatenated form to convert them into virtually concatenated form for transfer across the network; thus providing for data transmitted in high-bandwidth, contiguously concatenated signals (ie VC-4-4c) to be transported across a SDH network, not itself capable of carrying contiguously concatenated signals.
US08942250B2
Systems and methods for providing SRV node selection are provided. The method may include using an entry node to submit a query message in selected fields of a Device Attribute Information Element in L2ME protocol. The entry node may require an advanced service. The entry node may not be aware which node of the plurality of nodes is the node selected for supporting the advanced service on the network. The selected fields may include vendor specific fields. In response to the query message, the method may further include determining which of the plurality of nodes can be selected for supporting the advanced service on the network. The method may further include determining whether there is a one the plurality of nodes which has been selected for supporting the advanced service on the network.
US08942228B1
In one embodiment, a distributed, dynamic and call based feature controller election is executed in a distributed call processing system which is simple, robust, and consistent. The election is based on which VOIP telephone returns an appropriate SIP message first to a feature controller elector, which may be implemented on a proxy communicating with a wide area network.
US08942223B2
In 3GPP Release (Rel) 8, a primary synchronization signal (PSS) and a secondary synchronization signal (SSS) may be transmitted in six resource blocks, occupying, for example, the center 62 tones (i.e., subcarriers) of an LTE-A system, wherein the center tone may be skipped. In synchronous networks, cells may transmit their respective PSS and SSS on the same frequency at the same time, wherein strong cells may overshadow the weak ones. However, strong cells may not be the serving cell for a user equipment (UE), particularly in a heterogeneous network. Traditionally, interference cancelation, an enhanced receiver technique, has been used, wherein the UE may first find the strong cells and cancel them out to find the serving cell. However, due to propagation delay and synchronization uncertainty, a timing offset may exist among cells, even in synchronous networks. Therefore, systems and methods are disclosed, providing for improved handling of the timing offset among different cells by applying a time domain cancelation.
US08942220B2
An example of a method of policing a flow in a home network such as a MoCA network may include calculating a policing period, calculating a first credit parameter, initializing a first usage variable at a beginning of the policing period, receiving a packet at an ingress node, calculating the first usage variable based on a first formula, determining whether the first usage variable is less than or equal to the first credit parameter, and making a reservation request when the first usage variable is less than or equal to the first credit parameter. The reservation request is different from an opportunistic reservation request. Examples of a system and a computer program product having instructions stored in a tangible computer-readable storage medium are also provided.
US08942207B2
Beam selection is provided. A method for handover in a mobile station includes sending a scan request message for scanning a downlink (DL) beam with respect to a serving base station (BS) and a neighboring BS, to the serving BS, and receiving a scan response message; determining the DL beam for the MS by performing scanning with the serving BS and the neighboring BS based on the scan response message; sending a scan report message comprising a result of the scanning to the serving BS; when receiving an air-HO request message from the serving BS, generating an air-HO response message comprising information of a neighboring BS to which the MS hands over based on the air-HO request message; performing beam selection with the neighboring BS of the handover based on the air-HO request message; and performing the handover.
US08942205B2
Methods, apparatus and articles of manufacture for performing idle mode mobility measurements in a mobile network are disclosed. An example method in a user equipment (UE) disclosed herein comprises receiving, from the mobile network, a system information block (SIB) message specifying idle mode mobility measurement is to be performed. If the measurement parameter threshold is not configured in the SIB message or if the SIB message includes an indication to not use a configured measurement parameter threshold in the SIB message, the UE sets a measurement parameter threshold for idle mode mobility measurement.
US08942204B2
One or more nodes in a network provide access control for an in-bound handover of an access terminal to a closed subscriber group. For example, at least one of a source access point, a network node, or a target access point may determine whether handover is allowed based on whether a closed subscriber group identifier of the target access point is listed in closed subscriber group subscription information for the access terminal.
US08942200B2
A system and method which improve the performance of a wireless transmission system by intelligent use of the control of the flow of data between a radio network controller (RNC) and a Node B. The system monitors certain criteria and, if necessary, adaptively increases or decreases the data flow between the RNC and the Node B. This improves the performance of the transmission system by allowing retransmitted data, signaling procedures and other data to be successfully received at a faster rate, by minimizing the amount of data buffered in the Node B. Flow control is exerted to reduce buffering in the Node B upon degradation of channel qualities, and prior to a High Speed Downlink Shared Channel (HS-DSCH) handover.
US08942196B2
The present invention discloses a method for receiving downlink control information by a terminal in a wireless communication system. More specifically, the method comprises the steps of receiving a coordination field from a base station and receiving control information on more than one component carrier that is allocated to the terminal, on the basis of the coordination field, wherein the coordination field includes more than one parameter for decoding the control information on the more than one component carrier.
US08942183B2
The present invention discloses a method for assigning the carrier frequency in a trunking system, which includes: after the base station subsystem receiving a group call request, it assigns a carrier frequency reference for this group call, by which to establish the forward channels of the group users managed by the base station subsystem. With the method offered by the present invention, all the group members under a base station subsystem could be established on the same carrier frequency reference as far as possible, thereby sharing of the wireless channels.
US08942175B2
The present invention relates to a method for controlling an overload of a network, which may be generated due to a service request of a terminal in a mobile communication system of machine type communication (MTC). The invention controls a network overload and efficiently use network resources, by requesting activation of a particular MTC function to the network on the basis of information on changes in unnecessary MTC functions, without allowing a terminal to request (for example, attach request) the unnecessary MTC functions.
US08942171B2
The present disclosure relates to a technique for performing physical layer measurements on a frequency resource relative to other frequency resources in a telecommunications system operable to communicate over multiple frequency resources. A method aspect of this technique includes determining that a mobile terminal is to perform a physical layer measurement with regard to a first frequency resource, determining if there is data to be communicated over one or more second frequency resource(s) within a time period wherein the first frequency resource is distinct from the second frequency resources: if it is determined that there is no data to be communicated over the second frequency resource(s) within the time period, performing the physical layer measurement on the first frequency resource and forming a quality measure of the first frequency resource based on the physical layer measurement; or if it is determined that there is data to be communicated over the second frequency resource(s) within the time period, modifying the physical layer measurement and forming a quality measure of the first frequency resource based on the modified physical layer measurement.
US08942160B2
More than one communication device that is to simultaneously transmit identical data through multiple data transmissions using different radio wave multiplex types is determined based on the link qualities of a plurality of communication devices. Then the multiple data transmissions are made by transmitting the identical data with synchronized timings at the determined communication apparatuses. The link qualities are determined by measuring received signal intensities, bit error rates, or frame error rates at the respective communication devices at the time of the multiple data transmissions using two radio wave multiplex types orthogonal to each other.
US08942150B2
Systems and methodologies are described that facilitate evaluating and utilizing timing updates in a wireless communications network. A base station can transmit timing adjustment commands to mobile devices as needed as opposed to a periodic timing update where timing adjustment commands are always sent within a certain period. However, the mobile devices need to stay awake to monitor the timing adjustment message resulting in high power consumption. On the other hand with periodic update, the mobile devices can wake up to check whether there is a timing adjustment for itself and, if not, return to a sleep mode. With the proposed method, a mobile device can sleep for a period of time to check for timing adjustment commands upon waking. Thus, both the mobile power consumption and downlink signaling overhead are reduced.
US08942142B2
A method for improving ACK/NACK bundling in a user equipment (UE) of a wireless communication system is disclosed. The method includes steps of receiving an uplink grant allocated to an uplink sub-frame, the sub-frame being utilized for transmitting an HARQ feedback corresponding to a plurality of downlink sub-frame, a TDD UL/DL configuration of the UE being set to 0; and determining whether the UE misses any downlink assignment is missing according to a downlink assignment index (DAI) carried in a latest received Physical Downlink Control Channel (PDCCH) for downlink assignment.
US08942140B2
In order to parameterize, within a communication network, a bridge to be put in communication with at least one element to be connected to the bridge, the bridge comprising at least one created port, a parameter representing a predetermined waiting period and corresponding to a time for detection by the bridge, during a phase of listening to the data received by the at least one created port, of the presence of any communication loop within the network, is determined. A filtering of the at least one created port is activated, the filtering being adapted to prevent the sending and reception by the at least one created port of inter-bridge management messages. The bridge is configured with the parameter thus determined, a new port of the bridge is created with a view to setting up communication with the at least one element, and the filtering is deactivated.
US08942131B2
A method processes data in a packet-switched communication network having a plurality of network nodes, between which data packets are transmitted. Information contained in one data packet is extracted therefrom, the packet being received in a network node. One physical transmission parameter of the received data packet is ascertained, the physical transmission parameter specifies or is dependent on one property of the physical transmission of the received data packet. The received data packet is filtered based on a rule set, taking into account some of the extracted information and part of the physical transmission parameter, and further processed dependant on the filtering. An application of the method is “bootstrapping”, wherein network nodes are configured, cryptographic information being transmitted in the context of the configuration. A plausibility test of physical transmission parameters of the data packets that are transmitted during bootstrapping can ascertain whether an attacker is manipulating the bootstrapping process.
US08942128B2
Detection and prevention of heavy congestion in a wireless network is disclosed herein. Radio links are monitored and if the number of radio links reaches a first threshold level, one or more network parameters are modified in order shrink a cell footprint and/or to control cell reselection. The monitored radio links can be downlink circuit switched and packet switched radio links. Alternatively or additionally, an uplink noise level can be monitored and if the uplink noise level reaches a second threshold level, the one or more network parameters can be modified, even if the number of radio links are not at the threshold level.
US08942117B2
A frame time having a certain period of time is divided into: a time period (for inter-base-station time division multiplex communication) in which one of the base stations has a transmission right in the simultaneous transmission and carries out inter-base-station time division multiplex communication so as to avoid interference between the base stations; and a time period (for inter-base-station simultaneous communication) for communication which is simultaneously carried out between the plurality of base stations. Furthermore, the time periods are switched for the communication.
US08942110B2
A method applied to a wired network including a first network device and a second network device is disclosed. The first and second network devices each include a first set of connection ends and a second set of connection ends. Firstly, the first network device transmits a specific signal pattern through its first set and second set of connection ends. Then, the first network device detects whether a signal is received at its first set and second set of connection ends. If it is determined that a signal is not received at the first set connection ends while a signal is received at the second set connection ends, the first network device determines that its second set of connection ends is not correctly coupled to the second set of connection ends of the second network device.
US08942108B2
A differential protection system is provided. The differential protection system includes a local terminal configured to be communicatively coupled directly or indirectly with at least two remote terminals via at least three communication links to form a ring topology or a mesh topology. The differential protection system further includes a controller comprising a communication link decision unit and a clock unit associated with the local terminal. The communication link decision unit is configured to determine some of the at least three communication links as virtually disconnected such that the ring topology or the mesh topology is configured to be converted to a daisy chain topology. The clock unit is configured to time synchronize the local terminal with at least one of the at least two remote terminals when the local terminal and the at least two remote terminals are configured in the daisy chain topology.
US08942106B2
In one embodiment, a best exit from an autonomous system (AS) for a controlled prefix is determined. A network device of the AS influences a route for the controlled prefix to be over the best exit. Traffic statistics for the controlled prefix are selected. The network device verifies, based on the traffic statistics, whether the influence has caused at least a configured amount of traffic for the controlled prefix to be over the best exit. When at least the configured amount of the traffic is not directed over the best exit, the network device further influences the route for the controlled prefix to be over the best exit.
US08942101B2
A method of relaying data performed by a relay station in a wireless communication system based on time division duplex (TDD) is provided. The relay station receives downlink data from a base station and relays the downlink data to at least one mobile station in an uplink subframe which belongs to an unlinked subframe. Accordingly, uplink acknowledgement (ACK) collision can be avoided, and efficiency of resource allocation can be increased.
US08942100B2
Presented herein are techniques for detection and characterization of buffer occupancy of a buffer in a network device. Packets are received at a network device. The packets are stored in a buffer of the network device as they are processed by the network device. An occupancy level of the buffer is sampled at a sampling rate. Occupancy levels of the buffer over time are determined from the sampling, and traffic flow through the network device is characterized based on the occupancy levels.
US08942099B2
A method to realize IP flow mobility (IFOM) between 3GPP access and non-3GPP access over GTP based interfaces is proposed. A user equipment is connected to a PDN-GW via a 3GPP access network and a non-3GPP access network. The UE transmits an IFOM triggering message to the PDN-GW, which selects IP flows to be moved based on EPS bearer ID and IP flow description. The PDN-GW sends an Update Bearer Request to a WAG or ePDG, and updates its mapping table if the Update Bearer Request is successful. The UE also updates its mapping table upon receiving an IFOM acknowledgement from the WAG or ePDG. The PDN-GW initiates a 3GPP bearer modification procedure to move the selected IP flows.
US08942094B2
A switching network includes first, second and third switches coupled for communication, such that the first and third switches communicate data traffic via the second switch. The first switch is operable to request transmission credits from the third switch, receive the transmission credits from the third switch and perform transmission of data traffic in reference to the transmission credits. The third switch is operable to receive the request for transmission credits from the first switch, generate the transmission credits and transmit the transmission credits to the first switch via the second switch. The second switch is operable to modify the transmission credits transmitted by the third switch prior to receipt of the transmission credits at the first switch.
US08942090B2
A method for selective admission of traffic packets to a telecommunication switch having a limited throughput T and a common input queue, wherein the traffic packets comprise packets pre-assigned to higher and lower classes; in case of congestion at the common input queue of the switch, the method performs selective admission of the packets to the switch according to classes pre-assigned to them and depending on dynamic, recently utilized throughput of the switch.
US08942085B1
A multi-stage network may include a first stage having a first plurality of switches, a second stage having a second plurality of switches, and a number of links between the first and second stages. A controller in communication with the first plurality of switches and the second plurality of switches may determine a priority path to be utilized by each switch in sending information and a fallback path. If the priority path includes a failed link, the controller implements in one or more of the switches the fallback path for sending the information. The fallback path may, for example, cause the information to be transmitted through a peer router.
US08942081B2
According to one aspect of the present invention, antennas or antenna nodes spaced away from each other by a predetermined distance or more are configured to be able to transmit control information of mutually different user equipment groups, thereby increasing the efficiency in the operation of control channels. In addition, according to another aspect of the present invention, a resource region for transmitting control information for an improved user equipment, which is a target of a multi-node cooperative transmission, is set differently from a resource region for transmitting control information for a legacy user equipment, thereby increasing the efficiency in the transmission of the control information for the improved user equipment.
US08942079B2
A method for mapping wireless resources of reference symbols for channel state estimation and modulation symbols for user information transmission in a transmitter of an Orthogonal Frequency Division Multiplexing (OFDM) mobile communication system is disclosed. The mapping method includes channel-encoding and modulating a user information stream to be transmitted, and then generating a systematic symbol stream and a parity symbol stream; and preferentially arranging systematic modulation symbols in resource elements of a symbol including no reference symbol, and then arranging parity modulation symbols in remaining resource elements.
US08942072B2
Upon receiving a request to allocate a storage region, a storage device may initialize the contents of the storage device to default values (e.g., zero) in order to avoid problems arising from unknown data stored in the locations of the storage region (e.g., upon writing a data set to a location involved in a mirroring relationship, uninitialized data in the corresponding mirror location may result in a mismatch that jeopardizes the written data). However, initializing the storage device may be time-consuming and inefficient. Instead, a usage bitmap may be generated that, for respective location sets of the storage region, indicates whether values exist in the location. A read request may be fulfilled by examining the usage bitmap to determine whether values exist in the specified location, and if not, the default value may be returned without accessing the storage device. Other efficiencies may also be achieved using the usage bitmap.
US08942071B2
A system comprises a writer to form a plurality of color mits on a base material, wherein at least one of the color mits may represent computer-readable instructions comprising data other than pixel-image data. The plurality of color mits may include a first color mit and a second color mit, wherein the first color mit represents information data, and the second color mit represents that the first color mit contains a particular type of information data. The system also may include a reader to read colors of the plurality of color mits on the base material. The system may comprise a device to map at least one of the color mits to computer-readable instructions. The system may further comprise a processor configured to transmit signals using a colored light.
US08942068B2
A timepiece includes a case; a dial made from a nonconductive material; a solar panel that has an opening and is disposed at a side opposite of a display side of the dial, the solar panel receiving light incident from the display side of the dial; a patch antenna disposed (i) at a side opposite a light receiving side of the solar panel, and (ii) at a position overlapping the opening in plan view; and a date wheel made from a nonconductive material that is disposed between the solar panel and the patch antenna in lateral view, and is disposed at a position overlapping, at least in part, the patch antenna in plan view. The dial has a date window for exposing at least part of the date wheel, and the date window is formed at a position overlapping the opening in plan view.
US08942065B2
In a method and a device for determining the position of an object in relation to a vehicle, for use in a driver assistance system of the vehicle, a first ultrasound pulse is transmitted by an ultrasound sensor situated on the vehicle, the ultrasound pulse including multiple predefined transmission frequencies which result in a variation of the directional characteristic of the ultrasound sensor. The transmitted first ultrasound pulse is reflected on the object and is received again as a first echo pulse. A frequency spectrum of the first echo pulse is subsequently determined, and a first absolute value of a relative offset angle of the object is determined as a function of the frequency spectrum of the first echo pulse and the directional characteristics.
US08942061B2
A seismic streamer system for acquiring seismic data includes a plurality of first cable sections each employing a first sensor configuration therein, and at least one second cable section operatively connected to one or more of the first cable sections and employing a second sensor configuration therein. In various embodiments of the streamer system, one or more of the second cable sections are sparsely integrated into a streamer, a streamer array and/or a seismic spread. The first sensor configuration may, e.g., include a conventional hydrophone distribution, and the second sensor configuration may, e.g., include multicomponent sensors such as at least one of a particle velocity sensor, a pressure gradient sensor, an accelerometer and a combination thereof. The present invention is useful for attenuating noise in the measured seismic data as well as deghosting the data. A particular deghosting process includes decomposing the up- and down-going parts of the vertical component of particle velocity associated with the acoustic wave reflections from the strata.
US08942051B2
This description relates to a system for storing repair data of a random access memory (RAM) array in a one-time programming memory (OTPM). The system includes the RAM array, wherein the RAM array includes a main memory, redundant rows and columns, and a first repair register memory. The system further includes a built-in self-test-and-repair (BISTR) module having a second repair register memory, wherein the BISTR module is used to test and repair the RAM array. The system further includes the one-time programming memory (OTPM) for storing repair data from more than one test and repair stages for the RAM array, wherein the repair data from different test and repair stages are stored in a same data segment.
US08942048B2
A semiconductor device includes a memory block coupled to word lines and configured to a memory cell including a floating gate, an inter-poly dielectric and a control gate and a peripheral circuit configured to perform an erase loop operation, a program loop operation an electron injection operation of the memory cell, the electron injection operation trapping electrons in the inter-poly dielectric.
US08942043B2
A system for reducing read disturb on edge word lines in non-volatile storage is disclosed. In one embodiment, the memory cells on edge word lines are programmed using a series of pulses that have an initial magnitude and step size between pulses that are lower than for memory cells on word lines that are not edge word lines. Additionally, when reading memory cells on word lines that are not edge word lines, the edge word lines receive a lower pass voltage than the default pass voltage applied to other unselected word lines. In another embodiment. the system applies a higher than normal bias on a neighboring word lines when reading memory cells on an edge word line.
US08942036B2
The present invention discloses a method for achieving four-bit storage by using a flash memory having a splitting trench gate. The flash memory with the splitting trench gate is disclosed in a Chinese patent No. 200710105964.2. At one side that each of two trenches is contacted with a channel, a programming for electrons is achieved by using a channel hot electron injection method; and at the other side that each of the two trenches is contacted with a source or a drain, a programming for electrons is achieved by using an FN injection method, so that a function of a four-bit storage of the device is achieved by changing a programming mode. Thus, a performance of the device is improved while a storage density is greatly increased.
US08942032B2
A testing method is described that applies a sequence external magnetic fields of varying strength to MRAM cells (such as those with MTJ memory elements) in chips or wafers to selectively screen out cells with low or high thermal stability factor. The coercivity (Hc) is used as a proxy for thermal stability factor (delta). In the various embodiments the sequence, direction and strength of the external magnetic fields is used to determine the high coercivity cells that are not switched by a normal field and the low coercivity cells that are switched by a selected low field. In some embodiments the MRAM's standard internal electric current can be used to switch the cells. Standard circuit-based resistance read operations can be used to determine the response of each cell to these magnetic fields and identify the abnormal high and low coercivity cells.
US08942026B2
A read circuit for sensing a resistive state of a resistive switching device in a crosspoint array has an equipotential preamplifier connected to a selected column line of the resistive switching device in the array to deliver a read current while maintaining the selected column line at a reference voltage near a biasing voltage applied to unselected row lines of the array. The read circuit includes a reference voltage generation component for generating the reference voltage for the equipotential preamplifier. The reference voltage generation component samples the biasing voltage via the selected column line and adds a small increment to a sampled biasing voltage to form the reference voltage.
US08942024B2
A method of writing a first state or a second state to a memory cell may be provided. Writing the first state to the memory cell may include electrically connecting a first switch in electrical connection to a first end of the memory cell to a first voltage and electrically connecting a second switch in electrical connection to a second end of the memory cell to a fourth voltage to apply a first potential difference to cause formation of the first state in the memory cell. Writing the second state to the memory cell may include electrically connecting the first switch to the second voltage and electrically connecting the second switch to the third voltage to apply a second potential difference to cause formation of the second state in the memory cell.
US08942023B2
A semiconductor device using resistive random access memory (ReRAM) elements and having improved tamper resistance is provided. The semiconductor device is provided with a unit cell which stores one bit of cell data and a control circuit. The unit cell includes n ReRAM elements (n being an integer of 2 or larger). At least one of the ReRAM elements is an effective element where the cell data is recorded. In reading the cell data, the control circuit at least selects the effective element and reads data recorded thereon as the cell data.
US08942021B2
A semiconductor device includes: an I/O circuit configured to input/output a data signal; a plurality of internal circuits configured to transmit and receive the data signal to/from the I/O circuit; and a path provider configured to select one of a direct path to a target internal circuit or an indirect path to the target internal circuit that is longer than the direct path in response to one or more path control signals and use the selected path when the data signal is transmitted between the I/O circuit and the plurality of internal circuits.
