US09111004B2
Implementation of a meta-model service of a service oriented architecture industry model repository into a web ontology language representation of at least one topic map meta-model into a plurality of temporal scope topic map meta-models representing states of the at least one topic map meta-model at different times. The implementation includes assigning topics, occurrences, and attributes from the meta-model service to the at least one topic map meta-model. The topics, occurrences, and attributes are assigned from the at least one topic map meta-model to plurality of temporal scope topic map meta-models. The topics, occurrences, and attributes from the plurality of temporal scope topic map meta-models are converted into resource description framework triples; and the resource description framework triples are persisted into the resource description framework repository.
US09111001B2
A system for receiving local point of interest data is presented. The local point of interest data for a local geographic area is received by a geographic location device via a supported protocol. The local point of interest data includes information regarding one or more local points of interest in the local geographic area. The received local point of interest data is cached with existing point of interest data and maps within a cache in the geographic location device. Then, it is determined whether any time-sensitive point of interest data in the cache has expired. In response to determining that time-sensitive point of interest data in the cache has expired, the expired time-sensitive point of interest data is removed from the cache to form current local point of interest data for the local geographic area. Then, the current local point of interest data is displayed in a display device.
US09110996B2
A system for targeting advertising content includes the steps of: (a) receiving respective requests for advertising content corresponding to a plurality of mobile communication facilities operated by a group of users, wherein the plurality includes first and second types of mobile communication facilities with different rendering capabilities; (b) receiving a datum corresponding to the group; (c) selecting from a first and second sponsor respective content based on a relevancy to the datum, wherein each content includes a first and second item requiring respective rendering capabilities; (d) receiving bids from the first and second sponsors; (e) attributing a priority to the content of the first sponsor based upon a determination that a yield associated with the first sponsor is greater than a yield associated with the second sponsor; and (f) transmitting the first and second items of the first sponsor to the first and second types of mobile communication facilities respectively.
US09110984B1
Methods and systems for constructing a taxonomy based on hierarchical clustering are provided. The taxonomy is generated by first constructing a hierarchy of clusters using a clustering algorithm. A first level of the hierarchy of clusters is generated by providing a plurality of content files to a clustering algorithm. Subsequent levels of the hierarchy are generated by providing the clusters of the preceding levels to the clustering algorithm. Labels that characterize each cluster within the hierarchy are assigned to corresponding clusters. Labels and clusters are combined to form the taxonomy.
US09110979B2
A new approach is proposed that contemplates systems and methods to provide a ranking of citied objects and citing subjects identified as results of a search, where the relative expertise of subjects or sources of citations to said targets or objects is considered. The relative expertise is a function of the share of the subject's citations matching the query term or search criteria relative to the share of all subjects' citations matching the query term, weighted by the influence of the subjects. This allows the identification of “experts” on “topics” without any pre-defined categorization of topics or pre-computation of expertise. Under this novel approach, expertise can be determined on any query term in real-time.
US09110977B1
Techniques for autonomous and automatic real-time publishing of content are described. In an example embodiment, one or more topic terms are obtained. A set of information that is related to the one or more topic terms is automatically acquired. Linguistic analysis on the set of information is automatically performed to determine a set of linguistic structures that are represented in the set of information. The set of linguistic structures is used to automatically create a set of content items that are responsive to searches that include the one or more topic terms. New content that includes the set of content items is then automatically published.
US09110972B2
A power allocation system includes a manager provided on a network controller. An agent is provided on a line module coupled to the network controller. The agent is operable to detect a connection of a powered device to a port on the line module and communicate that to the manager. The manager then classifies the powered device and provides a first power to the powered device through the port from a global power budget according to the classification. At least one of the manager and agent then monitor the power consumption of the powered device subsequent to providing the first power, and a second power is provided to the powered device through the port from the global power budget according to the monitoring, wherein the second power is different from the first power.
US09110970B2
A computer system selects a first database corresponding to a first schema and a second database corresponding to a second schema. The computer system then generates a schema table based upon the selected databases. Next, the computer system destructures the schema table, which includes a first entry corresponding to the first database and a second entry corresponding to the second database. The computer system then selects a property map that links the first entry to the second entry, and restructures the destructured schema table using the selected property map, resulting in a restructured schema table. In turn, the computer system processes a user query using the restructured schema table.
US09110961B2
Information warehouse table data is updated through a full outer join between warehouse tables and source tables in response to a single query language command statement of a relational database computer language. The single command statement comprises table mapping instructions for updating the warehouse tables that define matching conditions, delete instructions, archive instructions, and update instructions. The full outer join inserts rows in the warehouse tables for source table data rows that do not have corresponding matching rows in the warehouse table. Data rows in the warehouse tables without corresponding matching source table rows are deleted if a value of a parameter in the warehouse table system is set to delete; updated if the parameter is update; and updated with archive values and a new table row inserted with existing values if the parameter is archive.