US08942007B2
An electronic component includes a circuit element, a circuit board that is connected to the circuit element, and a connection terminal that is connected to the circuit board. The connection terminal includes a main body, a spring member that is formed so as to be elastically deformable in two directions including a direction of moving closer to the circuit board disposed on the main body and a direction of moving away from the circuit board, and a pair of arm portions that is extended from the main body so as to position the spring member therebetween. The pair of arm portions passes through the circuit board, ends of the respective arm portions far from the main body are bent toward the spring member, and the circuit board is held between the ends and the spring member.
US08942006B2
A printed circuit board (PCB) stackup includes conductive layers and insulating layers interleaved among the conductive layers. The conductive layers include one or more power layers, one or more ground layers, one or more high-frequency layers, and one or more low-frequency layers. One or more first signals having one or more first frequencies greater than a first threshold are communicated over the high-frequency layers. One or more second signals having one or more second frequencies less than a second threshold are communicated over the low-frequency layers. Each second frequency is less than each first frequency. The insulating layers include one or more core layers and one or more prepreg layers arranged in alternating fashion. Each insulating layer adjacent to any high-frequency layer has a first material type. Each insulating layer not adjacent to any high-frequency layer has a second material type different than the first material type.
US08942002B2
Stacked arrays of components are disclosed. In one embodiment, a first and a second layer of components are electrically and mechanically coupled to a thin interposer disposed between the first and second layers. The first layer can be configured to attach the stacked array to a host printed circuit board. The interposer can insulate the components from one another and also couple signals between the components on the first and second layers. In one embodiment, the components in the first and second layers are passive components.
US08941997B2
A server cabinet for retaining at least one computer server includes a plurality of holding poles and a plurality of retaining apparatuses. Each of the plurality of retaining apparatuses is secured to a computer server and clamps a holding pole, such that the computer server is secured on the plurality of holding poles both vertically and horizontally by the plurality of retaining apparatuses.
US08941982B2
A connector for a disk drive unit includes a base, a curve portion, a tab, a support, a hook, and a first spring arm. The base has a left portion, a right portion, a bottom portion, and a top portion. The curve portion extends from a back of the top portion of the base. The tab is adapted to be inserted into a retention opening of a static wall of a server. The support extends substantially horizontally from an opposite end of the curve portion, and is adapted to flex up and down when the tab is inserted into the retention opening of the static wall of the server. The hook is physically connected between the support and the tab, and is adapted to flex the support when the hook pressed into contact with a top of the retention opening, and to snap fit around the top of the retention opening when the connector is completely inserted into the retention opening. The first spring arm extends toward a center and in front of the base, and is adapted to apply a force to the static wall when the hook is snap fitted around the top of the retention opening to secure the disk drive unit within the server.
US08941967B2
Methods for producing a laser-guided underwater electrical discharge are provided. One or more electrodes defining a desired electrical discharge path are situated in a body of water and are attached to an external electrical power supply. A high-powered, intense laser beam is fired into the water. The laser beam forms an optical filament in the water, which in turn forms an ionized channel having a much greater conductivity than the surrounding water. An external power supply drives an electrical discharge along the path of the ionized channel due to its greater conductivity.
US08941964B2
An electrical safety circuit powered by an electrical power supply at point A terminal, the safety circuit includes a plurality of switches serially connected to one another, the serially connected switches have a first and second ends, the first end is connected serially to the power supply and the second end is serially connected to a safety circuit bypass detector having two ends, one end of the safety circuit bypass detector is connected serially to the second end of the serially connected switches and the second end of the safety circuit bypass detector is connected to a point B terminal, the point B terminal is connected to an electrical load. The safety circuit bypass detector have a switching device RX with a normally open contact RX1 and a normally close contact RX2, a switching device RZ with a normally open contact RZ1 and a normally open contact RZ2.
US08941961B2
In some embodiments, a system includes multiple coils of a multi-phase machine in which the coils are each associated with a different phase. Associated with each coil is a protective element such that each protective element is associated with a different coil. When its associated protective element is in a first configuration, a coil is part of an electrical circuit, and its associated protective element allows a first amount of current to flow through the coil. Its associated protective element allows a second amount of current to flow through the coil when its associated protective element is in a second configuration. When in the second configuration, the coil's associated protective element does not obstruct current flow through other coils that are not associated with the protective element.
US08941960B2
A switching apparatus for use in conjunction with a fuse, the switching apparatus including a circuit interrupter having a pair of separable contacts, a sensor for sensing a line fault, and an actuator for moving the contacts to an open state when a line fault is sensed, and wherein the switching apparatus is arranged such that the contacts always return to a closed state.
US08941944B1
A method of radially positioning a heat assisted magnetic recording (HAMR) head writes data to a first band, wherein a radial position of the HAMR head within each data track is defined by a positional bias and a track location. A determination is made regarding whether a threshold has been reached with respect to the first band. If the write threshold has been reached with respect to the first band, then the positional bias associated with the first band is modified to evenly distribute thermal exposure of data tracks in the first band.
US08941937B1
Technologies are described herein for determining the linear storage density of data tracks on a recording media of a storage device while compensating for segments of the recording media with poor bit-error rates. The sectors of the data track are grouped into a plurality of segments and a bits-per-inch capability (“BPIC”) value is determined for each of the plurality of segments based on a target bit-error rate. The lowest segment BPIC value from amongst the plurality of segments is then determined as well as an average BPIC value for the entire data track. The final BPI value for the data track is determined based on the average BPIC value and the lowest segment BPIC value.
US08941930B2
An imaging lens includes a first lens; a second lens; and a third lens arranged from an object side to an image plane side. The first lens has an object-side surface with a positive curvature radius. The second lens has an object-side surface and an image plane-side surface with negative curvature radii. The third lens has an object-side surface and an image plane-side surface with positive curvature radii. The object-side surface and the image plane-side surface of the third lens are respectively formed as an aspheric shape having an inflexion point. When the whole lens system has a focal length f, the first lens has a focal length f1, the second lens has a focal length f2, and the third lens has a focal length f3, the imaging lens satisfies the following conditional expressions: f1
US08941928B2
An imaging lens substantially includes six lenses, constituted by: a first lens having a positive refractive power and a convex surface that faces an object side; a second lens having a negative refractive power; a third lens having a positive refractive power; a fourth lens having a positive refractive power; a fifth lens having a negative refractive power and a concave surface that faces the object side; and an aspherical sixth lens having a negative refractive power, the surface of which is concave toward an image side in the vicinity of an optical axis and convex toward the image side at the peripheral portion thereof. The imaging lens satisfies a predetermined conditional formula.
US08941923B2
A diffractive optical element includes a first diffraction grating and a second diffraction grating which are made of materials different from each other and are stacked in an optical axis direction, and a thin film which is arranged at least part of an interface between the first diffraction grating and the second diffraction grating, includes a single layer or multiple layers made of a material different from that of each of the first and second diffraction gratings, and is transparent to light of a working wavelength range. nd1
US08941922B2
A lens apparatus includes: a correction unit moving perpendicularly to an optical axis and including a correction optical system correcting an image blur; a driving unit driving the correction unit; an engaging unit movable between an engaging position where the engaging unit abuts abutting portions of the correction unit to engage the correction unit and a non-engaging position where the engaging unit makes the correction unit movable; a biasing unit biasing the engaging unit from non-engaging position to engaging position; and a non-engaging position maintaining unit maintaining the engaging unit at non-engaging position by being engaged with the engaging unit, wherein the correction unit moves to press the non-engaging position maintaining unit beyond a range driven by the driving unit during image-blur correction to disengage the non-engaging position maintaining unit and the engaging unit, and the biasing unit moves the engaging unit from non-engaging position to engaging position.
US08941917B2
A projection screen apparatus having a perimeter frame and a substantially blank screen is provided.
US08941916B2
A filter holder for correlative particle analysis during imaging microscopy methods or methods of the elemental analysis including a receiving element with a filter support and a fastening unit. The plane filter support is designed as pressure piece and is movably arranged in the receiving element to be movable at a right angle to the surface of the filter for the purpose of tensioning the filter. The fastening unit includes a clamping element which encloses the filter at the circumference of the filter and is held by a tensioning element which is supported in the receiving element.
US08941910B2
A beam focusing unit for a laser weapon system includes a laser generating unit, an output element unit, and a beam optics element. The beam focusing unit includes a stationary/partly movable part and a fully movable part. The stationary/partly movable part is adapted for positioning or for transporting the beam focusing unit between operations. The fully movable part is adapted for targeting and target-following of the laser weapon system. The beam optics element and the at least one output element unit is arranged on the fully movable part.
US08941908B2
A porous electrode sheet (1) includes a resin film (2) being transparent and having insulating properties, and a transparent electrode (3) placed on one face (2a) of the resin film (2). The resin film (2) is provided with a plurality of through holes (21) extending linearly from the one face (2a) to the other face (2b). The transparent electrode (3) has openings (31) at positions corresponding respectively to the through holes (21). The through holes (21) of the resin film (2) and the openings (31) of the transparent electrode (3) communicate with each other, and thereby form passages (10) penetrating the porous electrode sheet (1) in the thickness direction.
US08941897B2
An image reading apparatus includes a housing having a conveyance path where a first medium and a second medium are conveyed; a pair of first conveyance rollers that has a first driving roller and a first pinch roller; a pair of second conveyance rollers that has a second driving roller and a second pinch roller having an outer diameter smaller than that of the first pinch roller, and wherein the first driving roller and the first pinch roller are positioned at an outside of a conveyance area in the axis direction, wherein the second driving roller and the second pinch roller are positioned at an inside of the conveyance area in the axis direction, wherein the second pinch roller, and wherein the first pinch roller and the second pinch roller are rotatably supported about a driven shaft center parallel with a driving shaft center.
US08941894B2
A scanner device according to one aspect of this disclosure includes a document table, a light detecting portion, and a control portion. The light detecting portion detects light from an object placed on the document table. The control portion adjusts reading sensitivity for the object on the basis of a detection result of the light detecting portion.
US08941889B2
An overhead image reading apparatus 1 includes: an image-capturing unit 22 that captures an image of a medium S to be read from above when the medium S to be read is placed on a placement surface 2; a light source 21 that irradiates the medium S to be read with light when the image-capturing unit 22 captures the image of the medium S to be read; and a light blocking portion 25 that blocks light above an upper-end position of light emitted from the light source 21. As a result, the user 100 can be prevented from seeing light from the light source 21 with his/her eyes and from being dazzled with an unpleasant feeling by light from the light source 21 during reading on the medium S to be read.
US08941888B2
A fax to E-mail system and related method are shown, whereby a hardcopy document is sent via a fax device to its recipient via electronic mail through a data network, and is delivered in such a manner that it can be retrieved by the recipient at an E-mail device and displayed on the screen of the E-mail device. The document begins as a hardcopy, as an electronic file retrieved through E-mail recipient's terminal and displayed on the computer screen of the E-mail recipient's terminal. The system and method also provides for an interface device which connects to a conventional fax device for communicating E-mail addresses and routing hardcopy documents to the E-mail network, and provides a means for embedding the functions of the interface device into conventional fax devices. The system can also be used in cooperation with Internet Web service for reporting, accounting, information services, and user interaction.
US08941883B2
A method creates a copy image from a hardcopy original on a reproduction system including a display. The method includes displaying a predetermined digital image according to image parameters set with initial image parameter values, reading out image parameter values entered by a user for replacing the initial image parameter values and characterizing the hardcopy original, displaying the predetermined digital image in accordance with the read-out image parameter values, determining a first conversion of image parameters mapping the initial image parameter values to the read-out image parameter values, determining a second conversion of image parameters by inverting the first conversion, scanning the hardcopy original resulting in scan-bound image parameter values, applying the second conversion to the scan-bound image parameter values resulting in converted image parameter values, and creating the copy image by taking into account the converted image parameter values. A reproduction system is configured for applying the method.
US08941869B2
An image forming apparatus includes a printing data reception unit, an identification information creation unit, an identification information transmission unit, an HDD, an image forming unit, an identification information acceptance unit, and a controller. The printing data reception unit receives from a communication terminal device printing data including printing target data and its printing accompanying information with a predetermined protocol. The identification information creation unit creates identification information upon receiving the printing data. The identification information transmission unit transmits identification information to the communication terminal device. The HDD stores the printing data. The identification information acceptance unit accepts input of the identification information. The controller makes the image forming unit print the printing target data corresponding to the input identification information.
US08941866B2
It is determined to cause the printing apparatus to print when the printing apparatus receives a first print job which is issued and does not cause the printing apparatus to print. When it is determined to cause the printing apparatus to print, the print control apparatus controls the printing apparatus to print an image corresponding to a second print job for causing the printing apparatus to print based on the second print job.
US08941865B2
A print system comprises notification part for providing, to a user, a notification of an inquiry about whether concurrent printing output that an image forming apparatus performs first printing output and subsequently performs second printing output is scheduled, in a non-sleep period associated with the first printing output by the image forming apparatus; and setting part for setting a transition standby period for transition of the image forming apparatus to a sleep state at a first value when a reply for informing that the concurrent printing output is scheduled is not sent from the user, and setting the transition standby period at a second value which is larger than the first value when the reply is sent from the user.
US08941860B2
A scanning method used to scan documents in a scanning system, the system including a scanner and a user host computer having a technology without an interesting name (TWAIN) driver, the scanner and the user host computer connected by a local interface and a network, includes selecting one of the local interface or the network to connect the scanner and the user host computer; if the network is selected, connecting the TWAIN driver to the scanner via the selected network to control scanning processes of the scanner; and performing scanning according to the selected local interface or the network.
US08941858B2
An image forming apparatus has a normal mode and a power saving mode. The image forming apparatus includes a printing portion for performing printing, a communication portion for performing a communication process, a system controller for performing operation control of the apparatus and a process concerning communication, and a power supply controller configured to supply power to the printing portion, the system controller, and the communication portion in the normal mode while in the power saving mode, to supply power to the communication portion but to stop power supply to the printing portion. The system controller performs the process concerning communication during the power saving mode, and the power supply controller adjusts a length of a stop time so that average power consumption of the image forming apparatus does not exceed a permissible maximum power, so as to temporarily restore the system controller during the power saving mode.
US08941853B2
An image forming apparatus includes a main control unit including a plurality of control units, and a sub control unit configured to respond to a request from an information processing apparatus via a network in substitution for the main control unit when the main control unit is being operated in a power saving state, wherein, in a case where the sub control unit receives a request to which the sub control unit cannot perform proxy response from the information processing apparatus, the main control unit determines a number of the control units for responding to the request among the plurality of control units and returns from the power saving state to a normal state using the control units the number of which is determined.
US08941851B2
An image forming apparatus is configured so that an attachable and detachable storage medium is attachable thereto, and the image forming apparatus includes an operation unit, a document reading unit, and a control unit. The operation unit receives an operation due to a user. The document reading unit reads a document and generates the image data of the document. The control unit controls the document reading unit to start an operation for reading a document after having received an instruction for reading a document, from the user through the operation unit, and after identification information of the document and a destination to save the image data of that document have been saved in the attached storage medium, when the storage medium is not detached during the operation for reading the document, the control unit stops the operation for reading the document.
US08941849B2
A sheet positioning device includes a sheet setting plate, first and second regulating members disposed facing each other to move in an orthogonal direction to a sheet conveyance direction to regulate positions of two facing ends of the sheet on the plate by contacting these ends, a driving mechanism to move the first regulating member in the orthogonal direction, first and second contact detectors mounted on the first and second regulating members to detect contact of the two facing ends, and a controller to stop the driving mechanism based on detection results obtained by the first and second contact detectors. The first and second regulating members are used to adjust a position of the sheet to a predetermined position. Respective contact surfaces of the first and second contact detectors with the sheet extend over an entire maximum loadable range in a sheet setting direction on the plate.
US08941838B2
A rare-earth-doped-fiber light source with wavelength stability includes a rare-earth doped fiber and an undoped fiber placed in proximity to each other and having the same host material and the same cross-sectional structure, a coupler configured to direct a first portion of pump power from a pump laser to the undoped fiber so the first portion of pump power was twice passed through the coupler; and a wavelength division multiplexer configured to input a second portion of pump power from the pump laser to the rare-earth doped fiber. The rare-earth doped fiber is an active medium for the broadband light source and includes a fiber core doped with rare-earth ions. The undoped fiber includes a rare-earth-dopant-free fiber core. The length of the undoped fiber is one of the same as that of the doped fiber or optimized to match a radiation sensitivity of the doped fiber.
US08941837B1
An apparatus for testing an optical surface comprising an array of holograms. The array includes a plurality of individual holograms arranged in an M×N format, in which M is the number of rows and N is the number of columns in the array. The array of holograms is positioned between the optical surface and a wavefront sensor. The array of holograms reflects a reference beam back to the wavefront sensor, and transmits a test beam to the optical surface. The array of holograms also receives the test beam reflected from the optical surface and transfers the test beam back to the wavefront sensor.
US08941834B2
The invention relates to an interference filter (100) for receiving an incident light (135) and selecting a light component of the incident light to be transmitted (115). The interference filter (100) includes a metal mirror (110), a dielectric mirror (130), and a spacer (120) placed between the metal mirror (110) and the dielectric mirror (130). The metal mirror (110) and the dielectric mirror (130) are configured to enable optical interference in the spacer (120) to select the light component of the incident light to be transmitted (115). Using one metal mirror and one dielectric mirror allows achieving a spectral response with high finesse and large rejection band while reducing the total number of layers in the filter and reducing the number of additional filters necessary for removing transmitted side bands, relative to prior art approaches.
US08941827B2
Measuring device of the present invention includes a plurality of measuring sites for generating a plurality of optical paths and various dilutions. The range for concentration measurement and the measurement accuracy are enhanced due to the plurality of optical path length, and the interference on the measurement ranges and results caused by the concentration or the turbidity of suspended solid is reduced and removed by water sample dilution, and thus the characteristic wavelengths of the components in the water are measured. Next, the information of spectrum database is used to determine the ingredients which may exist in the water (qualitative analysis), and UV-VIS-NIR absorbance spectrum analysis is used to obtain the concentration of the respective ingredients in the water at the same time (quantitative analysis).
US08941823B2
A surface inspection device for a cylindrical body includes an illumination light source disposed above the cylindrical body, a beam splitter disposed above the cylindrical body so as to correspond to the illumination light source, and a surface condition recognition device disposed above the beam splitter. Illumination light emitted from the illumination light source is reflected by the beam splitter and applied coaxially to the surface of the cylindrical body, and the reflected light reflected by the surface of the cylindrical body transmits through the beam splitter to be recognized by the surface condition recognition device. The device is configured such that the illumination light from the illumination light source is applied from one end side of the cylindrical body in the axial direction toward, the other end side so as to be in parallel to the axial direction.
US08941822B2
A clamping device includes a first plate and a second plate. The first plate includes an upper surface, a lower surface facing away from the upper surface and a first side surface. The upper surface is substantially parallel with the lower surface. The first side surface perpendicularly connects the upper surface and the lower surface. The first plate defines a receiving cavity at a joint of the upper surface and the first side surface. The second plate is detachably connected to the first plate. The second plate includes a top surface and a second side surface. The second side surface perpendicularly connects to the top surface. The second plate defines a sloped surface extending from the top surface to the second side surface. The sloped surface aligns with the receiving cavity. The second plate includes a reflective layer positioned on the sloped surface.
US08941811B2
A method and apparatus for cleaning the inside of an immersion lithographic apparatus is disclosed. In particular, a liquid supply system of the lithographic apparatus may be used to introduce a cleaning fluid into a space between the projection system and the substrate table of the lithographic apparatus. Additionally or alternatively, a cleaning device may be provided on the substrate table and an ultrasonic emitter may be provided to create an ultrasonic cleaning liquid.
US08941804B2
Arbitrary one pixel P (contact hole pixel (13)) is selected in a predetermined demarcated area (20) of the liquid crystal display device of the present invention. The pixel P is (i) any of four pixels Q1 through Q4 (contact hole pixels (13)) closest to another pixel P or (ii) (a) contained in a quadrangle whose vertices correspond to respective four pixels Q1 through Q4 closest to the pixel P and (b) any of four pixels Q1 through Q4 closest to another pixel P. Further, two diagonal lines of a quadrangle formed by four pixels Q1 through Q4 are inclined at respective two angles with respect to a gate bus line (line segment A-B), and a difference between the two angles is smaller than 30 degrees. Moreover, the contact hole pixels (13) are provided for respective source bus lines in the predetermined demarcated area (20).
US08941799B2
Provided is a liquid crystal display including: a lower display panel including a lower insulating substrate and a lower reflective layer; an upper display panel including an upper insulating substrate and an upper reflective layer; a liquid crystal layer positioned between the lower reflective layer of the lower display panel and the upper reflective layer of the upper display panel; and a backlight unit positioned on a lower portion of the lower display panel and including a light source, wherein a pair of field generating electrodes are formed in at least one display panel of the lower display panel and the upper display panel, wherein microcavities are formed in the lower reflective layer, the upper reflective layer, and the liquid crystal layer, and wherein a wavelength and luminance of light resonated and emitted in the microcavities are changed by an electric field generated by the field generating electrodes.
US08941798B2
A panel, a method of fabricating the panel, and a 3-dimensional (3D) image displayable system are provided. The panel includes first and second films disposed opposite each other, a polymer layer interposed between the first and second films, the polymer layer formed of a polymer having light alignment and light-curing characteristics, the polymer layer in which the polymer is arranged in one direction, and a plurality of liquid crystal (LC) droplets dispersed in the polymer layer. Each of the plurality of LC droplets includes a plurality of LC molecules, which are arranged in the same direction as the direction in which the polymer layer is arranged.
US08941785B2
A projector includes a moving unit adapted to move positions of at least six correction points, which are included in a correcting image, a reception unit adapted to receive a designation on a value of a parameter representing linearity, a derivation unit adapted to derive a correspondence relationship of the coordinates between and input image and the correcting image using coordinates of the at least six correction points moved by the moving unit, and the parameter having the value designation of which is received by the reception unit, and a processing unit adapted to perform a correction process on the input image based on the correspondence relationship derived by the derivation unit.
US08941782B2
A display system comprising: a display apparatus which comprises a first data processor to perform a first data processing, an output unit to output the processed data, at least one first signal connector to transmit and receive data and a first controller to control the first data processor; and an upgrading apparatus which comprises at least one second signal connector connected to the first signal connector to connect the display apparatus from the outside, a second data processor to perform a second data processing, and a second controller to control the second data processor. The first data processor and the second data processor perform the data processing independently.
US08941770B2
A digital image processing apparatus includes an image capturing unit that captures an image of a subject and converts the image into image data, a storage unit that stores the image data, a successive capturing information generating unit that adds successive capturing photographing information to image data of images that are obtained by the image capturing unit when successively capturing a plurality of images, a display unit that displays an image representing the image data, a user input unit that generates an input signal when an input is received from a user, and a slide show control unit that displays successively captured images obtained by a single successive capturing photographing operation on the display unit at predetermined time intervals based on the successive capturing photographing information included in the image data, wherein a portion of the successively captured images is enlarged and sequentially displayed.
US08941767B2
A mobile device includes a camera unit configured to sense an image, a display unit configured to display the image, a sensor unit configured to detect a user input and a processor configured to control the display unit, the camera unit and the sensor unit, where the processor is further configured to display an image capturing interface including the image sensed by the camera unit and an image capturing trigger for storing the image, wherein the image capturing interface is further includes a pattern code trigger which is linked to contents when the pattern code is recognized from the sensed image, store the sensed image when the user input for the image capturing trigger is detected, and display the contents to which the pattern code is linked or store the pattern code, when the user input for the pattern code trigger is detected.
US08941765B2
An imaging device includes a plurality of first pixels, each of which outputs a first pixel signal, a plurality of second pixels, each of which outputs a second pixel signal, a ramp wave generator that outputs a ramp signal that monotonously increases or monotonously decreases over time, a phase shift pulse generator that outputs first to n-th phase shift pulse signals, a first pixel latch group that latches the first to n-th phase shift pulse signals when the first pixel signal and the ramp signal have a predetermined relationship, a second pixel latch group that latches the first to n-th phase shift pulse signals when the second pixel signal and the ramp signal have the predetermined relationship, first to n-th power source lines to supply a power source and first to n-th phase shift pulse supply lines to supply the phase shift pulses.
US08941764B2
An image sensor for electronic cameras includes a plurality of light sensitive pixels arranged in rows and columns, wherein the pixels of a respective column can be read out via a respective column line and includes a plurality of data outputs, wherein a plurality of column lines are associated with the respective data output via at least one multiplexer device. The column lines are divided into a plurality of column line groups, wherein the respective column line group includes a plurality of column lines arranged next to one another; and wherein the number of column lines of the respective column line group corresponds to the number of the column lines associated with the respective data output.
US08941760B2
An image processing apparatus includes a clip part and an incremental processing part. The clip part sets a threshold value as an output luminance value of a process object pixel when a luminance value of the process object pixel of an image data having luminance values of a plurality of pixels is less than the threshold value set in advance. The incremental processing part finds and holds an incremental value of the output luminance value relative to the luminance value of the process object pixel, and finds the output luminance value of the process object pixel by subtracting the incremental value from the luminance value when the luminance value of the process object pixel is the threshold value or more.
US08941755B2
The purpose of the present invention is to provide sophisticated AWB technologies. According to one aspect of the present invention, there is provided a technology for adjusting a white balance of a frame of image data including a plurality of color elements. This technology is characterized by comprising: dividing the frame into a plurality of blocks including a plurality of pixel data; judging, for each of all of or a part of the blocks, whether the block is likely to be grey or not, and; deciding gains for adjusting a white balance using the blocks judged as being likely to be grey.
US08941753B2
An imaging apparatus includes: a pixel generating a photoelectric conversion signal; a comparator comparing a base signal based on the pixel at a reset state with a time-changing first reference signal, and comparing an effective signal based on the pixel at a non-reset state with a time-changing second reference signal, the second reference signal having a larger time-changing ratio than that of the second reference signal; a counter counting a first count value until an inversion of a magnitude relation between the base signal and the first reference signal, and counting a second count value until an inversion of a magnitude relation between the effective signal and the second reference signal; and a correcting unit configured to correct the difference of resolutions of the first and second count values, and configured to correct the difference between the corrected first and second count values.
US08941747B2
Video recording where an input image signal is received with one or more optical sensor disposed in a hands-free video recorder. The input image signal is processed into an encoded video data stream with one or more processor disposed in the hands-free video recorder. First frames of the video data stream are relayed over a wireless communication link to a cellular-enabled wireless telephony handset and presented on a display screen of the handset along with a graphical user video control interface. Video control commands are wirelessly sent to the recorder in response to receiving a first input through the video control interface. Second frames of the video data stream are directed by the video control commands to at least one of a plurality of destinations.
US08941742B2
Provided is a luminance measurement method for accurately measuring luminance of each pixel even if pixel images of a display panel overlap each other on an imaging surface of a camera. A central exposure factor indicating luminance of the central part of the pixel image is calculated on the basis of an output of a picture element corresponding to the central part. A peripheral exposure factor indicating luminance of the peripheral part of the pixel image is calculated on the basis of an output of picture elements corresponding to the peripheral part of the pixel image is calculated, all pixels of the display panel are sorted into a plurality of groups, sequentially turned on one group after another, and imaged by the camera, and the luminance of all the pixels of the display panel is calculated based on this imaged image, the central exposure factor, and the peripheral exposure factor.
US08941735B2
A video stream is received over a network from a remotely located video capture device. The video stream is processed in real-time or near real time. The processing of the video stream extracts at least one metric from content of the video stream. The extracted metric is compared against at least one previously established value to generate either a TRUE or a FALSE result. Responsive to a TRUE result, at least one programmatic action is automatically initiated. The previously established value, the programmatic action, or both are user configurable. The programmatic action is a real time or a near real time action resulting from analyzing content of the video stream. Responsive to a FALSE comparison result, the at least one programmatic action is not automatically initiated.
US08941728B2
A method for automated real-time acquisition of a marine mammal in a natural body of water in the surroundings of a vessel includes detecting a thermal signature of the marine mammal is detected by imaging thermographic scanning of a water surface with an infrared camera system so as to generate an image data stream of consecutive images. A modular processing of the image data stream is performed including performing an image pre-processing, detecting local changes in contrast in the images, classifying the detected local changes in contrast so as to detect a pattern of the thermal signature of the marine mammal, localizing the classified thermal signature of the marine mammal, verifying the classified, localized thermal signature of the marine mammal and documenting the classified, localized and verified thermal signature of the marine mammal.
US08941727B2
Apparatus for determining the status of hair bulk in an area of a scalp is operative to provide a metric over a sufficiently large area to permit revisiting with only negligible misalignment error. Accurate re-measurement of hair status in accurately identified areas produces a reliable metric for determining degree of hair loss and or the effectiveness of treatment.
US08941726B2
A set of images is acquired of a scene by a camera. The scene includes a moving object, and a relative difference of a motion of the camera and a motion of the object is substantially zero. Statistical properties of pixels in the images are determined, and a statistical method is applied to the statistical properties to identify pixels corresponding to the object.
US08941713B2
A video phone call method for adjusting resolution quality and a video phone call apparatus supporting the same are provided. The video phone call apparatus includes a Radio Frequency (RF) communication unit for transmit a video phone call connection request message and for receiving a video phone call connection accept message in response to the video phone call connection request message to form a communication channel for connection of video phone call, a camera for collecting an image signal for the video phone call, an audio processor for collecting an audio signal for the video phone call, and a controller for creating a control signal for controlling the image signal and the audio signal, and for adding a collected video frame to the video phone call data to generate integral video phone call data having additional video frame data.
US08941709B2
While performing or initiating a transaction with a self-service video transaction device, a user may interact with a video agent and a terminal associated therewith. An error may occur during the transaction. In response to detecting the error, video agent(s) having video or audio functionalities to service the error may be identified. Servicing the error may also be based on a length of a wait time to connect to an appropriate video agent. If the wait time exceeds a predetermined threshold, an error receipt identifying the error and other information may be printed by the self-service video transaction device. If the wait time does not exceed the predetermined threshold, a display device of the self-service video transaction device may display an option for the user to connect to the video agent terminal.
US08941703B2
To provide a printing apparatus for enabling printing speed to be increased, while enabling the unevenness of concentration to be reduced, a printing apparatus is provided with a thermal head having a plurality of heater elements lined up in the main scanning direction and a CPU for switching current passage timing of the plurality of heater elements, and the CPU switches the current passage timing for the plurality of heater elements so that a second strobe signal STB2 is switched to an ON state after switching a first strobe signal STB1 to an ON state, after switching the STB2 to the ON state the STB1 is switched to an OFF state, the STB2 is switched to an OFF state, then the STB1 is switched to the ON state after switching the STB2 to the ON state, after switching the STB1 to the ON state the STB2 is switched to the OFF state, and that the STB1 is switched to the OFF state.
US08941700B2
To provide a condensed polycyclic compound shown in the following General Formula [1], in which X1 to X16 each are independently selected from a hydrogen atom, an aryl group, a heterocyclic group, an alkyl group, an alkoxy group, and an amino group and the aryl group, the heterocyclic group, the alkyl group, the alkoxy group, and the amino group may have a substituent.
US08941699B2
A time recorder includes a first sensor that detects the side edge of a time card having a cut-out formed at at least one corner of the bottom, a second sensor that detects the bottom of the time card, and a card feeding unit that feeds the time card. When the time card is fed by this card feeding unit, a pulse counter of the card feeding unit counts the number of pulses of predetermined pulse signals after the first sensor detects the time card and until the second sensor detects the time card. Next, the front and back faces of the time card are determined based on the number of pulses that is a counting result. Hence, the front and back faces can be determined by the first sensor and the second sensor only.
US08941698B2
The invention relates to an LED electronic sign board capable of power-saving per pixel line, comprising: an LED display panel; a panel driver; a switching mode power supply that receives AC power, generates driving power required to operate the LED display panel and the panel driver and supplies power to the LED display panel and the panel driver; a black line extractor that analyzes an image signal which will be displayed on the LED display panel and extracts pixel lines which becomes black per LED module; and a main controller that controls the panel driver to display an image on the LED display panel according to the image signal, and that controls a switching signal for the operation of the switching mode power supply to shut off driving power that is supplied to the pixel lines extracted by the black line extractor from the switching mode power supply.
US08941697B2
A technique for driving a column of pixels that include light emitting elements. The technique incorporates feedback data provided from feedback data sources connected to the data line and to feedback line of the array, pixel driving circuit with feedback path. The technique can also include block of the reference elements for input signal corrections.
US08941688B2
The system for providing targeting augmented contents includes: an augmented metadata generation apparatus that generates augmented metadata designating specific space and time of broadcast contents as an augmented area; a broadcast content providing apparatus that transmits the augmented metadata to a first broadcast terminal apparatus and transmits the augmented metadata and the broadcast contents to a second broadcast terminal apparatus; a first broadcast terminal apparatus that transmits augmented contents displayed in the augmented area in which the augmented metadata are designated to the augmented content providing apparatus; an augmented content providing apparatus that transmits the augmented contents to a second broadcast terminal apparatus; and a second broadcast terminal apparatus that receives the broadcast contents and the augmented metadata from the broadcast content providing apparatus and receives the augmented contents from the augmented content providing apparatus based on the augmented metadata.
US08941682B2
The retrieval of medical data from a database through easy operations without displaying components for retrieval operations on a display screen is realized. The present invention is a medical image processing apparatus comprising a data memory, a display, a position-designating part, a data-list-display controller, and a keyword-generating part. The data memory stores medical data associated with attributes data including patient identification information. The position-designating part designates a position on the display. The data-list-display controller causes the display to display a data list presenting the attributes data in a list. The keyword-generating part generates a retrieval key based on the attributes data in the data list corresponding to the position designated by the position-designating part. Moreover, the data-list-display controller updates the data list based on the results retrieved by the retrieval key.
US08941677B1
A quality display is disclosed. Embodiments of the invention provide for the display of an indication of quality of a geographic survey. In some example embodiments, a survey grid corresponding to the geographic boundaries of a dynamically created survey area is displayed, where the displayed survey grid expands based on the geographic movement of survey participants. In additional embodiments, data representing the survey grid, cells of the survey grid, and a plurality of sub-cells into which each cell of the survey grid is divided is stored. In other embodiments, a numerical index corresponding to the quality of the survey in each cell of the survey grid is determined based on positioning information. In still other embodiments, a display attribute associated with each cell of the survey grid is adjusted in accordance with the numerical index.
US08941676B2
One embodiment of the present invention includes a graphics subsystem for processing multi-sample anti-aliasing work. The graphics subsystem includes a cache unit, a tiling unit, and a screen-space pipeline coupled to the cache unit and to the tiling unit. The tiling unit is configured to organize multi-sample anti-aliasing commands into cache tile batches. The screen-space pipeline includes a pixel shader and a raster operations unit, and receives cache tile batches from the tiling unit. The pixel shader is configured to generate sample data based on a set of primitives and to generate resolved data based on the sample data. The raster operations unit is configured to store the sample data in the cache unit and to invalidate the sample data after the pixel shader generates the resolved data.
US08941668B2
A scalable discrete graphics system (DGS) is disclosed. The DGS includes a serial bus bridge configured to couple a plurality of GPUs to a serial bus. A serial bus connector is coupled to the serial bus bridge. A system chassis coupled to the serial bus bridge and the serial bus connector and configured to house the GPUs. The serial bus connector is configured to removably connect to a computer system. The GPUs access the computer system via the serial bus bridge and the serial bus connector to cooperatively execute 3-D graphics instructions from the computer system.
US08941662B2
A method is provided for rendering pixels based on a certain type of Bézier curve, called a simple Bézier arch. The method uses an implicit function to determine whether each pixel in a domain triangle containing the arch is on the arch, on one side of the arch, or on the other side. The function's parameters can be linearly interpolated to allow efficient rendering of the triangle by a GPU. A method is also provided for applying the aforementioned method to render pixels, based on a non-linear Bézier curve having at most four control points, by subdividing the curve into simple Bézier arches as necessary. A computing device for performing these methods is also provided.
US08941651B2
The present disclosure provides methods, machine readable media, and systems for object alignment from a 2-dimensional (2-D) image of the object. One or more embodiments include defining a 2-D shape in the 2-D image and a 3-dimensional (3-D) shape in a 3-D model of the object, mapping a number of corresponding points on the 2-D and 3-D shapes, defining the 2-D and 3-D shapes with a number of triangles, wherein a number of vertices of the number of triangles correspond to the number of points, subdividing the number of triangles defining the 2-D and 3-D shapes into a plurality of subdivided triangles that include a plurality of new vertices, and reconstructuring a 3-D image from the 2-D image by assigning a number of z-coordinates from the plurality of subdivided triangles of the 3-D shape to the plurality of subdivided triangles of the 2-D shape to create a 3-D reconstructured shape.
US08941650B2
A CAD system enables a designer to freely modify a model of a design without regenerating a history of the model, as in traditional parametric feature based modeling. The CAD system automatically determines whether the modifications to the model invalidate current features associated with the model and whether the modifications create new features that should be added to the model. Such a CAD system enables a designer to quickly edit designs and simultaneously preserve design intent without requiring the significant computational resources of historical based approaches that regenerate a geometry upon every edit made by a designer.
US08941641B2
In one example, images may be used to create a model of a three-dimensional space, and the three-dimensional space may be annotated and/or edited. When a three-dimensional model of a space has been created, a user may associate various items with points in the three-dimensional space. For example, the user may create a note or a hyperlink, and may associate the note or hyperlink with a specific point in the space. Additionally, a user may experiment with the space by adding images to, or deleting images from, the space. Annotating and editing the space, rather than the underlying images, allows annotations and edits to be associated with the underlying objects depicted in the images, rather than with the images themselves.
US08941639B2
Determining pixel behavior type of a pixel or a group of pixels of a LCD and triggering adjustment in drive power of the pixel or the group of pixels based on the pixel behavior type. The pixel behavior type indicates relative motion of areas on the LCD in a video. A pixel behavior determination module directs one or more selected pixels of the LCD to be driven relative slower or faster based upon content of video that the selected pixels display. Operations include identifying an active window from a plurality of windows corresponding to a plurality of applications running on the host device and setting the drive power of those pixels that correspond to the active window based on speed of a video displayed on the active window. Operation may also include adapting LCD drive power on a pixel by pixel basis based upon user input and/or remaining battery life.
US08941621B2
In order to simultaneously carry out, at a smaller sensor density, (i) detection of color information (recognition of a color) of visible light which enters a detection target surface and (ii) detection of an input position of the visible light, a liquid-crystal panel (20) included in a liquid-crystal display device of the present invention has an area sensor function of detecting color information and an input position of visible light by sensing an input image of the visible light on a panel surface. The liquid-crystal panel (20) (position detecting section) includes (i) a yellow sensor (31Y) including a light sensor element (30) which senses an intensity of green light and red light from among three primary color lights and (ii) a cyan sensor (31C) including a light sensor element (30) which senses an intensity of blue light and green light from among the three primary color lights. Sensing of the input image of the visible light on the panel surface by each of the yellow sensor (31Y) and the cyan sensor (31C) allows detection of the color information and the input position.
US08941615B2
Provided is an information processing apparatus including a contact detection unit that detects coordinates of a position of a touch manipulation with respect to a touch panel, a storage unit that stores a table that is a command table relating to an editing process with respect to a material that is an element of content, and that at least includes a command to change a reproduction position of the material that is reproduced on a separate information processing apparatus, according to a distance that the touch manipulation moves, and a command specification unit that specifies the command issued to the separate information processing apparatus, from the table stored in the storage unit, based on a detection result obtained by the contact detection unit.
US08941611B2
A portable terminal comprising: a display displaying a first display item; and a touch panel displaying a second display item and detecting contact made thereon determines, when a first contact point and a second contact point are detected at different positions on the touch panel, whether the first contact point moves before release of one of the contact points and further determines whether a change in a relative position of the second contact point with respect to the first contact point, before and after the movement, is smaller than a predetermined amount. When determining affirmatively, the portable terminal specifies, according to a direction of the movement, a position on the display to which the first display item is to be moved and a position on the touch panel to which the second display item is to be moved and displays the display items at the specified positions.
US08941610B1
A computing device includes a capacitively coupled antenna provided in a display portion of the device. An antenna pattern is provided on a backside of a touch screen display. An antenna element is provided in a display housing. The touch screen is attached to the display housing a dielectric adhesive. The dielectric adhesive prevents the antenna pattern from contacting the antenna element such that the antenna pattern is capacitively coupled to the antenna element.
US08941605B2
Technologies are generally described for an intuitive process management mechanism in a multi-core environment. An example electronic device may include a processor with a first core and a second core, an operating system, a process-core assignment module operatively coupled to the operating system, and a graphical user interface system operatively coupled to the process-core assignment module and configured to provide a first display screen and a second display screen, the first display screen and the second display screen being associated with the first core and the second core, respectively. An example method for the electronic device may include: displaying a graphical element associated with a process of an application program on the first display screen, wherein the process is executed by the first core; detecting a movement of the graphical element from the first display screen to the second display screen; and assigning the process to the second core.
US08941603B2
The present solution relates to a device (800) comprising a touch sensitive display (111). The device (800) further comprises a receiving unit (701) configured to receive image data. The device (800) further comprises a processing unit (703) configured to display the image data as a haptic image on the touch sensitive display (111), whereby objects comprised in the haptic image are discernable to a user by sense of touch.
US08941597B2
A two-dimension (2-D) sensing information is analyzed for determining touch related sensing information. The touch related sensing information may include touch related sensing information with inner lower values within outer high values and with inner higher values within outer low values.
US08941581B2
A light emitting element drive apparatus capable of outputting the lowest voltage satisfying drive conditions and having high light emitting efficiency and low power loss, and a portable apparatus using the same, comprising an LED drive apparatus to which LEDs of different drive voltages required for emitting light are connected in parallel and driving one or more LEDs, wherein the LED drive apparatus 10 has drive circuits connected to the corresponding LEDs among a plurality of LEDs and driving the corresponding LEDs with luminances based on set values and power supply circuits for deciding a drive voltage value required for the highest light emission among one or more LEDs driven to emit light based on drive states of drive circuits (for example terminal voltages of the current source) and supplying a drive voltage having at least the decided value to LEDs in parallel.
US08941555B2
An organic light emitting display device (OLED) includes: a multiple display in which a plurality of panels operate as a single display, wherein each of the panels comprise a substrate and a pixel; and a polarizing plate attached to the multiple display to bond the plurality of panels as a single panel, wherein the panels are divided into (i) display areas in which pixels are formed, and (ii) non-display areas surrounding the display areas, and at least two adjacent panels at an interpanel boundary are folded in the adjacent non-display areas to reduce the non-display areas.
US08941545B2
A vehicle window glass has a glass plate, a conductive film laminated on the glass plate and an antenna structured with a feeding structure placed on the conductive film, and is characterized in that the feeding structure has a dielectric and a pair of electrodes, that the conductive film has a slot one end of which makes an upper edge of the conductive film an open end, and is disposed between the glass plate and the dielectric, and that the pair of electrodes are disposed on the opposite side of the side of the conductive film with the dielectric in between so that the slot is sandwiched between the pair of electrodes when the pair of electrodes are projected onto the conductive film, and are capacitively coupled to the conductive film.
US08941537B2
The invention, in some embodiments, relates to the field of global navigation satellite systems, and more particularly to the field of methods and devices for identifying whether a satellite in a global navigation satellite system has a line of sight to a specific global navigation satellite system receiver (LOS satellite) or does not have a line of sight to the global navigation satellite system receiver (NLOS satellite).
US08941532B2
The present invention relates to a guided wave radar level gauge system for determining a filling level of a product contained in a tank. The level gauge system comprises a transceiver for transmitting and receiving electromagnetic signals, a probe extending into the tank and configured to guide the signals towards the surface and to guide reflected signals back to the transceiver, processing circuitry for determining the filing level based on the reflected signals, and a plurality of spacing elements arranged on the probe. Each spacing element comprises a shell structure having an ellipsoidal shape defining an ellipsoidal space, first and second shell openings at first and second locations of the shell, such that a passage through the shell openings defines a passage through the spherical space, wherein the probe extends through the passage, and a plurality of flow openings allowing fluid flow between the exterior and interior of the shell.
US08941528B2
An analog-to-digital conversion circuit includes a reference current generating unit suitable for generating a reference current varied by a given level in a sampling stage, a ramp voltage generating unit suitable for generating a ramp voltage corresponding to the reference current, and a comparison unit suitable for comparing the ramp voltage with a voltage level of a pixel signal to output a comparison signal.
US08941524B2
A TD converter is provided for digitally converting a delay time value into a digital value. In the TD converter, an oscillator circuit part inputs time domain data. A first-state counter circuit part measures a number of waves of an output oscillation waveform from the oscillator circuit part when time domain data is in a first state, and a second-state counter circuit part measures a number of waves of the output oscillation waveform from the oscillator circuit part when the time domain data is in a second state. An output signal generator part generates an output signal based on output count values of the first-state counter circuit part and the second-state counter circuit part, and a frequency control circuit controls the oscillator circuit part to always oscillate and to control an oscillation frequency of the oscillator circuit part.