US09110958B2
Systems and methods for implementing and performing coaching-assisted content delivery and workflows are described. In one example, a goal-based workflow integrates with operations for suggesting and delivering content on behalf of professional users. The operations may be conducted in connection with a subscription or membership to an information service, and various interactions between a client user and a professional user through the information service. In further examples, the information service may track data for the human user, generate suggestions and playlists, manage the accomplishment of goals and logic triggers, and exchange communications, to facilitate the relationship between the professional user and the client user. In other further examples, the information system manages various data values used to provide prompts, reminders, motivators, and other forms of suggested content to the client user.
US09110957B2
A business intelligence document provides functionality for testing a hypothesis on aggregated data in a business intelligence document (e.g., a spreadsheet-like document), wherein one or more of the input data values and transformation properties are designated as constrained (e.g., invariant or constrained within a range, set, enumeration, or domain). The hypothesis, which is articulated as a data mining assertion, is input through the user interface of the business intelligence document (e.g., via an expression interface or properties of a row, column, or cell) and solved over the aggregated data. The solution is then presented through the user interface of the spreadsheet-like document, such as in a table, graph, histogram, etc.
US09110954B2
Method and systems for searching for media instances of interest to a user are described. User input specifying criteria for content is received and parameters are defined based on the user input. A plurality of databases are searched for media instances meeting the defined parameters, wherein the plurality of databases includes at least one database containing broadcast television content information and at least one database containing non-broadcast television content information. Information about the media instances meeting the defined parameters is retrieved from the plurality of databases. The retrieved information is provided to the user.
US09110949B2
Processes, machines, and stored machine instructions are provided for estimating how many rows would be processed by a query. In one embodiment, model aggregating logic may generate a global model based on separate models for separate portions of a set of data. For example, the separate portions may be assigned to separate partitions of the set of data based at least in part on key values in the separate portions. Generating the global model may include generating an uncompressed model that includes components of the separate models before generating a compressed model to estimate the uncompressed model. Query analysis logic may use the global model to estimate how many rows would be processed by queries that, when executed, would access portion(s) of the set of data.
US09110944B2
A method, system and computer program product for generating answers to questions. In one embodiment, the method comprises receiving an input query; conducting a search to identify candidate answers to the input query, and producing a plurality of scores for each of the candidate answers. For each of the candidate answers, one, of a plurality of candidate ranking functions, is selected. This selected ranking function is applied to the each of the candidate answers to determine a ranking for the candidate answer based on the scores for that candidate answer. One or more of the candidate answers is selected, based on the rankings for the candidate answers, as one or more answers to the input query. In an embodiment, the ranking function selection is performed using information about the question. In an embodiment, the ranking function selection is performed using information about each answer.
US09110941B2
A method, apparatus, and computer program product for processing data is disclosed. In one aspect of the invention, a computer implemented method comprises receiving, on one or more computers, a record having one or more attributes from a source system. The method also comprises measuring, on one or more computers, a data accuracy of the received record as compared to a golden record stored in a master data management system. One or more remediation actions are performed, on one or more computers, to enforce improvements to the measured data accuracy of the received record in the source system. In one or more embodiments, measurement of data accuracy comprises calculating, on one or more computers, an accuracy score defined by a closeness of the received record to the golden record.
US09110931B2
A method for querying metadata associated with media, such as multimedia and/or streaming media, on a computer network includes separating the metadata into keywords. The keywords are compared with valid keywords. A score is calculated in accordance with the degree of similarity between the keywords and valid keywords. If the degree of similarity is above a threshold, the metadata is qualified as valid metadata. Valid metadata is available for comparison and correction of other (invalid) metadata.
US09110926B1
A method for detecting and correcting skew in scanned vertical text includes identifying an image of vertically oriented characters, and identifying a plurality of vertical lines corresponding to character positions of the vertically oriented characters in the image. The method further includes generating an average slope of a subset of the plurality of lines, and causing the image to be deskewed based on the average slope.
US09110925B2
A digital image of the object is captured and the object is recognized from plurality of objects in a database. An information address corresponding to the object is then used to access information and initiate communication pertinent to the object.
US09110917B2
A server computer system receives a file access request for accessing a file in a file system. The file access request includes a file handle for the file. The server computer system assigns a value as a file descriptor for the file. The assignment is performed without issuing a file open request to open the file. The server computer system associates the file descriptor with the file handle in a data store accessible to a storage subsystem and provides the file descriptor for accessing the file to the storage subsystem according to the file access request.
US09110905B2
A system includes a processor device. The processor device is configured to detect a physical topology of a network comprising hosts and sensors in the network. The processor device is also configured to generate a sensor policy for assignment of the sensors to network blocks of the hosts, that balances a processing load and accuracy of the sensors in the network based on physical closeness of the sensors to different divisions of hosts within a same network block.
US09110904B2
A method and devices for obtaining metadata associated with programs from multiple metadata sources. Title metadata is compared to determine if any title metadata match. Transformation rules are applied to the title metadata when title metadata does not match with other title metadata. The transformation rules transform the title metadata into a common format. The title metadata is compared after transformation to determine whether the title metadata matches other title metadata. Title metadata that matches other title metadata, the metadata associated with a program is aggregated.