US08941512B2
Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for encoding and decoding information. In one aspect, methods of encoding information in an encoder include receiving a signal representing information using a collection of discrete digits, converting, by an encoder, the received signal into a time-based code, and outputting the time-based code. The time-based code is divided into time intervals. Each of the time intervals of the time-based code corresponds to a digit in the received signal. Each digit of a first state of the received signal is expressed as an event occurring at a first time within the corresponding time interval of the time-based code. Each digit of a second state of the received signal is expressed as an event occurring at a second time within the corresponding time intervals of the time-based code, the first time is distinguishable from the second time.
US08941508B2
A signaling device for emitting an acoustic and/or visual signal includes a base housing body, and an upper housing part. The upper housing part can be connected to the base housing to form a receiving space, in which at least one electrical component assembly for generating signals is disposed and from which at least a first electrical line can be guided into the signaling device. A line connection mechanism is provided and disposed in the base housing body to which the electrical line can be connected. The electrical component assembly for the signal generation is disposed on the upper housing part.
US08941498B2
A method and system for deactivating locks, locking the functionality of products and/or the product packing in which such products are sold, in particular remote-activation adhesive locks.
US08941497B2
A multi-mode RFID tag includes a power generating and signal detection module, a baseband processing module, a transmit section, a configurable coupling circuit, and an antenna section. In near field mode, the configurable coupling circuit is operable to couple the transmit section to a coil or inductor in the configurable coupling circuit to transmit an outbound transmit signal using electromagnetic or inductive coupling to an RFID reader. In far field mode, the configurable coupling circuit is operable to couple the transmit section to the antenna section, and the multi-mode RFID tag then utilizes a back-scattering RF technology to transmit the outbound transmit signal to RFID readers.
US08941494B2
The invention describes a safety system (100) for a working machine (1), wherein an operator (7) is able to interact with the machine (1), wherein the system (100) comprises a transceiver unit (71) associated with the operator (7), a central processing unit (11), associated with the working machine (1), so as to receive signals from the transceiver unit (71), conductive gloves (81) comprising electrical conduction means (85, 84) configured to operate in ordinary functioning (I) or in an alarm condition (II), electrical connection means (82) configured to connect the transceiver unit (71) to the conductive gloves (81), and wherein the central processing unit (11) is configured to recognize whether the operator (7) is authorized for use of the machine (1), and to transmit an alarm signal (Sx1) so as to disable the machine (1) if the second operative condition (II) occurs.
US08941493B2
Systems and methods are provided relating to utilizing a plurality of RFID tags in conjunction with a circuit comprising at least one reed switch to facilitate determination of operational states and actions based thereon. A magnet can activate the reed switch causing a first RFID tag to be activated and transmit an associated RFID identifier from which a position/operation associated with the first RFID can be determined. The magnet can be removed to activate a second RFID tag whereupon a second RFID identifier is transmitted from which a second position/operation can be determined. The circuit comprising the reed switch and RFID tags can have an induction coil enabling the circuit to be activated when the induction coil is brought into proximity of a second induction coil and inductively coupled.
US08941490B2
The life alarm sensor device a very compact life alarm with a geodesic-like convex body frame structure mechanical sensor. The geodesic-like frame sensor is comprises a plurality of polygonal frames with beveled edges which are contiguously coupled at their respective edges with conducting probes, an unconstrained conducting ball dynamic wrist movement following inside the geodesic frame structure that closes a frame electric circuit upon a cessation of wrist movement. An alarm is triggered when a pre-set countdown has elapsed.
US08941487B2
Technology is described for transferring one or more mobile tags using a light based communication protocol. A mobile device, for example a smart phone, with an image sensor and an illuminator, like a camera flash, initiates transfer of data formatted in a mobile tag displayed by another device by automatically controlling the illuminator to generate sequences of light representing data transfer messages. The other device, for example a user wearable computer device with sensors capturing biometric and health related data, has a photodetector unit for capturing the sequences of light and converting them into digital data. A processor of the other device identifies the data transfer messages and causes a display of one or more mobile tags responsive to the messages. In this way, a number of mobile tags may be used to transfer several kilobytes of biometric data, for example 4-7 KBs, using low power for the wearable device.
US08941484B2
A method and apparatus wherein the method includes detecting a plurality of events within a security system, evaluating the events using one of a first expression defined by ΣrεQconf(f(r)−mrg(r)), a second expression defined by ∫rεR|f(r)−mrg(r)|dr and a third expression defined by ∫rεRconf(f(r)−mrg(r))dr, where r is a size of a neighborhood around a data point, f(r) is a Local Correlation Integral (LOCI) of r, mrg(r) is a margin of r, R is a predetermined set of intervals of neighborhood sizes, Q is a predetermined discrete set of neighborhood sizes and conf(d) is a non-linear confidence function being 0 for near distance to the data point and quickly approaching 1 for larger distances, comparing a value of the evaluated expression with a threshold value and setting an alarm upon detecting that the value exceeds the threshold value.
US08941481B2
A method for assisting in maintenance of a motor vehicle having a drive motor, an drive energy storage device, and a filling level measuring device. A request for a maintenance process is identified by a self-monitoring device with the maintenance request being transmitted as a maintenance indication to a driver by an information device. The maintenance indication is transmitted to the driver as a function of a switch-off filling level present when the vehicle drive motor is switched off and detected by the filling level measuring device. The maintenance indication is transmitted when the switch-off filling level is lower than a preset filling level threshold value or when a filling level difference between a switch-on filling level, present when the vehicle drive motor is subsequently switched on again and detected by the filling level measuring device, and the preceding switch-off filling level indicates a positive filling level value.
US08941480B2
A vehicular vision system includes a camera including an image sensor, a control including a microcontroller, and a serial data interface. The camera has a field of view exterior of a vehicle. A video output is configured for transmitting a stream of video captured by the image sensor. The microcontroller is operatively connected to the image sensor. The serial data interface permits the microcontroller to communicate with at least one electronic device in the vehicle. A resistor having a selected impedance is connected in series with a switch. The resistor and the switch connect a video plus electrical conduit and a video minus electrical conduit. The switch is openable by the microcontroller to deactivate the video output into a high impedance state and is closable to activate the video output. The microcontroller is configured to comply with selected messages received through the serial data interface by opening the switch.
US08941475B2
An apparatus for producing an electrosensory sensation to a body member (120). The apparatus comprises one or more conducting electrodes (106), each of which is provided with an insulator (108). When the body member (120) is proximate to the conducting electrode, the insulator prevents flow of direct current from the conducting electrode to the body member. A capacitive coupling over the insulator (108) is formed between the conducting electrode (106) and the body member (120). The conducting electrodes are driven by an electrical input which comprises a low-frequency component (114) in a frequency range between 10 Hz and 500 Hz. The capacitive coupling and electrical input are dimensioned to produce an electrosensory sensation. The apparatus is capable of producing the electrosensory sensation independently of any mechanical vibration of the one or more conducting electrodes (106) or insulators (108).
US08941468B2
A planogram specifying items of a item type associated with a first location may be determined, and item read events for the items of the item type may be received from a first receiver associated with the first location and from a second receiver associated with a second location. A first counting of the item read events associated with the first receiver may be determined, and a second counting of the item read events associated with the second receiver may be determined. A clustering algorithm may be applied to the first counting and the second counting to determine a first cluster corresponding to a first subset of the items and a second cluster corresponding to a second subset of the items. Then, for each cluster, it may be determined whether the item read events contained therein indicate a presence of the corresponding subset of the items at the second location and in non-compliance with the planogram.
US08941454B2
A proportionally acting solenoid with a plastics encapsulation having a fastening flange which is integrally formed thereon and contains shaped elements which permit installation of the solenoid onto the housing by axial pressing in, rotation and rotary latching, the shaped elements, in interaction with metallic springs and shaped elements of the housing, holding the solenoid on a housing axially and against rotation, and the springs being tensioned upon rotation of the housing during the installation, and the seal which seals the radial gap between the solenoid and the housing being coordinated, by means of the configuration thereof, with a small axial installation force.
US08941450B2
An acoustic wave device includes a main resonator and a sub resonator each having a substrate, a lower electrode provided on the substrate, a piezoelectric film provided on the lower electrode, and an upper electrode provided on an upper side of the piezoelectric film. A frequency control film is provided on an upper side of a resonance area in which the upper electrode and the lower electrode face each other in at least one of the main resonator and the sub resonator. The frequency control film has multiple convex patterns, and the convex patterns are arranged with a common pitch for spurious adjustment and with different areas in the main resonator and the sub resonator.
US08941449B2
A coupler is presented that has high-directivity and low coupling coefficient variation. The coupler includes a first trace associated with a first port and a second port. The first trace includes a first main arm, a first connecting trace connecting the first main arm to the second port, and a non-zero angle between the first main arm and the first connecting trace. Further, the coupler includes a second trace associated with a third port and a fourth port. The second trace includes a second main arm.
US08941444B2
A crystal oscillator is configured by accommodating a crystal blank that functions as a crystal unit and an IC chip that includes at least an oscillator circuit using the crystal blank into a container in an integrated manner. In the IC chip, the oscillator circuit is connected to the crystal unit via a pair of crystal connecting terminals, an output from the oscillator circuit is supplied to a plurality of output buffers. In relation to the crystal connecting terminal having a phase opposite to that of an output from the on/off controllable output buffer, an output terminal of this output buffer is disposed farther than an output terminal of the output buffer that is not subjected to the on/off control.
US08941443B1
A cavity filter having a piezoelectric tuning element is tuned by determining a desired oscillating frequency for the piezoelectric tuning element and applying that frequency through a phase-locked loop. The phase-locked loop maintains the piezoelectric tuning element at the desired frequency.
US08941441B2
A low noise amplifier including a variable gain amplifier stage configured to accept an input signal and to provide a load driving signal; a tunable bandpass filter connected as a load to the variable gain amplifier stage, wherein the bandpass filter includes a cross-coupled transistor pair, and at least one cross-coupled compensation transistor pair biased in a subthreshold region configured to add a transconductance component when the load driving signal is of a magnitude large enough to decreases a transconductance of the cross-coupled transistor pair; and, a controller circuit configured to tune the bandpass filter. The filter can be tuned in respect to the frequency and the quality factor Q.
US08941438B2
An apparatus for limiting the bandwidth of an amplifier provides for the design of an input impedance, a feedback impedance, and a load impedance such that the load impedance is proportional to the sum of the input impedance and feedback impedance. A sampling circuit has a load impedance including a resistor and capacitor in series to reduce the effective amplifier transconductance, which decreases bandwidth without increasing noise density or making this circuit more difficult to drive than a conventional circuit.
US08941435B2
Techniques reduce erroneous judgment due to effects of noise accompanying PWM control. LEDs light operating portions and function as indicators. Circuitry adjusts brightness of the LEDs through PWM control. A detecting circuit outputs detected values in accordance with electrostatic capacitances of the electrode. A CPU senses a touch operation when a difference between a detected value of the detecting circuit and a reference value is more than a prescribed value. The CPU stores a detected value as a reference value which is the first value detected by the detecting circuit after the PWM control execution state of the LEDs has been changed or the first value that is detected by the detecting circuit, which is comprised by a touch switch that is in a specified positional relationship with respect to the touch switch which executing state of PWM control of the LEDs has changed, after transition of the executing state.
US08941434B1
A system and method for reducing simultaneous switching output (SSO) noise. In one embodiment, power supply decoupling capacitances are distributed non-uniformly among a plurality of I/O circuits. Transitions between consecutive values on a data bus are either sent by the transmitter as requested at the input of the transmitter, or, in cases for which the noise of the requested transition is high, converted by an encoder to transitions having lower SSO noise. The converted transitions are decoded in a receiver, so that the data at the output of the receiver are the same as the data at the input to the transmitter.
US08941423B2
Circuits and methods for implementing a continuously adaptive timing calibration training function in an integrated circuit interface are disclosed. A mission data path is established where a data bit is sampled by a strobe. A similar reference data path is established for calibration purposes only. At an initialization time both paths are calibrated and a delta value between them is established. During operation of the mission path, the calibration path continuously performs calibration operations to determine if its optimal delay has changed by more than a threshold value. If so, the new delay setting for the reference path is used to change the delay setting for the mission path after adjustment by the delta value. Circuits and methods are also disclosed for performing multiple parallel calibrations for the reference path to speed up the training process.
US08941420B2
In a first clock frequency multiplier, multiple injection-locked oscillators (ILOs) having spectrally-staggered lock ranges are operated in parallel to effect a collective input frequency range substantially wider than that of a solitary ILO. After each input frequency change, the ILO output clocks may be evaluated according to one or more qualifying criteria to select one of the ILOs as the final clock source. In a second clock frequency multiplier, a flexible-injection-rate injection-locked oscillator locks to super-harmonic, sub-harmonic or at-frequency injection pulses, seamlessly transitioning between the different injection pulse rates to enable a broad input frequency range. The frequency multiplication factor effected by the first and/or second clock frequency multipliers in response to an input clock is determined on the fly and then compared with a programmed (desired) multiplication factor to select between different frequency-divided instances of the frequency-multiplied clock.
US08941417B2
A system for recovering energy from a sensor couples a battery to an inductive device in the sensor for a period of time, such that a current flows through the inductive device from the battery during the time period. The connections of the inductive device are then reversed for a second period of time. During the second time period, a current flow resulting from energy stored in the inductor is allowed to flow back to the battery, such that a portion of the energy from the inductor recharges the battery during the second period of time.
US08941416B2
Provided is a semiconductor device exemplified by an inverter circuit and a shift register circuit, which is characterized by a reduced number of transistors. The semiconductor device includes a first transistor, a second transistor, and a capacitor. One of a source and a drain of the first transistor is electrically connected to a first wiring, and the other thereof is electrically connected to a second wiring. One of a source and a drain of the second transistor is electrically connected to the first wiring, a gate of the second transistor is electrically connected to a gate of the first transistor, and the other of the source and the drain of the second transistor is electrically connected to one electrode of the capacitor, while the other electrode of the capacitor is electrically connected to a third wiring. The first and second transistors have the same conductivity type.
US08941410B1
Buffer circuit embodiments are described. A buffer circuit includes an input configured to receive an input signal and a buffer configured to generate an output signal based on the input signal. In one embodiment, the buffer circuit includes a programmable chopping module coupled with the buffer, wherein the programmable chopping module is programmable with a selected configuration from a plurality of configurations, and wherein the programmable chopping modulates the input signal based on the selected configuration. In another embodiment, the buffer circuit further includes a programmable output filter coupled with the buffer, wherein the programmable output filter is programmable with a selected configuration form a plurality of configurations, and wherein the programmable output filter filters a frequency band of the output signal based on the selected configuration.
US08941405B2
A FET pair based physically unclonable function (PUF) circuit with a constant common mode voltage and methods of use are disclosed. The circuit includes a first n-type field effect transistor (NFET) and a second NFET. The circuit also includes a first load resistor coupled to the first NFET by a first p-type field effect transistor (PFET) and a second load resistor coupled to the second NFET by a second PFET. The circuit further comprises a closed loop, wherein the closed loop creates a constant common mode voltage.
US08941399B2
A first integrated circuit includes a first voltage output circuit for outputting a voltage, which proportionally increases in correspondence to an angular position of a throttle valve, a first protective resistor, a first output terminal connected to the first protective resistor, and a first abnormality detection circuit for outputting a first abnormality detection signal based on a voltage produced by the first protective resistor. A second integrated circuit is configured similarly to the first integrated circuit by a second voltage output circuit, a second protective resistor, a second output terminal, and a second abnormality detection circuit.
US08941397B2
The present invention relates to a movement sensor that comprises a plurality of plate-type layers on which individual sensors are arranged. The layers are configured in the way set forth in the claims.
US08941396B2
An electronic sensing system has a transceiver with input and output pads, an excitation circuit connected to the output pad, and a detection circuit connected to the input pad. An electrically-conductive sensor patch has an electrical state that changes with exposure to a corresponding environmental factor. The detection circuit detects an electrical state of the input electrical-connection pad in response to the excitation signal and the electrical state of the sensor patch. A stack of one or more layers in order is disposed over the sensor patch in the detection region. Each layer is susceptible to a respective environmental factor, so that the sensor patch changes electrical state in response to exposure of the layer stack to the respective environmental factors of the one or more layer(s) in the selected order and subsequent exposure of the sensor patch to the corresponding environmental factor.
US08941395B2
Capacitive sensing devices are provided that include a sensing pattern of conductive traces disposed upon the surface of a substrate and a first passive circuit element that includes a metallic conductor disposed upon the same surface of the substrate. In some embodiments, the first passive circuit element is a component of an electronic circuit that can be, for example, a low pass filter. Provided capacitive sensing devices are useful, for example, when incorporated into projected touch screen display panels for use on electronic devices.
US08941390B2
A test system for medical devices that does not require physical contact with an electrical site along a conductive path is described. Not having to physical contact an electrical site while performing an electrical continuity test avoids potential damage to the site. The test system includes a fluidic channel that dispenses an electrolytic solution onto a first electrical site on the conductive path. A light source irradiates the first site to thereby induce a photoelectrochemical (PEC) effect at an interface thereof. The PEC effect produces a change in both the potential (i.e., voltage) and current carrying ability in the conductive path. That voltage or current is measured at a second site to determine whether there is electrical continuity or discontinuity between the sites on the conductive path.
US08941389B2
A position sensor that includes two coils, the first coil (transmitting coil) being fed a certain frequency such that it emits a constant electromagnetic field, and said field being received and/or detected by way of the second coil (receiving coil), is characterized in that the axis of the second coil is angled with respect to the axis of the first coil, preferably located at an angle of 90° with respect to the axis of the first coil.
US08941384B2
A high-frequency data and/or power transmission system suitable for downhole use including signal/power couplers, transmission line segments and signal repeaters. Signals and power are/is transmitted between couplers and/or between couplers and repeaters by means of electromagnetic resonance coupling. In at least a portion of the system, the transmission line segments form parallel data paths and the repeaters provide crossover capability between the data/power paths, thereby significantly improving reliability. The invention also includes methods of transmitting data and/or distributing high-frequency power through a downhole transmission system including multiple data/power paths and multiple crossovers wherein a fault location in one data/power path is bypassed by routing data and/or power to a parallel data/power path by means of electromagnetic resonance coupling.
US08941382B2
Described are methods and apparatus, referred to as “temperature-lock,” which can control and stabilize the sample temperature in an NMR spectrometer, in some instances with a precision and an accuracy of below about 0.1 K. In conventional setups, sample heating caused by experiments with high-power radio frequency pulses is not readily detected and is corrected by a cumbersome manual procedure. In contrast, the temperature-lock disclosed herein automatically maintains the sample at the same reference temperature over the course of different NMR experiments. The temperature-lock can work by continuous or non-continuous measurement of the resonance frequency of a suitable temperature-lock nucleus and simultaneous adaptation of a temperature control signal to stabilize the sample at a reference temperature value. Inter-scan periods with variable length can be used to maintain the sample at thermal equilibrium over the full length of an experiment.
US08941381B2
Disclosed are methods and systems for carrying out super-multiplexed magnetic resonance imaging that entwines techniques previously used individually and independently of each other in Simultaneous Echo (or Imaging) Refocusing (SER or SIR) and Multi-Band (MB) excitation, in a single pulse sequence that provides a multiplication rather than summation of desirable effects while suppressing undesirable effects of each of the techniques that previously were used independently.
US08941379B2
Systems and methods for detecting electromagnetic waves are disclosed. A system for use in detecting an electromagnetic wave includes an inductive device and a spintronic device. The inductive device generates an induced electromagnetic field when the inductive device receives the electromagnetic wave. The spintronic device has an impedance that changes when exposed to the induced electromagnetic field from the inductive device. The change in impedance is indicative of the electromagnetic wave received by the inductive device. Another system for use in detecting or transmitting an electromagnetic wave includes a conductive device and an inductive device. The inductive device is configured to generate an induced electromagnetic wave when the inductive device receives an electromagnetic wave passed by the conductive device. Another system for detecting electromagnetic wave permittivity or permeability of an object includes a pair of antennas and an inductive device.
US08941377B2
An optically pumped magnetometer and a magnetic sensing method acquire information as to strengths of magnetic fields in two different directions. A pump light having a circularly polarized component, first probe light having a liner polarized component and second probe light having a linearly polarized component are emitted to a cell containing a group of alkali metal atoms so as to form a crossing region A magnetic field applying unit applies a static magnetic field in a direction of the pump light incident on the crossing region during the emission of the pump light, the first probe light and the second probe light. And, information as to strengths of magnetic fields in two different directions perpendicular to the direction of the static magnetic field in the cell from the rotation angles of a polarization planes of the first and second probe lights during passage through the cell is calculated.
US08941371B2
An RFID-based sensor is provided with an RFID chip and an antenna electrically connected to the RFID chip. The sensor further includes a sensing material electrically connected to the antenna and a drive element. At least a portion of the sensor is movable between a closed condition in which the sensing material is isolated from the outside environment and an open condition in which the sensing material is exposed to the outside environment. The drive element moves the sensor between the open and closed configurations depending on whether or not it is receiving a signal.
US08941370B2
A temperature corrected voltage bandgap circuit is provided. The circuit includes first and second diode connected transistors. A first switched compare circuit is coupled to the one transistor to inject or remove a first current into or from the transistor. The first current is selected to correct for curvature in the output voltage of the bandgap circuit at one of hotter or colder temperatures.
US08941367B2
A switching regulator including: a power stage having a first power switch and a second power switch coupled in series; a filter circuit having an inductor and an output capacitor; a feedback circuit configured to provide a feedback signal indicating an output voltage of the regulator; and a control circuit configured to provide a switching signal to control the ON and OFF of the first power switch so as to regulate the energy supplied to a load; wherein the control circuit has a peak current generator configured to generate a peak current signal, wherein the gain of a variation of the peak current signal between the contiguous switching cycles is less than one.
US08941364B2
An on-demand electric power system for providing on-demand electric power in remote locations. The on-demand electric power system generally includes a protective housing, an engine-generator within the protective housing, a control switch electrically positioned between the engine-generator and an electric load, and a control unit in communication with the engine-generator and the control switch to control operation of the engine-generator along with electrical power to the electric load. The control unit detects when electrical power is required by an electric load and then first starts the engine-generator. After a period of time, the control unit then closes the control switch to provide electrical power to the electric load.
US08941362B2
There is provided a charging apparatus including a connection unit to which a device is to be connected, a charging unit for charging the device connected to the connection unit, a history acquisition unit for acquiring a history of content use stored in the device, a timing prediction unit for predicting a timing of use of the device based on the history of content use acquired by the history acquisition unit, and a charge control unit for controlling the charging unit such that the device connected to the connection unit becomes fully charged at a timing suitable for the timing predicted by the timing prediction unit.
US08941361B2
A computer system to charge a rechargeable battery of an external device regardless of power on/off of the computer system when the external device having the rechargeable battery is connected, and a control method thereof. The computer system includes a connector having a terminal to which an external device is connected, a power supply to supply power to the connector, and a recognition signal generator to generate a predetermined recognition signal to initiate charging a rechargeable battery of the external device with power supplied from the power supply through the connector when the external device having the rechargeable battery is connected to the connector through the terminal. Thus, it is possible to charge the battery of the external device even when the computer system is powered off.
US08941358B2
A circuit for heating a battery includes the battery including parasitic damping and current storage components, a switch unit, a switching control component coupled to the switch unit, a charge storage component, and a freewheeling circuit. The charge storage component and current storage component are at least parts of an energy storage circuit. The damping component, the current storage component, the switch unit, and the charge storage component are connected. The switching control component is configured to turn on and off the switch unit so as to control a first current flowing from the battery to the charge storage component and a second current flowing from the charge storage component to the battery. The freewheeling circuit is configured to allow a freewheeling current to flow to the battery after the switch unit is turned off. The circuit for heating the battery is configured to heat the battery by at least discharging and charging the battery.
US08941352B2
A contactless charging apparatus of a portable terminal is provided. The contactless charging apparatus of a portable terminal includes a main circuit board, a rectifying unit, a charging unit, and a secondary coil unit mounted on the main circuit board for generating an electromotive force. The secondary coil unit may be formed on the main circuit board in a patterning process instead of an existing copper line coil. A coil layer formed in the patterning process generates an electromotive force induced by a magnetic induction field created by a contactless charger, and a direct current is applied to a battery to charge the battery using the rectifying unit and the charging unit.
US08941348B2
System and methods for protecting motors of a vehicle are provided. A system includes a current transformer device for each phase of the three-phase power received by each protected motor. Each current transformer device includes a switch that is normally in a first position and is configured to monitor an output current of fuse through which the power is transmitted, compare the output current to a threshold current level, and, when the output current is below the threshold current level, change the switch to a second position. The system also includes a processing circuit configured to control operation of the one or more motors of the vehicle. The processing circuit is configured to determine whether one or more of the switches of the plurality of current transformer devices is in the second position and, if so, activate a fault condition.
US08941340B2
A regenerative variable frequency drive includes an active converter connected to an inverter. The converter has a filter capacitor, an inductor, two half bridges, bus bars that connect to the inverter and bus capacitors. The converter converts single phase AC power to DC power and DC power to single phase AC power, boosts the AC power, reduces input line harmonics, maintains input current in phase with utility voltage in order to achieve near unity power factor, and maintains constant DC voltage between the bus bars.
US08941338B2
An electric braking device for printing material processing machines includes at least one electric drive to be braked that is supplied by a power converter in motor operation and is braked by the power converter in generator operation. A control unit switches on a redundant electric braking device in the case of a failure of the power converter by using a switch. The braking device has at least two braking stages, an additional switch for actuation in at least two stages, and at least one brake resistor. In the circuit of the redundant electric braking device, a braking current is measured and the measured value is fed to a comparator for comparing the actual braking current to a desired braking current. A printing press having the braking device is also provided.
US08941325B2
The present invention discloses a current splitter circuit for splitting a supply current to multiple light emitting device strings of a light emitting device array. The current splitter circuit includes: a minimum selector circuit coupled to the multiple light emitting device strings to generate a minimum signal which indicates a minimum voltage of the light emitting device strings; and multiple current source circuits each including a first current source end coupled to a corresponding light emitting device string, a second current source end coupled to ground, and a current source control end receiving a current control signal related to the minimum signal, so as to control currents through the corresponding light emitting device string.
US08941321B2
A discharge lamp lighting device light which drives a discharge lamp with an alternating power includes a DC-DC converter, an inverter, a voltage detector which detects an output voltage of the DC-DC converter, and a current detector which detects an output current of the DC-DC converter. The discharge lamp lighting device light further includes a controller controlling a switching frequency of the DC-DC converter according to a detection value of at least one of the voltage detector and the current detector; and a PWM ON signal controller increasing a DC power by lengthening an ON duty of a PWM signal during a predetermined period after a start of polarity inversion of the alternating power. When the voltage detector and/or the current detector detects a detection value, the controller changes an increase amount of the DC power according to the detection value.
US08941317B1
A power drive system of light-emitting diode (LED) strings includes an isolation transformer, a current-sharing capacitor, two rectifying units, and a current control integrated circuit (IC). The isolation transformer has a primary-side winding and a secondary-side winding with a dotted terminal and a non-dotted terminal. The current-sharing capacitor is connected to the dotted terminal at one terminal thereof. One rectifying units is connected to the other terminal of the current-sharing capacitor, and the other rectifying unit is connected to the non-dotted terminal of the secondary-side winding. Each rectifying unit is connected to one LED string. The current control IC is connected between common points of the rectifying units and corresponding anode terminals of the LED strings and corresponding cathode terminals of the LED strings.
US08941314B2
In a light emitting device, luminance irregularities caused by fluctuation in threshold of TFTs for supplying a current to EL elements among pixels hinder the light emitting device from improving the image quality. A voltage equal to the threshold of a TFT 110 is held in capacitor means 111 in advance. When a video signal is inputted from a source signal line, the voltage held in the capacitor means is added to the signal, which is then applied to a gate electrode of the TFT 110. Even when threshold is fluctuated among pixels, each threshold is held in the capacitor means 111 of each pixel, and therefore, influence of the threshold fluctuation can be removed. Since the threshold is stored in the capacitor means 111 alone and the voltage between two electrodes is not changed while a video signal is written, fluctuation in capacitance value has no influence.
US08941311B2
There is described a system and method for controlling the intensity of a lighting system for vehicles comprising light emitting diodes mounted on printed circuit boards (PCBs). The method comprises sending a first modulation signal to the lighting modules from a master controller upon detection of a presence of power from a power source by the master controller; and sending a second modulation signal to the lighting modules from the master controller upon detection of an absence of power from a power source by the master controller. The first modulation signal corresponds to a first LED intensity and the second modulation signal corresponds to a second LED intensity lower than the first light intensity.
US08941310B2
An LED (Light Emitting device) driving circuit is disclosed, the circuit characterized by: at least two LED strings (120); at least two constant current control blocks (140) for respectively controlling a current path of the at least two LED strings; a detector (160) for detecting a voltage in the at least two constant current control blocks; and a power supply (200) for supplying a driving power to the at least two LED strings (120) in response to the detected voltage.
US08941304B2
A fast starting dimmable induction RF fluorescent lamp comprising a dimming facility enabling the induction RF fluorescent lamp to dim in response to a signal from an external dimming device, and with structures within the bulb envelope that facilitate rapid luminous development during a turn-on phase.
US08941302B2
The invention provides a light-emitting arrangement comprising: a light source adapted to emit light of a first wavelength; a wavelength converting member comprising an organic wavelength converting material adapted to receive light of said first wavelength and to convert at least part of the received light to light of a second wavelength, said wavelength converting member and said light source being mutually spaced apart; and a sealing structure at least partially surrounding said wavelength converting member to form a sealed cavity containing at least said wavelength converting member, the gas pressure within said sealed cavity being 1*10−5 bar (1 Pa) or less. At such pressure, the organic phosphor has been found to have particularly good stability, thus resulting in a longer life time of the phosphor.
US08941295B2
A fluorescent material is represented by the following formula (I): M1yM2nOzNx:M3w (I); wherein M1 is selected from Sc3+, Y3+, La3+, Sm3+, Gd3+, Pm3+, Er3+, Lu3+, and combinations thereof; M2 is selected from Al3+, In3+, Ga3+, and combinations thereof; M3 is selected from Tm3+, Bi3+, Tb3+, Ce3+, Eu3+, Mn3+, Er3+, Yb3+, Ho3+, Gd3+, Pr3+, Dy3+, Nd3+, and combinations thereof; 0.6≦x/n≦1.6, 0.54≦y/n≦0.6, 0
US08941294B2
In various embodiments, a luminophore composition for low pressure discharge lamps for generating radiation with a color temperature of greater than 4800 K having a very good general color rendering index of greater than 90, the luminophore composition including at least one halophosphate luminophore, a luminophore emitting in the red wavelength region, a luminophore emitting in the blue-green wavelength region, a europium-doped luminophore emitting in the blue wavelength region and a Tb-doped luminophore emitting in the green wavelength region, wherein the luminophore composition includes a luminophore emitting in an emission range in the visible region with wavelengths of greater than 380 nm and at least one emission band in the near ultraviolet and that the emitted intensity of the luminophore is smaller in the visible region than in the near ultraviolet region.
US08941291B2
A plasma actuator (1) includes four electrodes (11) and three dielectrics (10) and is disposed on the side of an object surface (B). When a high voltage is applied to the electrodes (11), a plasma (15) is generated at an end (10a) of each dielectric (10) exposed so as to be accessible to a gas. In the plasma actuator (1), the electrodes (11) and dielectrics (10) are alternately stacked one on another. The plasma actuator (1) includes a stepped exposed portion (X). The plasma actuator (1) in which the electrodes (11) and dielectrics (10) are arranged such that the ends (10a) of the dielectrics (10) are exposed in the normal line direction of the object surface (B) in the stacked order in the stepped exposed portion (X) can suppress the flow of the generated plasma even when the plasma actuator is exposed to a high-speed airflow under high pressure. This stabilizes the plasma.
US08941289B2
A power generation unit includes: a deforming member adapted to deform while switching a deformation direction; a piezoelectric device provided to the deforming member, and having a pair of electrodes; a displacement sensor adapted to detect a deformation amount of the deforming member, and then output deformation amount information as information related to the deformation amount; an inductor electrically connected to the piezoelectric device; a switch disposed between the piezoelectric device and the inductor; and a switch control section adapted to control the switch so as to set the pair of electrodes to a shorted state for a predetermined period of time when the deformation amount exceeds a predetermined level.
US08941284B2
The present invention relates to an electromechanical converter, in particular an electromechanical sensor, actuator and/or generator, which comprises a polymer element obtainable from a reaction mixture comprising a polyisocyanate, a polyisocyanate prepolymer and a compound having at least two isocyanate-reactive hydroxy groups. The present invention additionally relates to a process for the production of such an electromechanical converter and to the use of a polymer element according to the invention as an electromechanical element. The present invention relates further to an electronic and/or electrical device comprising an electromechanical converter according to the invention and to the use of an electromechanical converter according to the invention in an electronic and/or electrical device.
US08941267B2
A high-power induction-type power supply system includes a supplying-end module consisting of a supplying-end microprocessor, a power driver unit, a signal analysis circuit, a coil voltage detection circuit, a display unit, a power supplying unit, a resonant circuit, a supplying-end coil and a shunt resistor unit, and a receiving-end module consisting of a receiving-end microprocessor, a voltage detection circuit, a rectifier and filter circuit, an amplitude modulation circuit, a protection circuit breaker, a voltage stabilizer circuit, a DC-DC buck converter, a resonant circuit and a receiving-end coil. Subject to time series arrangement, the high-power induction-type power supply system allows transmission of data signal in a stable manner during a charging operation, assuring system operation stability and low power loss. By means of bi-phase decoding, data code is accurately decoded when the receiving-end module is at full load, ensuring system operating reliability.
US08941264B2
A plurality of modules each including at least a pair of series connected power MOSFETs are configured between a plurality of DC voltage sources, and a plurality output terminals for connection to respective loads, are controlled for selectively applying power to the loads via time delay switching incorporating forward biased intrinsic diodes of the MOSFETs in a given current path during initial application of power to a load, whereby a predetermined period of time after turning on one of the series connected MOSFETs, the associated other MOSFET is turned on to shunt its intrinsic diode for reducing the resistance in the current path to maximize current flow. The configuration of the plurality of power MOSFETs is also controlled for selectively providing bi-directional current flow between said plurality of DC voltage sources.
US08941261B2
A method is provided in one example embodiment and includes receiving a message associated with a detection of reactive power in an energy system and inducing a first quantity of reactive power at a power level specified in the message. The first quantity of reactive power is induced in order to mitigate a second quantity of reactive power that is detected on a specific segment of the energy system. The first quantity of reactive power is induced at a local level on which a source associated with the second quantity of reactive power operates. In more specific embodiments, the message is sent in response to a sensor detecting the second quantity of reactive power, where the first quantity and the second quantity of reactive power are the same. In other embodiments, the method can include receiving a second message to stop mitigating the first quantity of reactive power.
US08941257B2
In a wind power generator, a nacelle is located on an upper portion of a support rod, a rotor head having wind turbine blades fitted thereto is rotatably supported to a front end side of the nacelle, and a main shaft rotating integrally with the rotor head, a gear box coupled with the main shaft which rotates while the wind turbine blades receive a wind power, a power generator having a rotor driven by a shaft output of the gear box, a brush, and a slip ring, and a humidity management device controlling humidity inside of the power generator having the brush and the slip ring, are installed in an interior of the nacelle.
US08941256B1
A data center includes a computing room, computing devices in the computing room, an air handling system, and a turbine system. Air moved by the air handling system flows across heat producing components in the computing devices in the computing room. A rotor of the turbine system rotates in response to at least a portion of the air moved by the air handling system. The turbine system generates electricity from rotation of the rotor.
US08941255B2
A generator for a wind turbine is provided. The generator includes a housing with a multi-piece stator arrangement mounted to the housing, the stator arrangement surrounding radially inward and radially outwardly directed faces of a rotor assembly, also surrounded by the housing. The rotor assembly is configured for direct attachment to a wind turbine main shaft so that rotation of the main shaft results in like rotation of the rotor assembly. The housing is mechanically coupled to the rotor by anti-friction elements such that the rotor is free to rotate about its central axis relative to the housing, and such that radial displacement of the rotor due to main shaft deflections results in a like radial displacement of the housing.
US08941253B2
A method for operating a wind turbine which includes a rotor hub supporting a rotor blade includes: a) detecting changes in the aerodynamic performance of the rotor blade; b) determining a first control rule; c) determining a first power output information indicating a first power output based on the first control rule; d) changing an operational parameter and choosing a second control rule such that the first control rule is replaced by the second control rule; e) determining a second power output information indicating a second power output based on the second control rule. c) comparing the first and second power output information. If the second power output exceeds the first power output, repeating a)-f) with the second control rule being used as the first control rule in b); otherwise repeating a)-f) a different second control rule is applied in d).
US08941246B2
In one embodiment, a semiconductor device includes a chip stacked body disposed on an interposer substrate and an interface chip mounted on the chip stacked body. The chip stacked body has plural semiconductor chips, and is electrically connected via through electrodes provided in the semiconductor chips excluding a lowermost semiconductor chip in a stacking order of the plural semiconductor chips and bump electrodes. The interface chip is electrically connected to the interposer substrate via a rewiring layer formed on a surface of an uppermost semiconductor chip in the stacking order or through electrodes provided in the interface chip.
US08941244B1
A semiconductor structure includes a molding compound, a conductive plug, and a cover. The conductive plug is in the molding compound. The cover is over a top meeting joint between the conductive plug and the molding compound. The semiconductor structure further has a dielectric. The dielectric is on the cover and the molding compound.
US08941239B2
A copper interconnect structure in a semiconductor device including an opening formed in a dielectric layer of the semiconductor device, the opening having sidewalls and a bottom. A first barrier layer is conformally deposited on the sidewalls and the bottom of the opening. A first seed layer is conformally deposited on the first barrier layer. A second barrier layer is conformally deposited on the first seed layer. A second seed layer is conformally deposited on the second barrier layer and a conductive plug is deposited in the opening of the dielectric layer.
US08941236B2
Provided are an electronic assembly and method for forming the same, comprising a first element having a first surface and a second element having a second surface.Electrical connections are provided between the first and the second elements formed by heating solder bumps. At least one collapse limiter structure is coupled to at least one of the first and the second surfaces, wherein the at least one collapse limiter structure is between at least two of the electrical connections.
US08941233B1
Integrated circuit (IC) packages with an inter-die thermal spreader are disclosed. A disclosed IC package includes a plurality of stacked dies disposed on a package substrate. A heat spreader is disposed on a top die of the plurality of stacked dies. The IC package further includes a thermal spreader layer disposed adjacent to at least one die of the plurality of stacked dies. The thermal spreader layer may extend out of a periphery of the plurality of stacked dies and may be attached to the heat spreader through a support member.
US08941223B2
A MEMS lead frame package body encloses a MEMS device enclosed in an internal cavity formed by the mold body and cover. A conductive internal shell with a connection window sits in the cavity. The MEMS device is mounted in the shell and electrically coupled to the lead frame through wire bonds directed through the connection window. To accommodate a MEMS microphone, an acoustic aperture extends through the mold body aligned with a hole in the internal shell.
US08941222B2
A semiconductor package includes at least one semiconductor die having an active surface, an interposer element having an upper surface and a lower surface, a package body, and a lower redistribution layer. The interposer element has at least one conductive via extending between the upper surface and the lower surface. The package body encapsulates portions of the semiconductor die and portions of the interposer element. The lower redistribution layer electrically connects the interposer element to the active surface of the semiconductor die.
US08941217B2
A semiconductor device includes a semiconductor substrate having a first side and a second side opposite the first side, an active area and a through contact area, the active area including a transistor structure having a control electrode, the through contact area including a semiconductor mesa having insulated sidewalls. The semiconductor device further includes a first metallization on the first side in the active area and a recess extending from the first side into the semiconductor substrate and between the active area and the through contact area and including in the through contact area a horizontally widening portion, the recess being at least partly filled with a conductive material forming a first conductive region in ohmic contact with the semiconductor mesa and the transistor structure. The semiconductor device also includes a control metallization on the second side and in ohmic contact with the semiconductor mesa.
US08941216B2
The inventive concept provides semiconductor devices having through-vias and methods for fabricating the same. The method may include forming a via-hole opened toward a top surface of a substrate and partially penetrating the substrate, forming a via-insulating layer having a first thickness on a bottom surface of the via-hole and a second thickness smaller than the first thickness on an inner sidewall of the via-hole, forming a through-via in the via-hole which the via-insulating layer is formed in, and recessing a bottom surface of the substrate to expose the through-via. Forming the via-insulating layer may include forming a flowable layer on the substrate, and converting the flowable layer into a first flowable chemical vapor deposition layer having the first thickness on the bottom surface of the via-hole.
US08941212B2
The present disclosure relates to a multi-level integrated inductor that provides for a good inductance and Q-factor. In some embodiments, the integrated inductor has a first inductive structure with a first metal layer disposed in a first spiral pattern onto a first IC die and a second inductive structure with a second metal layer disposed in a second spiral pattern onto a second IC die. The first IC die is vertically stacked onto the second IC die. A conductive interconnect structure is located vertically between the first and second IC die and electrically connects the first metal layer to the second metal layer. The conductive interconnect structure provides for a relatively large distance between the first and second inductive structures that provides for an inductance having a high Q-factor over a large range of frequencies.
US08941209B2
Semiconductor device comprises a memory cell region, a peripheral region, and first wiring. The memory cell region includes a first isolation region, and a first active region provided so as to be divided off by the first isolation region. The peripheral region includes a second isolation region, and a second active region divided off by the first and second isolation regions and protruding from the upper surface of an insulating film located in the first and second isolation regions. The first wiring is buried in portions of a semiconductor substrate within the memory cell region and the peripheral region, so as to extend over the first and second active regions in a first direction. The first-direction width of the second active region is constant.
US08941197B2
A magnetic random access memory which is a memory cell array including a magnetoresistive effect element having a fixed layer whose magnetization direction is fixed, a recording layer whose magnetization direction is reversible, and a non-magnetic layer provided between the fixed layer and the recording layer, wherein all conductive layers in the memory cell array arranged below the magnetoresistive effect element are formed of materials each containing an element selected from a group including W, Mo, Ta, Ti, Zr, Nb, Cr, Hf, V, Co, and Ni.
US08941193B2
A simple and cost-effective manufacturing method for hybrid integrated components including at least one MEMS element, a cap for the micromechanical structure of the MEMS element, and at least one ASIC substrate, using which a high degree of miniaturization may be achieved. The micromechanical structure of the MEMS element and the cap are manufactured in a layered structure, proceeding from a shared semiconductor substrate, by applying at least one cap layer to a first surface of the semiconductor substrate, and by processing and structuring the semiconductor substrate proceeding from its other second surface, to produce and expose the micromechanical MEMS structure. The semiconductor substrate is then mounted with the MEMS-structured second surface on the ASIC substrate.
US08941191B2
A radio frequency microelectromechanical (RF MEMS) device can comprise an actuation p-n junction and a sensing p-n junction formed within a semiconductor substrate. The RF MEMS device can be configured to operate in a mode in which an excitation voltage is applied across the actuation p-n junction varying a non-mobile charge within the actuation p-n junction to modulate an electric field acting upon dopant ions and creating electrostatic forces. The electrostatic forces can create a mechanical motion within the actuation p-n junction. The mechanical motion can modulate a depletion capacitance of the sensing p-n junction, thereby creating a motional current. At least one of the p-n junctions can be located at an optimal location to maximize the efficiency of the RF MEMS device at high resonant frequencies.
US08941187B2
In a three-dimensional transistor configuration, a strain-inducing isolation material is provided, at least in the drain and source areas, thereby inducing a strain, in particular at and in the vicinity of the PN junctions of the three-dimensional transistor. In this case, superior transistor performance may be achieved, while in some illustrative embodiments even the same type of internally stressed isolation material may result in superior transistor performance of P-channel transistors and N-channel transistors.
US08941179B2
FinFETs and fin isolation structures and methods of manufacturing the same are disclosed. The method includes patterning a bulk substrate to form a plurality of fin structures of a first dimension and of a second dimension. The method includes forming oxide material in spaces between the plurality of fin structures of the first dimension and the second dimension. The method includes forming a capping material over sidewalls of selected ones of the fin structures of the first dimension and the second dimension. The method includes recessing the oxide material to expose the bulk substrate on sidewalls below the capping material. The method includes performing an oxidation process to form silicon on insulation fin structures and bulk fin structures with gating. The method further includes forming a gate structure over the SOI fin structures and the bulk fin structures.
US08941176B2
An embodiment of an integrated device includes a semiconductor body, in which an STI insulating structure is formed, laterally delimiting first active areas and at least one second active area in a low-voltage region and in a power region of the semiconductor body, respectively. Low-voltage CMOS components are housed in the first active areas. Formed in the second active area is a power component, which includes a source region, a body region, a drain-contact region, and at least one LOCOS insulation region, arranged between the body region and the drain-contact region and having a prominent portion that emerges from a surface of the semiconductor body, and an embedded portion inside it. The prominent portion of the LOCOS insulation region has a volume greater than that of the embedded portion.
US08941165B2
Methods are provided for fabricating semiconductor devices having capacitors, which prevent lower electrodes of the capacitors from breaking or collapsing and which provide increased capacitance of the capacitors. For instance, a method includes forming a first insulating layer on a semiconductor substrate, forming a first hole in the first insulating layer, forming a contact plug in the first hole, forming a second insulating layer having a landing pad, wherein the landing pad contacts an upper surface of the contact plug, forming an etch stop layer on the landing pad and the second insulating layer, forming a third insulating layer on the etch stop layer; forming a third hole through the third insulating layer and etch stop layer to expose the landing pad, selectively etching the exposed landing pad, forming a lower electrode on the selectively etched landing pad, and then forming a capacitor by forming a dielectric layer and an upper electrode on the lower electrode.
US08941163B2
A DRAM device includes plural N-channel MIS transistors arranged in a matrix over a P well, and a plurality of capacitors formed corresponding to the plurality of N-channel MIS transistors, and plural word lines formed corresponding to each row of the plurality of N-channel MIS transistors, and a plurality of bit lines formed corresponding to each column of the plurality of N-channel MIS transistors, and a P+ diffusion layer formed extending in the direction that the plurality of word lines extend and supplied with a p well voltage potential.
US08941159B2
Embodiments of an apparatus including a color filter arrangement formed on a substrate having a pixel array formed therein. The color filter arrangement includes a clear filter having a first clear hard mask layer and a second clear hard mask layer formed thereon, a first color filter having the first clear hard mask layer and the second hard mask layer formed thereon, a second color filter having the first clear hard mask layer formed thereon, and a third color filter having no clear hard mask layer formed thereon. Other embodiments are disclosed and claimed.
US08941153B2
An integrated circuit structure includes a semiconductor substrate including a first portion in a first device region, and a second portion in a second device region. A first semiconductor fin is over the semiconductor substrate and has a first fin height. A second semiconductor fin is over the semiconductor substrate and has a second fin height. The first fin height is greater than the second fin height.
US08941149B2
A semiconductor device includes: a first semiconductor layer formed on a substrate and formed of a nitride-based semiconductor; a second semiconductor layer formed on a surface of the first semiconductor layer and formed of a nitride-based semiconductor having a wider band-gap than the first semiconductor layer; first and second electrodes formed on a surface of the second semiconductor layer; an inter-electrode insulator film that is formed between the first and second electrodes on the surface of the second semiconductor layer; and a dielectric constant adjustment layer formed on the inter-electrode insulator film and formed of an electric insulator. The first electrode has a field plate portion formed so as to ride on the inter-electrode insulator film, and the dielectric constant adjustment layer has a first layer that contacts a lateral end portion of the field plate portion and a second layer formed on the first layer.
US08941144B2
This disclosure discloses a light-emitting device. The light-emitting device comprises: a substrate; and a first light-emitting unit comprising a plurality of light-emitting diodes electrically connected to each other on the substrate. A first light-emitting diode in the first light-emitting unit comprises a first semiconductor layer with a first conductivity-type, a second semiconductor layer with a second conductivity-type, and a light-emitting stack formed between the first and second semiconductor layers. The first light-emitting diode in the first light-emitting unit further comprises a first connecting layer on the first semiconductor layer for electrically connecting to a second light-emitting diode in the first light-emitting unit; a second connecting layer, separated from the first connecting layer, formed on the first semiconductor layer; and a third connecting layer on the second semiconductor layer for electrically connecting to a third light-emitting diode in the first light-emitting unit.
US08941141B2
A light-emitting device having a corner includes a light-emitting stacked layer having a first conductivity type semiconductor layer, a light-emitting layer formed on the first conductivity type semiconductor layer, and a second conductivity type semiconductor layer formed on the light-emitting layer. A transparent conductive oxide layer is formed on the second conductivity type semiconductor layer. The upper surface of the transparent conductive oxide layer is textured. A first electrode is formed on the upper surface of the transparent conductive oxide layer. A second electrode is formed on the first conductivity type semiconductor layer. A planarization layer is formed on the transparent conductive oxide layer and the first conductivity type semiconductor layer, and a reflective layer is formed on the upper surface of the planarization layer. The projection of the edge of the reflective layer is not overlapped with the edge of the first electrode or the second electrode.
US08941128B2
Embodiments of the present disclosure are directed towards passivation techniques and configurations for a flexible display. In one embodiment, a flexible display includes a flexible substrate, an array of display elements configured to emit or modulate light disposed on the flexible substrate, and a passivation layer including molecules of silicon (Si) bonded with oxygen (O) or nitrogen (N), the passivation layer being disposed on the array of display elements to protect the array of display elements from environmental hazards.
US08941121B2
A first region of a silicon carbide layer constitutes a first surface, and is of a first conductivity type. A second region is provided on the first region, and is of a second conductivity type. A third region is provided on the second region, and is of the first conductivity type. A fourth region is provided in the first region, located away from each of the first surface and the second region, and is of the second conductivity type. A gate insulation film is provided on the second region so as to connect the first region with the third region. A gate electrode is provided on the gate insulation film. A first electrode is provided beneath the first region. A second electrode is provided on the third region.
US08941120B2
According to one embodiment, a semiconductor device includes a first, a second, a third, a fourth semiconductor region, a control electrode, and an insulating film. The first region contains silicon carbide. The second region is provided on the first region and contains silicon carbide. The third region is provided on the second region and contains silicon carbide. The fourth region is provided on the third region and contains silicon carbide. The control electrode is provided in a trench. The trench is formed in the fourth, the third, and the second semiconductor region. The insulating film is provided between a side surface of the trench and the control electrode. The insulating film contains a high-dielectric constant region. The high-dielectric constant region contacts with at least the third semiconductor region. The high-dielectric constant region has a higher dielectric constant than a dielectric constant of silicon oxide.
US08941117B2
An integrated device including a vertical III-nitride FET and a Schottky diode includes a drain comprising a first III-nitride material, a drift region comprising a second III-nitride material coupled to the drain and disposed adjacent to the drain along a vertical direction, and a channel region comprising a third III-nitride material coupled to the drift region. The integrated device also includes a gate region at least partially surrounding the channel region, a source coupled to the channel region, and a Schottky contact coupled to the drift region. The channel region is disposed between the drain and the source along the vertical direction such that current flow during operation of the vertical III-nitride FET and the Schottky diode is along the vertical direction.
US08941114B2
A protective circuit includes a non-linear element, which includes a gate electrode, a gate insulating layer covering the gate electrode, a pair of first and second wiring layers whose end portions overlap with the gate electrode over the gate insulating layer and in which a second oxide semiconductor layer and a conductive layer are stacked, and a first oxide semiconductor layer which overlaps with at least the gate electrode and which is in contact with the gate insulating layer, side face portions and part of top face portions of the conductive layer and side face portions of the second oxide semiconductor layer in the first wiring layer and the second wiring layer. Over the gate insulating layer, oxide semiconductor layers with different properties are bonded to each other, whereby stable operation can be performed as compared with Schottky junction. Thus, the junction leakage can be decreased and the characteristics of the non-linear element can be improved.
US08941092B2
Disclosed are a method which improves the performance of a semiconductor element, and a semiconductor element with improved performance. The method for forming a semiconductor element structure includes a heterojunction forming step in which a heterojunction is formed between a strained semiconductor layer (21) in which a strained state is maintained, and relaxed semiconductor layers (23, 25). The heterojunction is formed by performing ion implantation from the surface of a substrate (50) which has a strained semiconductor layer (20) partially covered with a covering layer (30) on an insulating oxide film (40), and altering the strained semiconductor layer (20) where there is no shielding from the covering layer (30) to relaxed semiconductor layers (23, 25) by relaxing the strained state of the strained semiconductor layer (20), while maintaining the strained state of the strained semiconductor layer (21) where there is shielding from the covering layer (30).
US08941084B2
The invention relates generally to treatment of solid cancers. More particularly, a method and apparatus for efficient radiation dose delivery to a tumor is described. Preferably, radiation is delivered through an entry point into the tumor and Bragg peak energy is targeted to a distal or far side of the tumor from an ingress point. Delivering Bragg peak energy to the distal side of the tumor from the ingress point is repeated from multiple rotational directions. Beam intensity is proportional to radiation dose delivery efficiency. The multi-field irradiation process with energy levels targeting the far side of the tumor from each irradiation direction provides even and efficient charged particle radiation dose delivery to the tumor. Preferably, the charged particle therapy is timed to patient respiration via control of charged particle beam injection, acceleration, extraction, and/or targeting methods and apparatus.
US08941075B2
A system for detecting fissile materials which utilizes boron coated straw detectors in which the straws have non-circular cross sections. Embodiments include straws having star shaped cross sections of various configurations including a six pointed star. The system can include tubular housings having one or more shaped straws stacked within the housings.
US08941067B2
A method for cooling an imaging device includes providing, by a cold finger, a cold sink to the imaging device and conducting heat from a cold shield, a sensor chip assembly and a leadless chip carrier towards the cold finger through a plurality of parallel paths. The imaging device includes a dewar assembly having a cold shield, a sensor chip assembly disposed on a leadless chip carrier (LCC) and configured to capture an infrared image, a cold finger configured to cool the dewar assembly; and a thermal adapter. The thermal adapter is configured to draw heat from the cold shield and sensor chip assembly through a plurality of parallel paths towards the cold finger.
US08941066B2
An apparatus and method of processing signals from a passive infrared sensor evaluates energy of received signals. An integration or accumulation process can be used to provide an indicator of signal energy. This indicator can be compared to a predetermined alarm threshold to determine if an alarm indication should be generated.
US08941058B2
The invention relates to ions guided by gas flows in mass spectrometers, particularly in RF multipole systems, and to RF quadrupole mass filters and their operation with gas flows in tandem mass spectrometers. The invention provides a tandem mass spectrometer in which the RF quadrupole mass filter is operated at vacuum pressures in the medium vacuum pressure regime, utilizing a gas flow to drive the ions are through the mass filter. Vacuum pressures between 0.5 to 10 pascal are maintained in the mass filter. The mass filter may be enclosed by a narrow enclosure to guide the gas flow. The quadrupole mass filter may be followed by an RF multipole system, operated at the same vacuum pressure, serving as fragmentation cell to fragment the selected parent ions. The fragmentation cell may be enclosed by the same enclosure which already encloses the mass filter, so the ions may be driven by the same gas flow at the same vacuum pressure, greatly simplifying the required vacuum pumping system in tandem mass spectrometers. There are many other applications utilizing gas flows including supersonic gas jets in mass spectrometry.
US08941055B2
Ions with a predetermined ion mobility range are produced by filtering ions entrained in a stream of moving gas with two ion mobility low pass filters located consecutively in the gas stream. Each filter is formed by applying a DC electric field to the gas stream which causes the ions to move in a direction opposite to the gas flow. Ions are collected between the two filters and transferred to a detector or analyzing device. In one embodiment, the maximum field strength of the electric field barrier in the first ion mobility low pass filter is continued as a plateau of essentially constant field strength up to the electric field barrier in the second ion mobility low pass filter, which has a maximum field strength higher that the maximum field strength of the electric field barrier in the first ion mobility low pass filter.
US08941049B2
A readout apparatus and method for processing spatially distributed signals is disclosed. The readout apparatus and method may reduce/eliminate the impact gain variations among a plurality of sensing channels. This is done by continuously varying the dispersion properties of a signal distribution device, which may induce a spatial shift of the signal distribution during data acquisition, allowing the distributed signals to move across the sensor area. Shifting of the distributed signals may occur multiple times, hence eliminating the impact of gain variation across the sensor array. The accumulated data may be re-assembled subsequently to complete the readout operation.
US08941041B2
A cooking apparatus is provided. The cooking apparatus includes a cooking cavity, an upper space formed above the cooking cavity, lateral side spaces formed to at opposite lateral sides of the cooking cavity, a rear space formed behind the cooking cavity, and a lower space formed below the cooking cavity. A fan provided in the rear space generates a cooling flow that cools components housed in the rear space. A cooling flow path extends from the rear space and into the upper space and lateral side spaces. Flow from the upper space enters the door to cool the door and is exhausted through a lower portion of the door. Flow from the lateral side spaces, which includes an exhaust flow from the cooking cavity, is guided to the lower space and exhausted. In this manner, the cooking apparatus can be completely cooled and cooking odors and heat appropriately exhausted by the cooling fan positioned in the rear space.
US08941038B2
A support assembly is provided for supporting a household appliance such as a non-convection microwave oven in a free-standing vertical relation with another household appliance such that the non-convection microwave oven is supported above the other household appliance. The support assembly includes a base tray having a floor portion on which the non-convection microwave oven can be disposed, brackets for fixedly securing the base tray to the other household appliance, and a pair of bracket arms for securing a trim element to the base tray.
US08941037B2
A substrate processing apparatus that can accurately control the temperature of a focus ring without causing abnormal electric discharge and the back-flow of radio frequency electrical power during the application of radio frequency electrical power. A wafer is mounted on a mounting stage disposed in a housing chamber. An annular focus ring is mounted on the mounting stage in such a manner as to surround the peripheral portion of the mounted wafer. The pressure in the housing chamber is reduced, radio frequency electrical power is applied to the mounting stage, and the focus ring generates heat by itself.
US08941024B2
A gouging carbon rod using an aluminum or aluminum alloy material as its conducting material includes a carbon rod unit, which has an elongated hollow main body internally defining a central space portion and having a first and a second open end; an aluminum/aluminum alloy unit, which is formed by high-pressure injection molding a molten aluminum or aluminum alloy material in the central space portion of the main body via the second open end, such that the aluminum/aluminum alloy unit so formed includes a shielded section located in the central space portion and an exposed section projected from the main body via the second open end. In this manner, the energy, time and labor costs for binding the aluminum material to the carbon rod are lowered, compared to the conventional carbon rod produced by metal thermal spraying technique, and the problem of uneven thickness of metal coating is solved.
US08941021B2
The present disclosure provides a wiring device having a color change kit. The color change kit includes a removable skirt and switch cover. The skirt and switch cover, which are disposed on the wiring device and accessible by an end-user, are easily detachable from the wiring device. Thus, the skirt and the switch cover are replaced without replacing the entire wiring device. Further, the skirt and switch cover is replaced without removing the wiring device from a wall box or further disassembling the entire wiring device. In certain exemplary embodiments, the skirt is disposed within a housing of the wiring device, and the switch cover is disposed within the skirt.
US08941019B2
A slit opening 8 is formed on a lower principal surface 6a of a hard disk case 6, in the vicinity of the inner side of an angle part formed by a lower left lateral wall 6e and an opposing lower lateral wall 6c. A hard disk drive 7 is placed in the hard disk case 6. When the hard disk drive 7 is subjected to vibration caused by disturbance on the hard disk case 6, elastic deformation of an angle part 8a of the slit opening 8 occurs using an axis 8b as a center to reduce vibration of the hard disk drive 7. Thus, it is possible to reduce the thickness of the hard disk case 6. With such a configuration, a hard disk case that is for housing an electronic component and that can have a small thickness can be provided.
US08941015B2
An embedded capacitor substrate module includes a substrate, a metal substrate and a solid electrolytic capacitor material. The solid electrolytic capacitor material is formed on the metal substrate, so as to form a solid electrolytic capacitor with the substrate. The embedded capacitor substrate module further includes an electrode lead-out region formed by extending the substrate and the metal substrate. The metal substrate serves as a first electrode, and the substrate serves as a second electrode. An insulating material is formed between the substrate and the metal substrate. Therefore, the embedded capacitor substrate module is not only advantageous in having a large capacitance as the conventional solid capacitor, but also capable of being drilled or plated and electrically connected to other circuits after being embedded in a printed circuit board.
US08941009B2
An electrical junction box includes an accommodation cover in which electrical parts are accommodated, and a groove that is formed on an outer surface of the accommodation cover and linearly extends in an up-down direction of the accommodation cover. The accommodation cover includes a folded wall part at which a wall surface of the groove is folded downwards. The accommodation cover includes a box body in which the electrical parts are accommodated, and a lower cover that covers a lower portion of the box body. The groove includes a first groove part formed on the lower cover. The folded wall part is formed on the first groove part.
US08941008B2
A photoelectric-conversion-device dye comprising a ruthenium metal complex, which includes a molecule including elemental phosphorous and the molecule forms a coordinate bond at least at the phosphorous atom, and which also includes a terpyridine derivative that forms a coordinate bond and has at least one adsorbing group that exhibits adsorptivity toward a metal oxide. The adsorbing group is selected from the group consisting of a carboxylic acid group, an ester thereof, or a salt thereof; a phosphonic acid group, an ester thereof, or a salt thereof; a hydroxyl group; an alkoxy group; and a sulfonic acid group or salt thereof. The dye exhibits absorption over a wide range from the visible light region to the near-infrared region, and as a result, a photoelectric conversion film, an electrode, and a solar cell having improved photoelectric conversion efficiency are provided.
US08940997B2
Systems and methods for disposing and supporting a solar panel array are disclosed. In one embodiment, a system for supporting a solar panel array includes the use of support columns and cables suspended between the support columns, with the solar panels received by solar panel receivers that are adapted to couple to the cables. The solar panel array may then be used to provide power as well as shelter. Cooling, lighting, security, or other devices may be added to the solar panel array. Embodiments of the invention include differing ways to support the solar panels by receivers of differing construction. Special installations of the system can include systems mounted over structure, such as parking lots, roads and aqueducts.
US08940993B1
A variable tone configuration control (100, 100′) for string instruments includes a pair of pickup coils (110, 120) located on a string instrument for inducing voltages therein responsive to vibration of any of the strings thereof. The variable tone configuration control (100, 100′) further includes a pair of potentiometers (130, 140) mechanically coupled for concurrent mechanical travel of a respective displaceable contact (132, 142) thereof. The pair of potentiometers (130, 140) are operatively coupled to the pair of pickup coils (110, 120) and a pair of output terminals (102, 104) to vary the electrical configuration of the pair of pickup coils (110, 120) between the pair of pickup coils (110, 120) being connected in series and being connected in parallel as the displaceable contacts (132 and 142) are moved between opposing ends of their mechanical travel.
US08940985B2
A guitar neck joint routing system. The system includes a probe and router assembly comprising a gantry, a probe, and a plurality of routers, and a guitar neck and body nest comprising clamps and vacuum grips for holding a guitar neck and guitar body in place for taking measurements and routing a dovetail joint.
US08940982B2
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH439482. The invention thus relates to the plants, seeds and tissue cultures of the variety CH439482, and to methods for producing a corn plant produced by crossing a corn plant of variety CH439482 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH439482.
US08940980B2
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH406206. The invention thus relates to the plants, seeds and tissue cultures of the variety CH406206, and to methods for producing a corn plant produced by crossing a corn plant of variety CH406206 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH406206.
US08940975B2
The invention provides seed and plants of the tomato variety designated Picus. The invention thus relates to the plants, seeds and tissue cultures of tomato variety Picus and to methods for producing a tomato plant produced by crossing a plant of tomato variety Picus with itself or with another tomato plant, such as a plant of another variety. The invention further relates to seeds and plants produced by such crossing, and also relates to parts of a plant of tomato variety Picus including the fruit and gametes of such plants. The invention also relates to tomato variety FDS 14-2081, and to seeds and plants produced by crossing a plant of tomato variety FDS 14-2081 with itself or another tomato plant. The present invention is also directed to tomato variety FDS 14-2090, and to seeds and plants produced by crossing a plant of tomato variety FDS 14-2090 with itself or another tomato plant.
US08940970B2
A novel soybean variety, designated XB33U13 is provided. Also provided are the seeds of soybean variety XB33U13, cells from soybean variety XB33U13, plants of soybean XB33U13, and plant parts of soybean variety XB33U13. Methods provided include producing a soybean plant by crossing soybean variety XB33U13 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety XB33U13, methods for producing other soybean varieties or plant parts derived from soybean variety XB33U13, and methods of characterizing soybean variety XB33U13. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XB33U13 are further provided.
US08940966B2
A soybean cultivar designated XB36AW12 is disclosed. The invention relates to the seeds of soybean cultivar XB36AW12, to the plants of soybean cultivar XB36AW12, to the plant parts of soybean cultivar XB36AW12, and to methods for producing progeny of soybean cultivar XB36AW12. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar XB36AW12. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar XB36AW12, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar XB36AW12 with another soybean cultivar.
US08940963B2
Process of producing in a plant, in plant tissue, or in plant cells a hetero-oligomeric protein comprising at least a first and a second protein subunit, said process comprising expressing in plant cells at least said first and said second protein subunit by (i) providing to said plant, said plant tissue or said plant cells a plus-sense single-stranded RNA viral vector encoding at least said first and said second protein subunit or (ii) providing to said plant, said plant tissue or said plant cells a first and a second plus-sense single-stranded RNA viral vector, said first viral vector encoding at least said first protein subunit, said second viral vector encoding at least said second protein subunit, whereby at least said first viral vector and said second viral vector are non-competing viral vectors.
US08940957B2
A method of removing heterocyclic sulfide impurities from a fluid stream is presented. The method comprises contacting the fluid stream with a sorbent comprising metallic copper.
US08940954B2
A process is disclosed that includes brominating a C2, C3, C4, C5 or C6 alkane with elemental bromine to form a bromo-alkane. The bromo-alkane is reacted to form a C2, C3, C4, C5 or C6 alkene and HBr. The HBr is oxidized to form elemental bromine.
US08940952B2
A new family of coherently grown composites of TUN and IMF zeotypes have been synthesized. These zeolites are represented by the empirical formula. NanMmk+TtAl1-xExSiyOz where “n” is the mole ratio of Na to (Al+E), M represents a metal or metals from zinc, Group 1, Group 2, Group 3 and or the lanthanide series of the periodic table, “m” is the mole ratio of M to (Al+E), “k” is the average charge of the metal or metals M, T is the organic structure directing agent or agents, and E is a framework element such as gallium. These zeolites are similar to TNU-9 and IM-5 but are characterized by unique compositions and synthesis procedures and have catalytic properties for carrying out various hydrocarbon conversion processes and separation properties for carrying out various separations.
US08940948B2
Provided are methods for producing fluorinated organic compounds, which preferably comprises converting at least one compound of formula (I) CH2XCHZCF3 to at least one compound of formula (II) CHX═CZCF3 where X and Z are independently H or F, with the proviso that X and Z are not the same. The converting step comprises catalytically reacting at least one compound of formula (I), preferably via dehydrogenation or oxidative dehydrogenation. In another aspect, the inventive method of preparing fluorinated organic compounds comprises converting a reaction stream comprising at least one pentafluoropropene to a product stream comprising at least one pentafluoropropane and at least one compound of formula (I), separating out the compound of formula (I) from the product stream, and converting the compound of formula (I) separated from the product stream to at least one compound of formula (II), wherein the conversion the compound of formula (I) to 3,3,3-trifluoropropyne is substantially limited.
US08940933B2
The present invention provides a method for producing polyoxyalkylene alkyl ether carboxylic acid and a salt thereof, including supplying polyoxyalkylene alkyl ether, oxygen, and water to a continuous stirred tank reactor containing a noble metal catalyst to oxidize the polyoxyalkylene alkyl ether with oxygen, in which the molar ratio of the salt of polyoxyalkylene alkyl ether carboxylic acid to the polyoxyalkylene alkyl ether in the continuous stirred tank reactor is controlled to 0.33 to 49.
US08940932B2
A process for stably producing high purity acetic acid comprising a condensation step for condensing and temporarily holding the lower boiling component in a decanter and discharging from the decanter; and a step for separating the lower boiling component discharged from the decanter into acetaldehyde and a liquid residue and recycling the liquid residue to the reaction system. In the condensation step, the amount of the lower boiling component to be held is controlled based on the fluctuating flow rate of the lower boiling component to be fed to the decanter.
US08940931B2
The present invention provides a method, as a means for industrially producing a refined 6-bromo-2-naphthalenecarboxylic acid product from a crude 6-bromo-2-naphthalenecarboxylic acid product, comprising: causing the above crude product to react with sodium hydroxide in water to precipitate a sodium salt of 6-bromo-2-naphthalenecarboxylic acid; performing recrystallization treatment for the obtained precipitate; causing the obtained crystal to react with acid in water to precipitate 6-bromo-2-naphthalenecarboxylic acid; and recovering the obtained precipitate.
US08940919B2
A compound represented by the following general formula (1), and a method for producing the compound represented by the general formula (1), the method comprising: reacting together a compound represented by the following general formula (2), a compound represented by the following general formula (3), and a compound represented by the following general formula (4): wherein R1 represents any of a protective group of a carboxyl group, and a hydrogen atom, R2 and R3 each independently represent any of a protective group of an amino group, and a hydrogen atom, and R4 represents any of a protective group of a carboxyl group, and a hydrogen atom.
US08940918B2
There are provided compounds and methods for the detection of amyloids and treatment of diseases related to amyloids including Alzheimer's disease and other related amyloid-based neurodegenerative diseases.
US08940914B2
Disclosed are compositions and methods for the production of mono-esters and di-esters from the reaction of HMF and a reactant selected from a diacid or a diacid derivative; typical reactants are PAN, phthaloyl dichloride, dimethyl phthalate, maleic acid, and maleic anhydride or mono-esters that can be prepared from HMF and MAN.
US08940912B2
The present invention features a process for the preparation of 4-oxo-3-[(phenylmethyl)oxy]-4-H-pyran-2-carboxylic acid, an intermediate useful in the synthesis of HIV integrase inhibitors. The process involves (a) treating a compound of formula P-2 with lithium bis(trimethylsilyl)amide and benzaldehyde to form a compound of formula P-3, (b) treating the compound of formula P-3 with triethylamine and methanesulfonyl chloride followed by N-methyl-2-pyrrolidone and 1,8-diazabicyclo[5.4.0]undec-7-ene to form a compound of formula P-4, and (c) treating the compound of formula P-4 with RuCl3 and NaIO4 to form the compound of formula P-5.
US08940911B2
A library of unnatural squarylated homoserine lactones (SHLs) and squarylated lactones that bear potential to modulate biofilm formation in Gram negative bacteria. At low concentrations (˜200 μM), these small molecules inhibit biofilm formation of E. coli. Moreover, these compounds are not toxic up to 300 μM and do not significantly attenuate E. coli growth. The SHLs have potential to disperse established biofilm and demonstrate an enhanced reduction (˜50%) of the maximum biofilm thickness by use of SHLs during biofilm growth.
US08940896B2
In accordance with the present invention, tetracyclic caboline derivatives that inhibit the expression of VEGF post-transcriptionally have been identified, and methods for their use provided. In one aspect of the invention, these compounds useful in the inhibition of VEGF production, in the inhibition of angiogenesis, and/or in the treatment of cancer, diabetic retinopathy or exudative macular degeneration are provided. In another aspect of the invention, methods are provided for the inhibition of VEGF production, the inhibition of angiogenesis, and/or the treatment of cancer, diabetic retinopathy or exudative macular degeneration using the compounds of the invention.
US08940886B2
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
US08940881B2
The present invention provides a method for producing chitin nanofibers, which includes the steps of deproteinizing a material derived from a chitin-containing organism by an alkali treatment, deashing a deproteinized integument by an acid treatment, optionally treating the deashed integument under acidic conditions, and then subjecting to a fiber-loosening treatment. The present invention also provides chitin nanofibers obtained by the method, and a composite material and a coating composition each containing the same. The present invention provides a method for producing chitosan nanofibers, which includes, in addition to the above steps, a deacetylation step and chitosan nanofibers obtained by the method, and a composite material and a coating composition each containing the same.
US08940880B2
The present invention concerns a process for the preparation of the compound of formula The compound of formula (1) is the key intermediate in the synthesis of some antibacterial agents of the triamilide class, such as Tulathromycin, useful to treat bacterial and protozoa infections.
US08940876B2
The present disclosure relates to a method for preparing recombinant glycoproteins with high sialic acid content. More specifically, for UDP-GlcNAc 2-epimerase/ManNAc kinase (GNE/MNK) enzyme where point mutation was induced by substituting arginine at position 263 by leucine only or by further substituting arginine at position 266 by glutamine, epimerase activity is constantly maintained, and overexpressed cells thereof experience an increase in intracellular cytidine monophosphate (CMP)-sialic acid content, irrespective of CMP-sialic acid concentration. Particularly, since in an glycoprotein (such as, erythropoietin and thrombopoietin)-producing host cell where point mutationinduced GNE/MNK, human alpha-2,3-sialyltransferase and a CMP-sialic acid transporter gene are simultaneously overexpressed, intracellular content of CMP-sialic acid and sialic acid in glycoprotein increases in cells, overexpression in a host cell producing a sialylated recombinant glycoprotein the three genes above may be useful for preparing glycoprotein with increased sialic acid content.
US08940873B2
The invention relates to batch crystallization methods for crystallizing an anti-hIL-12 antibody that allows the production of the antibody on an industrial scale, antibody crystals obtained according to the methods, compositions containing the crystals, and methods of using the crystals and the compositions.
US08940872B2
The present invention provides an antibody that specifically binds to an abnormal TDP-43 protein aggregate, an agent comprising the antibody for detecting a TDP-43 proteinopathy lesion, and a method for detecting or diagnosing a TDP-43 proteinopathy lesion by using the antibody.
US08940868B2
The invention is based on the discovery of a potent growth factor delivery system by creating a fusion polypeptide that includes two portions: (i) keratinocyte growth factor protein, and (ii) an elastin-like peptide. This chimera can be administered directly to a wound site, accelerating recovery.
US08940866B2
Provided herein are compositions useful in detecting degradative enzymes and biomolecules in bodily fluid samples.
US08940864B2
Provided are constrained peptides that inhibit HIV assembly. Pharmaceutical compositions comprising the above peptides are also provided. Additionally provided are methods of inhibiting replication of a capsid-containing virus in a cell. Also provided are methods of treating a mammal infected with a capsid-containing virus. Further provided are methods of treating a mammal at risk for infection with a capsid-containing virus. Methods of making the above peptides are additionally provided, as are uses of the above peptides and pharmaceutical compositions.
US08940863B2
It is an object of the present invention to provide a substance usable as an anticancer agent or DDS, which has intracellular stability, which is capable of evading side effects from functional disorder with respect to normal cells, or which has instantaneous effect. The inventors developed a novel chimeric peptide targeting cancer cells which overexpress EGFR or the like using a binding peptide such as a peptide sequence binding to EGFR, and a lytic peptide sequence, thereby solving such an object. Particularly, by using a chimeric peptide including an EGF receptor-binding peptide or the like and a cytotoxic peptide, this object was solved.
US08940854B2
A curable formaldehyde-free binding composition for use with fiberglass is provided. Such curable composition comprises an aldehyde or ketone and an amine salt of an inorganic acid. The composition when applied to fiberglass is cured to form a water-insoluble binder which exhibits good adhesion to glass. In a preferred embodiment the composition when applied to fiberglass provides a sufficient blackness required in facer products.
US08940852B2
The present invention is a method for manufacturing a reactive polysiloxane solution, the method comprising: a condensation process for hydrolyzing and copolycondensing a starting compound containing an organosilicon compound having a reactive functional group selected from a (meth)acryloyl group and an oxetanyl group, and also having a siloxane bond-forming group to synthetize a reactive polysiloxane represented by general formula (1); a dissolution process for dissolving the obtained reactive polysiloxane in an organic solvent for water washing; and a washing process for bringing the obtained organic solution and water in contact with each other to remove the water layer from the mixed liquid. The organic solvent for water washing that is used is a compound (e.g., propylene glycol mono butyl ether, 1-pentanol) including a hydroxyl group, having a boiling point at 1 atm of 110° C.-200° C., and a solubility of 10 g or less in 100 g of water at 20° C.
US08940850B2
An energy storage device comprises a capacitor having a dielectric between opposite electrodes and a nonconductive coating between at least one electrode and the dielectric. The nonconductive coating allows for much higher voltages to be employed than in traditional EDLCs, which significantly increases energy stored in the capacitor. Viscosity of the dielectric material may be increased or decreased in a controlled manner, such as in response to an applied external stimulus, to control discharge and storage for extended periods of time.
US08940845B2
The invention provides a novel method for producing a water-absorbent resin comprising: subjecting at least one water-soluble ethylenic unsaturated monomer to reversed-phase suspension polymerization in a petroleum hydrocarbon dispersion medium, the reversed-phase suspension polymerization being conducted using a 0.00005 to 0.00016 mole of water-soluble azo initiator for radical polymerization per mole of the water-soluble ethylenic unsaturated monomer in the presence of 0.000015 to 0.00015 mole of hypophosphorous compound per mole of the water-soluble ethylenic unsaturated monomer. According to the method, the environmental impact can be lessened by reducing the amount of petroleum hydrocarbon dispersion medium released to the outside of the system, and the method makes it possible to obtain a water-absorbent resin having a high water-retention capacity and water-absorption capacity under a load, and a small content of water soluble component at the same time.
US08940843B2
The present invention relates the use of a pump in a loop reactor for the production of polyethylene, as well as a reactor comprising such pump and methods for producing polyolefin by means of such reactor. The pump according to the invention is characterized in that it is an axial flow impeller circulation pump, wherein the impeller comprises 6 blades and wherein the pump is fixed on a spring supported frame. Use of the pump according to the present invention allows for preparation of homogeneous polyethylene products that meet high quality standards from the complicated ethylene polymerization mixtures while at the same time being produced with low energy consumption.
US08940835B2
Provided is a thermoplastic elastomer composition that can be suitably used for the inner liners of pneumatic tires and exhibits high air barrier properties and high fatigue durability. The present invention is a thermoplastic elastomer composition comprising a thermoplastic resin composition and a rubber composition dispersed in the thermoplastic resin composition, wherein the thermoplastic resin composition comprises a polyamide and an ethylene-vinyl alcohol copolymer or a poly(vinyl alcohol), the rubber composition comprises a halogenated isoolefin-p-alkylstyrene copolymer and is cross inked. The thermoplastic resin composition preferably comprises 1 to 25% by weight of the ethylene-vinyl alcohol copolymer or the poly(vinyl alcohol). The thermoplastic elastomer composition preferably comprises 100 parts by weight of the thermoplastic resin composition and 80 to 200 parts by weight of the halogenated isoolefin-p-alkylstyrene copolymer.
US08940826B2
Described are polymer compositions that include lattices (e.g., polymer emulsions or suspensions in an aqueous phase) and that contain a gloss reducing agent and that are useful in various finish compositions such as in floor care compositions.
US08940821B2
An inkjet ink composition comprising water, and at least one water-dispersible polyurethane/urea polymer having at least a first soft segment formed from a polyol prepolymer and at least a second soft segment formed from a polyamine prepolymer, wherein the polyol prepolymer forms urethane bonds in the polyurethane/urea and the polyamine prepolymer forms urea bonds in the polyurethane/urea, and further wherein at least about 4% by weight of the combined soft segments is formed by polyamine prepolymers that form urea bonds in the polyurethane/urea polymer.
US08940817B2
A method for preparing an oxalate of one or more actinides for processing and recycling nuclear fuel, comprising: the precipitation of said actinide or the coprecipitation of said actinides in the form of oxalate particles by bringing into contact an aqueous solution containing the actinide(s) with an aqueous solution of oxalic acid or of an oxalic acid salt; and the collection of the resulting oxalate particles; characterized in that the precipitation or coprecipitation is carried out in fluidized bed.
US08940811B2
A free radical curable liquid for inkjet printing of food packaging materials includes no initiator or otherwise one or more initiators selected from the group consisting of non-polymeric di- or multifunctional initiators, oligomeric initiators, polymeric initiators, and polymerizable initiators; wherein the polymerizable composition of the liquid consists of: a) 25-100 wt % of one or more polymerizable compounds A having at least one acrylate group G1 and at least one second ethylenically unsaturated polymerizable functional group G2 different from the group G1; b) 0-55 wt % of one or more polymerizable compounds B selected from the group consisting of monofunctional acrylates and difunctional acrylates; and c) 0-55 wt % of one or more polymerizable compounds C selected from the group consisting of trifunctional acrylates, tetrafunctional acrylates, pentafunctional acrylates and hexafunctional acrylates.
US08940809B2
The present invention provides a process for producing electret fine particles or coarse powder that can be uniformly electrified and exhibits excellent electrophoretic properties.Specifically, the present invention relates to the production processes (1) and (2) below:(1) A process for producing electret fine particles, comprising emulsifying a fluorine-containing material that contains a vinylidene fluoride-hexafluoropropylene-tetrafluoroethylene terpolymer in a liquid that is incompatible with the fluorine-containing material to obtain emulsified particles; and subjecting the emulsified particles to electron ray irradiation, radial ray irradiation, or corona discharge treatment.(2) A process for producing electret coarse powder, comprising subjecting a resin sheet containing a vinylidene fluoride-hexafluoropropylene-tetrafluoroethylene terpolymer to electron ray irradiation, radial ray irradiation, or corona discharge treatment to process the resin sheet into an electret resin sheet; and pulverizing the electret resin sheet.
US08940808B2
Disclosed is a curable coating agent composition which exhibits excellent wear resistance and weather resistance when applied as a coating agent to plastic or other substrates to be used outdoors. The curable coating agent composition comprises 95 to 65 parts by mass of a component (A) comprising an urethane adduct compound having weather resistance, 5 to 35 parts by mass of a component (B) comprising a specific organosilicon compound, 0.1 to 10 parts by mass of a component (C) which is a radical polymerization initiator, 1 to 12 parts by mass of a component (D) which is an ultraviolet ray absorber, and 10 to 1,000 parts by mass of a component (E) which is an organic solvent, with respect to 100 parts by mass of the components (A) and (B) in total.
US08940800B2
Disclosed are polymers of hydroxypropyl methyl cellulose acetate succinate (HPMCAS) and hydroxypropyl methyl cellulose acetate (HPMCA) with unique degrees of substitution of hydroxypropoxy, methoxy, acetyl, and succinoyl groups. When used in making compositions comprising a low-solubility drug and such polymers, the polymers provide enhanced aqueous concentrations and/or improved physical stability.
US08940789B2
A method for producing 4′-demethylnobiletin or 4′-demethyltangeretin including fermenting a skin derived from at least one citrus fruit selected from citrus fruits belonging to section Acrumen in subgenus Metacitrus in genus Citrus or citrus fruits belonging to section Aurantium in subgenus Archicitrus in genus Citrus, or a water extract product thereof using one or more Aspergillus molds selected from Aspergillus kawachii, Aspergillus awamori, Aspergillus oryzae, Aspergillus sojae, Aspergillus saitoi, and Aspergillus usamii to obtain a fermented product.
US08940786B2
Non-aqueous, ethanol-free taxane nanodispersion formulations are provided. Nanodispersion formulations of embodiments of the invention include a taxane, an oil, a non-ionic surfactant, a non-aqueous solvent, and an organic acid component, wherein the organic acid component is soluble in the non-aqueous solvent and the amount by weight of non-ionic surfactant is equal to or greater than the amount by weight of non-aqueous solvent. Also provided are methods of using the nanodispersion formulations, as well as kits that include the nanodispersion formulations. Non-aqueous, ethanol-free docetaxel nanodispersion formulations are provided. Nanodispersion formulations of embodiments of the invention include docetaxel, an oil, a non-ionic surfactant, a non-aqueous solvent, and an organic acid which is soluble in the non-aqueous solvent and is substantially free of any conjugate base. Also provided are methods of using the nanodispersion formulations, as well as kits that include the nanodispersion formulations.
US08940783B2
The present invention relates to a pheophorbide-α conjugate or its salt, solvate or hydrate. The pheophorbide-α conjugate of the present invention exhibiting fluorescence upon its introduction into cells and degradation inhibits the survival of various cancer cells. Especially, the conjugate of pheophorbide-α (1) and doxorubicin shows higher fluorescence intensity at lower pH (cancer environment). Therefore, the present composition for photodynamic therapy (PDT) of cancers is also very useful in detecting cancers. Interestingly, the anticancer effects of the present composition are dually exerted with help of both the photosensitizer and the anticancer drug of the present conjugates.
US08940779B2
Synergistic microbicidal compositions containing N-methyl-1,2-benzisothiazolin-3-one.
US08940774B2
Tris-Quaternary Ammonium Salts and Methods for Modulating Neuronal Nicotinic Acetylcholine Receptors
Provided are tris-quaternary ammonium compounds which are modulators of nicotinic acetylcholine receptors. Also provided are methods of using the compounds for modulating the function of a nicotinic acetylcholine receptor, and for the prevention and/or treatment of central nervous system disorders, substance use and/or abuse and/or gastrointestinal tract disorders.
US08940767B2
Grease-like compositions are provided for repelling rodents. The compositions utilize nontoxic mineral, synthetic, or vegetable oil based gels containing silica, clay, urea, polytetrafluoroethylene, or metallic soap thickeners and capsaicin.
US08940761B2
The present invention relates to novel [1,2,4]triazolopyridine compounds with phosphodiesterase inhibitory activity, as well as to their use as therapeutic agents in the treatment of inflammatory diseases and conditions.
US08940752B2
The present invention provides pyrimidinones that modulate the activity of phosphoinositide 3-kinases (PI3Ks) and are useful in the treatment of diseases related to the activity of PI3Ks including, for example, inflammatory disorders, immune-based disorders, cancer, and other diseases.
US08940743B2
The present invention relates to compounds that are fast dissociating dopamine 2 receptor antagonists, processes for preparing these compounds, pharmaceutical compositions comprising these compounds as an active ingredient. The compounds find utility as medicines for treating or preventing central nervous system disorders, for example schizophrenia, by exerting an antipsychotic effect without motor side effects.
US08940739B2
This invention relates to novel compounds of reverse-turn mimetics, having pyrazino-triazinone as a basic framework, and a method of preparing the same, and the use thereof to treat diseases such as cancer, in particular, acute myeloid leukemia.
US08940737B2
Disclosed are compounds which inhibit the activity of anti-apoptotic Bcl-xL proteins, compositions containing the compounds and methods of treating diseases during which is expressed anti-apoptotic Bcl-xL protein.
US08940734B2
The present invention relates to a fused aminodihydrothiazine derivative of formula (I): wherein X is hydrogen or fluorine; A is CH or N; Y is methyl, ethyl, monofluoromethyl, difluoromethyl, trifluoromethyl, difluoroethyl, methoxy, ethoxy, methoxymethyl or —C≡N; and pharmaceutically acceptable salts thereof; which compound has an Aβ production inhibitory effect or a BACE1 inhibitory effect and is useful as a prophylactic or therapeutic agent for a neurodegenerative disease caused by Aβ and typified by Alzheimer-type dementia.
US08940722B2
The invention provides modulators for the orphan nuclear receptor RORγ and methods for treating RORγ mediated diseases by administrating these novel RORγ modulators to a human or a mammal in need thereof. Specifically, the present invention provides compounds of Formula (1) and the enantiomers, diastereomers, tautomers, solvates and pharmaceutically acceptable salts thereof.
US08940721B2
Compositions and methods for treating macular degeneration and other forms of retinal disease whose etiology involves the accumulation of A2E and/or lipofuscin, and, more specifically, for preventing the formation and/or accumulation of A2E are disclosed.
US08940718B2
The disclosure is related to anti-viral compounds, compositions containing such compounds, and therapeutic methods that include the administration of such compounds, as well as to processes and intermediates useful for preparing such compounds.
US08940715B2
The object of the present invention is to provide a lipid-regulating agent or a composition for regulating the amount of lipids comprising the agent. The present invention solves the above object by providing a lipid-regulating agent comprising a cyclic tetrasaccharide and/or its saccharide-derivative(s) and a composition for regulating the amount of lipids comprising the lipid-regulating agent.
US08940712B2
The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease.
US08940691B2
A supramolecular insulin assembly and supramolecular exendin-4 assembly, which is useful as a protein therapeutic agent for the treatment of metabolic disorders particularly diabetes. The supramolecular assemblies disclosed in the present invention consists of insoluble and aggregated oligomers the protein. The invention also provides pharmaceutical compositions comprising the supramolecular assembly.
US08940688B2
The present invention relates to compounds of Formula I, or a pharmaceutically acceptable salt, ester, or prodrug, thereof: which inhibit serine protease activity, particularly the activity of hepatitis c virus (HCV) NS3-NS4A protease. Consequently, the compounds of the present invention interfere with the life cycle of the hepatitis c virus and are also useful as antiviral agents. The present invention further relates to pharmaceutical compositions comprising the aforementioned compounds for administration to a subject suffering from HCV infection. The invention also relates to methods of treating an HCV infection in a subject by administering a pharmaceutical composition comprising the compounds of the present invention.
US08940680B2
Composition in the form of a gel containing at least 35% by weight of water, at least one foaming surfactant chosen from nonionic or amphoteric surfactants, and at least one superabsorbent polymer. The superabsorbent polymer helps to thicken the composition without affecting its cosmetic properties.
US08940674B2
This invention relates to a “high lower alcohol content”(>40% v/v of a C1-4 alcohol) liquid composition able to be either dispensed as a stable foam with the use of non-propellant foam dispensing devices from non-pressurized containers or as an alcohol gel composition which does not use thickener and gelling agents that leave undesirable deposits or a sticky after-feel and that has a final viscosity less than 4,000 cps. The liquid compositions comprise an alcohol, C1-4 (>40% v/v), a fluorosurfactant of at least 0.001% by weight to prepare a foamable composition or from 0-2.0% to prepare a gel-like composition of a final viscosity less than 4,000 cps, 0-10% w/w of additional minor components added to obtain the desired performance (a foamable composition or a gel-like composition with a viscosity less than 4,000 cps), and the balance being purified water.
US08940654B2
A catalyst component for the polymerization of olefins obtained by: (a) reacting in a inert hydrocarbon suspension medium a Mg(OR1)(OR2) compound, in which R1 and R2 are identical or different and are each an alkyl radical having 1 to 10 carbon atoms, with a tetravalent transition metal compound having at least a Metal-halogen bond, used in amounts such that the molar ratio metal/Mg is from 0.05 to 10, thereby obtaining a solid reaction product dispersed in a hydrocarbon slurry, (b) washing the solid reaction product dispersed in a hydrocarbon slurry with a liquid hydrocarbon, (c) contacting the washed solid reaction product obtained in (b) with a tetravalent titanium compound and (d) contacting the product obtained in (c) with an organometallic compound of a metal of group 1, 2 or 13 of the Periodic Table.
US08940635B1
A method for forming a semiconductor structure includes providing a semiconductor substrate and forming a dielectric layer over the semiconductor substrate. An opening is formed in the dielectric layer. A conductive line is formed in the opening, wherein the conductive line has an open void formed therein. A sealing metal layer is formed overlying the conductive line, the dielectric layer, and the open void, wherein the sealing metal layer substantially fills the open void. The sealing metal layer is planarized so that a top surface thereof is substantially level with a top surface of the conductive line. An interconnect feature is formed above the semiconductor substrate, wherein the interconnect feature is electrically coupled with the conductive line and the sealing metal layer-filled open void.
US08940627B2
Vias (holes) are formed in a wafer or a dielectric layer. A low viscosity conductive ink, containing microscopic metal particles, is deposited over the top surface of the wafer to cover the vias. An external force is applied to urge the ink into the vias, including an electrical force, a magnetic force, a centrifugal force, a vacuum, or a suction force for outgassing the air in the vias. Any remaining ink on the surface is removed by a squeegee, spinning, an air knife, or removal of an underlying photoresist layer. The ink in the vias is heated to evaporate the liquid and sinter the remaining metal particles to form a conductive path in the vias. The resulting wafer may be bonded to one or more other wafers and singulated to form a 3-D module.
US08940626B2
A method for fabricating an integrated circuit includes forming a first layer of a workfunction material in a first trench of a plurality of trench structures formed over a silicon substrate, the first trench having a first length and forming a second layer of a workfunction material in a second trench, the second trench having a second length that is longer than the first length. The method further includes depositing a low-resistance fill material onto the integrated circuit to fill any unfilled trenches with the low-resistance fill material and etching the low resistance fill material, the first layer, and the second layer to re-expose a portion of each trench of the plurality of trenches, while leaving a portion of each of the first layer, the second layer, and the low-resistance fill material in place. Still further, the method includes depositing a gate fill material into each re-exposed trench portion.
US08940620B2
A composite wafer includes a first substrate having a first vertical thickness and a top surface, the top surface being prepared in a state for subsequent semiconductor material epitaxial deposition. A carrier substrate is disposed beneath the first substrate. The carrier substrate has a second vertical thickness greater than the first vertical thickness. An interlayer bonds the first substrate to the carrier substrate.
US08940617B2
A structure and method is provided for fabricating isolated capacitors. The method includes simultaneously forming a plurality of deep trenches and one or more isolation trenches surrounding a group or array of the plurality of deep trenches through a SOI and doped poly layer, to an underlying insulator layer. The method further includes lining the plurality of deep trenches and one or more isolation trenches with an insulator material. The method further includes filling the plurality of deep trenches and one or more isolation trenches with a conductive material on the insulator material. The deep trenches form deep trench capacitors and the one or more isolation trenches form one or more isolation plates that isolate at least one group or array of the deep trench capacitors from another group or array of the deep trench capacitors.
US08940608B2
Methods for fabricating integrated circuits are provided. In an embodiment, a method for fabricating an integrated circuit includes providing a semiconductor substrate including a first region of a first doping type, a second region of the first doping type spaced from the first region, a drift region of the first doping type positioned between the first region and the second region, and regions of the opposite doping type. A mask covering both the drift region and the regions of the opposite doping type is formed. Then, a source/drain ion implantation is performed into the first region and the second region. The mask prevents the drift region and the regions of the opposite doping type from receiving the source/drain ion implantation.
US08940606B2
The present invention provides a trench type power transistor device including a substrate, an epitaxial layer, a doped diffusion region, a doped source region, and a gate structure. The substrate, the doped diffusion region, and the doped source region have a first conductivity type, and the substrate has an active region and a termination region. The epitaxial layer is disposed on the substrate, and has a second conductivity type. The epitaxial layer has a through hole disposed in the active region. The doped diffusion region is disposed in the epitaxial layer at a side of the through hole, and is in contact with the substrate. The doped source region is disposed in the epitaxial layer disposed right on the doped diffusion region, and the gate structure is disposed in the through hole between the doped diffusion region and the doped source region.
US08940598B2
A method for adding a low TCR resistor to a baseline CMOS manufacturing flow. A method of forming a low TCR resistor in a CMOS manufacturing flow. A method of forming an n-type and a p-type transistor with a low TCR resistor in a CMOS manufacturing flow.
US08940595B2
A faceted intrinsic buffer semiconductor material is deposited on sidewalls of a source trench and a drain trench by selective epitaxy. A facet adjoins each edge at which an outer sidewall of a gate spacer adjoins a sidewall of the source trench or the drain trench. A doped semiconductor material is subsequently deposited to fill the source trench and the drain trench. The doped semiconductor material can be deposited such that the facets of the intrinsic buffer semiconductor material are extended and inner sidewalls of the deposited doped semiconductor material merges in each of the source trench and the drain trench. The doped semiconductor material can subsequently grow upward. Faceted intrinsic buffer semiconductor material portions allow greater outdiffusion of dopants near faceted corners while suppressing diffusion of dopants in regions of uniform width, thereby suppressing short channel effects.
US08940591B2
A method for fabricating a semiconductor device includes forming a gate stack on an active region of a silicon-on-insulator substrate. The active region is within a semiconductor layer and is doped with an p-type dopant. A gate spacer is formed surrounding the gate stack. A first trench is formed in a region reserved for a source region and a second trench is formed in a region reserved for a drain region. The first and second trenches are formed while maintaining exposed the region reserved for the source region and the region reserved for the drain region. Silicon germanium is epitaxially grown within the first trench and the second trench while maintaining exposed the regions reserved for the source and drain regions, respectively.
US08940585B2
The present disclosure provides semiconductor packaging techniques that form a substrate using metal and insulating materials. The substrate includes a first surface that is bonded to a semiconductor device and a second surface that is bonded to a printed circuit board. The substrate is formed using several techniques that minimize the amount of mask levels used to form the substrate. For example, a metal substrate is patterned to form a three dimensional pattern on the surface. A dielectric material is deposited on the three dimensional pattern. Using several patterning and polishing embodiments described herein, the metal/dielectric substrate is patterned and polished to form a substantially flush surface that is bonded to the semiconductor device. In one embodiment, the top surface of the metal/dielectric substrate is patterned to expose the underlying metal substrate and the bottom surface of the metal substrate is polished to be substantially flush with the dielectric material.
US08940577B2
A programmable metallization cell (PMC) that includes an active electrode; a nanoporous layer disposed on the active electrode, the nanoporous layer comprising a plurality of nanopores and a dielectric material; and an inert electrode disposed on the nanoporous layer. Other embodiments include forming the active electrode from silver iodide, copper iodide, silver sulfide, copper sulfide, silver selenide, or copper selenide and applying a positive bias to the active electrode that causes silver or copper to migrate into the nanopores. Methods of formation are also disclosed.
US08940575B2
There is provided a method of producing a semiconductor device. The method includes the steps of: forming a first hard mask having an opening above a substrate; forming a sacrificial film above a side surface of the opening of the first hard mask; forming a second hard mask in the opening having the sacrificial film above the side surface; removing the sacrificial film after the second hard mask is formed; ion implanting a first conductivity-type impurity through the first hard mask; and ion implanting a second conductivity-type impurity through the first and second hard masks.
US08940571B2
P-type semiconductor sheets and n-type semiconductor sheets formed by mixing a powder of semiconductor material, a binder resin, a plasticizer, and a surfactant are prepared. In addition, separator sheets formed by mixing a resin such as PMMA and a plasticizer are prepared. Through holes are formed in each of the separator sheets and then filled with a conductive material. Thereafter, the p-type semiconductor sheet, the separator sheet, the n-type semiconductor sheet and the separator sheet are stacked. The resultant laminated body is cut into a predetermined size and then subjected to a baking process.
US08940569B2
A dual gate extremely thin semiconductor-on-insulator transistor with asymmetric gate dielectrics is provided. This structure can improve the sensor detection limit and also relieve the drift effects. Detection is performed at a constant current mode while the species will be detected at a gate electrode with a thin equivalent oxide thickness (EOT) and the gate bias will be applied to the second gate electrode with thicker EOT to maintain current flow through the transistor. As a result, a small change in the charge on the first electrode with the thin EOT will be translated into a larger voltage on the gate electrode with the thick EOT to sustain the current flow through the transistor. This allows a reduction of the sensor dimension and therefore an increase in the array size. The dual gate structure further includes cavities, i.e., microwell arrays, for chemical sensing.
US08940568B2
Methods of fabricating a device having laterally patterned first and second sub-devices, such as subpixels of an OLED, are provided. Exemplary methods may include depositing via organic vapor jet printing (OVJP) a first organic layer of the first sub-device and a first organic layer of the second sub-device. The first organic layer of the first sub-device and the first organic layer of the second sub-device are both the same type of layer, but have different thicknesses. The type of layer is selected from an ETL, an HTL, an HIL, a spacer and a capping layer.
US08940565B1
A method of manufacturing a thin film transistor array substrate includes providing a plurality of gate lines and a plurality of data lines on a first substrate, providing an organic layer on the gate lines and the data lines, providing a first electrode on the organic layer, providing a passivation layer on the first electrode, providing a second electrode on the passivation layer, providing a first cover layer on the second electrode to cover the second electrode, providing a plurality of photosensitive layer patterns on the first cover layer, providing a plurality of first cutout patterns in the first cover layer and a plurality of second cutout patterns in the second electrode using the photosensitive layer patterns as an etch mask, and providing a plurality of third cutout patterns in the passivation layer using the first cover layer as an etch mask.
US08940563B2
A method for manufacturing an optoelectronic module is proposed. The method comprises the following steps: providing a top cover with a reflective surface. Then, a light-guiding structure is formed. A mounting device is provided. Next, an optoelectronic device is formed on the mounting device with a first precision. A control chip is formed on the mounting device with a second precision different from the first precision. The top cover combines with the mounting device, wherein the light-guiding structure is between the top cover and the mounting device, and the optoelectronic device faces the reflective surface.
US08940559B2
In an embodiment, a method of fabricating an integrated orifice plate and cap structure includes forming an orifice bore on the front side of a product wafer, coating side walls of the orifice bore with a protective material, grinding the product wafer from its back side to a final thickness, forming a first hardmask for subsequent cavity formation, forming a second hardmask over the first hardmask for subsequent descender formation, forming a softmask over the second hardmask for subsequent convergent bore formation, etching a latent convergent bore using the softmask as an etch delineation feature, etching a descender using the second hardmask as an etch delineation feature, and anisotropic etching of convergent bore walls and cavities using the first hardmask as an etch delineation feature.
US08940556B2
A apparatus and method for manufacturing a photovoltaic module includes components for heating the module and applying an electrical bias to the module to improve photovoltaic module performance and manufacture multiple photovoltaic modules with similar performance.
US08940542B2
A sensor for detecting and/or quantifying the amount of analyte in a sample, the sensor including: a sensing region; and a barrier layer including a reactive oxygen species (ROS)-quenching, analyte-permeable membrane having an ROS-quenching agent adsorbed to the membrane; wherein the sensor is adapted so that the sample enters the sensing region of the sensor through the barrier layer.
US08940541B2
The present invention discloses a sample sorter system adapted to receive and sort samples according to predetermined criteria. The sample sorter system comprises a receptacle that is adapted to receive and retain fluid and samples. The receptacle is operatively coupled with a drive and with a power source such that actuation of the drive causes the rotation of at least one circular component, which in turn causes the development of a flow regime in the receptacle such that the samples suspended in the fluid are conveyable along a closed path to at least one sample handling site that are positioned along said closed path.
US08940540B2
A portable, hand-held glucose testing device includes a housing configured to accommodate a plurality of test sensors in a stacked arrangement and having a wall with an opening defined therein. A plurality of packaged test sensors is stacked in alignment with one another within the housing. Each of the test sensors is packaged within a blister package. The blister package includes a blister package housing and a cover foil overlying a surface of the blister package housing and the test sensor. A drive slide is configured to displace one of the plurality of packaged test sensors out of alignment with other packaged test sensors. A knife mechanism is configured to pierce through the cover foil, and to engage and urge the test sensor to extend through the opening for receiving a sample. A meter contact is configured to engage the test sensor when the test sensor extends through the opening.
US08940534B2
The present invention relates to immortalized avian cell lines suitable for production of biologicals or viruses for vaccination. In particular, the cell lines are derived from primary cells which are transformed with at least two viral or cellular genes, one of which causes cell cycle progression whereas the other interferes with innate protective mechanisms of the cell induced by dysregulated replication. The invention moreover relates to the production of said immortalized cell lines and their use for producing biologicals or viruses for vaccination.
US08940531B2
A system for culturing and recovering micro algae comprises a photo-bioreactor, a floatation separator, a centrifugal separator, and a micro bubble generator. The photo-bioreactor unit is configured to culture micro algae by a photochemical reaction to produce a micro algae precipitate. The precipitated micro algae is separated by the floatation separator. The separated micro algae is concentrated by the centrifugal separator. The micro bubble generator generates process water containing micro carbon dioxide bubbles and supplies the generated process water to the photo-bioreactor unit and the floatation separator. With this system, micro algae can be cultured and recovered in a simpler and more cost-effective manner.
US08940517B2
The disclosure relates to the development of improved methods for quantifying antigen in a vaccine composition in the absence of available antigen standards. More specifically, the disclosure provides fast and robust methods of separating antigens from vaccine compositions, comprising the steps of solubilizing antigen without detergent and without alkylation, using acidification to prevent antigen subtypes from binding again, isolating antigen subtypes with chromatography, and quantifying the eluted antigen with amino acid analysis. The methods of the disclosure are applicable for use with a variety of antigens, thereby providing an improved method in the art of vaccine manufacturing to date.
US08940514B2
A thioesterase comprising an amino acid sequence set forth in SEQ ID NO: 1, a thioesterase gene encoding the thioesterase, a transformant comprising the gene, and a method of producing fatty acids or lipids using the transformant.
US08940506B2
The disclosure provides method and composition utilizing fluorescent amino acids and endogenous fluorescent proteins comprising a moiety capable of undergoing FRET. The methods and compositions of the disclosure are useful in analyzing protein structure and function, and screening molecular inhibitors.
US08940504B2
The present invention relates to methods and means for making Vitamin K-dependent protein compositions which are devoid or substantially devoid of protein contaminants. In particular, methods and means useful for the reduction or elimination of protein contaminants also being Vitamin K-dependent proteins are described.
US08940493B2
Methods for the detection, enumeration and analysis of circulating tumor cells expressing insulin-like growth factor-1 receptors (IGF-1R) are disclosed. These methods are useful for cancer screening and staging, development of treatment regimens, and for monitoring for treatment responses, cancer recurrence or the like. Test kits that facilitate the detection, enumeration and analysis of such circulating tumor cells are also provided.
US08940486B2
Provided are oligonucleotides that are capable of detecting KRAS and PIK3CA mutations in both cancer patients and healthy individuals with high specificity in kPCR assays. When the oligonucleotides are used as forward primers in conjunction with a defined genotyping algorithm spreadsheet, the primers are capable of enhancing detection of KRAS codon 12, 13, and 61 and PIK3CA codon 542, 545, and 1047 single nucleotide polymorphisms (SNPs) in a background of wild-type sequences. The oligonucleotides of the present invention are also capable of preventing pseudogene amplification when the oligonucleotides are hybridized as reverse primers or detection probes to the mismatch sequences.
US08940478B2
Methods for forming cell arrays of multiple cell samples arranged substantially in a monolayer on a single substrate particularly suited for diagnostic analysis are disclosed. The cell arrays are formed with a high-speed dispensing apparatus capable of dispensing small volumes in precise, complex patterns. Also disclosed are substrates upon which cell arrays may be formed, and methods for conducting diagnostic analyzes on the formed cell arrays.
US08940476B2
Provided is a pattern forming method that is excellent in resolving power such as pre-bridging dimension, a roughness performance such as line edge roughness, and development time dependency, and an actinic-ray-sensitive or radiation-sensitive resin composition and a resist film used for the pattern forming method.The pattern forming method includes (1) forming a film using an actinic-ray-sensitive or radiation-sensitive resin composition that contains a resin (A) and a compound (B) which has a polymerizable group and generates an acid by being irradiated with actinic rays or radiations; (2) exposing the film; and (3) developing the exposed film using a developer that contains an organic solvent, wherein a pattern formed in this method is a negative pattern.
US08940474B2
A silicate-free alkaline aqueous developer composition has a pH of at least 12 and comprises a hydroxide alkali agent, a metal cation M2+ selected from barium, calcium, strontium, and zinc cations, a chelating agent for the metal cation, and an alkali metal salt that is different than the other components. These developer compositions can be used to process imaged positive-working lithographic printing plate precursors to prepare lithographic printing plates.
US08940465B2
An undercoat layer of an electrophotographic photosensitive member contains a polymerized product of a composition that contains an isocyanate compound having a specific structure, a resin having a specific structure, and an electron transporting substance having a specific structure.
US08940461B2
A method of coating carbon based electrodes and thick electrodes without mud-cracking is described. The electrode ink is deposited on a decal substrate, and transferred to a hot press before the electrode ink is completely dried. The partially dried electrode ink is hot pressed to the membrane to form a membrane electrode assembly. A membrane electrode assembly including a polymer membrane; and a pair of crack-free electrode layers on opposite sides of the polymer membrane, each of the pair of electrode layers having a thickness of at least about 50 μm is also described.
US08940459B2
An alkaline fuel cell electrode catalyst includes a first catalyst particle that contains at least one of iron (Fe), cobalt (Co) and nickel (Ni), a second catalyst particle that contains at least one of platinum (Pt) and ruthenium (Ru), and a carrier for supporting the first catalyst particle and the second catalyst particle.
US08940458B2
The present invention discloses a fuel supply for a fuel cell, the fuel cell including a liquid storage area that includes a liquid reactant, a reaction area that includes a solid reactant, wherein the liquid reactant is pumped into the reaction area such that the liquid reactant reacts with the solid reactant to produce reaction components, a product collection area that receives the reaction components, a barrier, and a container with an interior volume that substantially encloses the reaction area, liquid storage area, product collection area. The barrier separates and defines several of the aforementioned areas, and moves to simultaneously increase the product collector area and decrease the liquid storage area as the liquid reactant is pumped from the liquid storage area and the reaction components are transferred into the product collection area.
US08940447B2
An oxygen cell capable of minimizing overvoltage increases is provided. An oxygen cell 1 comprises a positive electrode 2 that uses oxygen as an active material, a negative electrode 3 that uses metallic lithium as an active material, and an electrolyte layer 4 sandwiched between the positive electrode 2 and the negative electrode 3, wherein the positive electrode 2 contains a lithium compound.
US08940444B2
Hybrid radical energy storage devices, such as batteries or electrochemical devices, and methods of use and making are disclosed. Also described herein are electrodes and electrolytes useful in energy storage devices, for example, radical polymer cathode materials and electrolytes for use in organic radical batteries.
US08940426B2
A device stores electric energy, in particular for the traction supply of a rail vehicle. The device has a plurality of chargeable storage cells with cell poles, a cooling body that is in thermal contact with the storage cells, and a plurality of bridge members, by way of which two of the plurality of storage cells are in electric contact. Accordingly, at least some of the bridge members contact the storage cells on the sides thereof facing the cooling body. A bridge member contains a connecting web having two recesses and two connecting parts, each being introduced into one of the recesses. Each connecting part is connected to a cell pole of a storage cell to be contacted. The connecting parts are fixed non-rotatably and non-displaceably in a connecting web by a releasable tensioning device. Thus the efficiency and service life of the energy storage device can be increased by reducing the thermal resistance between the storage cells and the cooling body.
US08940425B2
Plate assemblies for a heat exchanger suitable for use in a battery assembly are provided. A plate assembly can include a first substantially planar member having a first side, a second side, a first opening, and a second opening. A first conduit extends from the first opening on the first side and a second conduit extends from the second opening on the first side. A first spacer extends from the second side. Some plate assemblies include a second substantially planar member having a third side, a fourth side, a third opening, and a fourth opening. The third side faces the first side, the first conduit connects the first opening on the first side and the third opening on the third side, and the second conduit connects the second opening on the first side and the fourth opening on the third side. A second spacer extends from the fourth side.
US08940424B2
The accumulator assembly comprises a plurality of electrical energy accumulator elements 12 each comprising connecting electrodes 18, 20, assembly means 22, 24, 50, 52, 54 linking said electrodes, a connector 35 for connecting an external component to the assembly, and a connector support 67. The support 67 comprises a mounting base 64 borne by the assembly means and a fixing lug 65 supporting the connector and configured in such a way as to allow a movement of the connector relative to the mounting base in response to an external stress exerted on said connector and/or on the fixing lug.