US09110895B2
The present disclosure includes a system and method for a serialized data service. A method for a serialized data service includes retrieving serialized data to a data service, and augmenting the serialized data with information corresponding to one or more data retention policies. The augmented serialized data is stored to a data source. The augmented serialized data is removed from the data source based on the augmented information.
US09110892B2
Aspects of the subject matter described herein relate to synchronizing data. In aspects, properties are synchronized from an organization property store to a cloud property store and/or vice versa. The list of properties to synchronize may change based on the cloud services to which the organization subscribes, changes to the cloud services, or for other reasons. Furthermore, the list of properties to synchronize may be limited to certain objects of the organization which may also change over time.
US09110888B2
A service server apparatus is provided which can realize a service as if a speaker has a conversation in a face-to-face manner using existing applications. The service server apparatus includes a service activating unit receiving an instruction for performing a task during a communication, a telephone/call control unit recording a call speech of the speaker during the communication between speech communication terminal devices, a speech recognizing enabler, a text translating enabler, and a speech synthesizing enabler performing the task based on the recorded call speech when the instruction is received, and a communication control enabler providing task data obtained through an performance of the task to the speech communication terminal device. The task data is text data obtained by converting the call speech into a text, translated text data obtained by translating the text data into another language, and speech data obtained by converting the translated text data into a speech.
US09110875B2
Aspects of the invention are directed to XML post-processing hardware acceleration for high-speed simple type checking (e.g., string and format checking) and whitespace collapsing. An apparatus for processing text data according to an embodiment includes a post processing engine (PPE); a set of post processing state machines coupled to the PPE; and a memory for storing text data to be processed by the set of post processing state machines; wherein the set of post processing state machines includes a whitespace handler state machine for reading text data from the memory and for applying a whitespace facet to at least 4 bytes of the text data during a clock cycle.
US09110873B2
Technologies are described herein for generating a platform-independent data application. In one method, a definition of a data schema is received for defining data types. A definition of a user interface is also received for access data stored in the data types. Further, a definition of business logic is received for enforcing validation rules and actions associated with the data types. The definitions of the data schema, the user interface, and the business logic are each received in a platform-independent format and used to generate the platform-independent data application.
US09110865B2
Dynamic network routing in a virtual machine environment. The dynamic network routing includes receiving an indication that a network outage has occurred and receiving a network communication to a guest or from the guest executing on a hypervisor. It is then determined if the guest that is the source or destination for the network communication is configured to use a revised network route. In response to determining that the guest is not configured to use the revised network route, then the transmission of the network communication is prevented and the guest is provided with network routing information. Once the guest has received the updating routing information the transmission of the network communication on the new route is allowed.
US09110864B2
A fault tolerance method and system for VMs on a cluster identifies a client state for each client session for those applications. The method replicates the client session onto a primary and a backup VM, and uses a network controller and orchestrator to direct network traffic to the primary VM and to periodically replicate the state onto the backup VM. In case of a VM failure, the method reroutes network traffic of states for which the failed VM serves as a primary to the corresponding backup, and replicates states without a backup after the failure onto another VM to create new backups. The method may be used as part of a method or system implementing the split/merge paradigm.
US09110862B1
A computer-implemented method to characterize a signal structure is provided. The method may receive a first set of time-dependent data vectors; select a sample size of data vectors; determine a minimum number of lags to process to characterize the first set of data vectors; calculate a cross-product term for each data vector in the sample size for each lag, a mean value and a variance value based on the sum of the cross-product term for each lag; calculate a circular correlation function for each lag; determine an upper and a lower correlation bound for the circular correlation based on the mean value, the variance value, and a desired false alarm rate; and characterize the signal structure based on the number of calculated circular correlation functions that exceed the upper or lower correlation bounds so as to generate a signal characterization data signal.
US09110861B2
Systems and methods are disclosed which facilitate the management of host computing devices through the utilization of a host computing device control component. The host computing device control component includes a state monitoring component that monitors operating states of the control component and a group of associated host computing devices. Based on a determination of a power event, the state monitoring component causes the initiation of a reboot of the grouping of host computing devices based on exchange priority information and additional reboot parameters.
US09110858B2
An apparatus and method for controlling a low-voltage memory in a mobile communication system are provided. The apparatus includes a memory for storing data including at least one error caused by a low-voltage, and an error correction unit for identifying whether the at least one error exists in the memory according to a first bit set in a local buffer of an error correction code storage, for comparing location information on the error data read from the memory and location information on error data of at least one protection set in the local buffer of the error correction code storage when it is determined that the at least one error exists in the memory, for generating an error correction code as a result of the comparison, and for correcting the error data of the memory according to the error correction code.
US09110850B2
Technique for reducing start-up time of a computerized system comprising a computer application with a data base DB and one or more functional blocks with respective memories; the system comprises a communication network being managed by the computer application. The technique comprises providing each of said functional blocks with basic information about the communication network; updating the functional blocks about changes whenever take place in the network; updating objects in the base DB by the updated functional blocks; creating an image of at least one functional block of the blocks in a persistent memory, building a changes log and to in case of failure of the mentioned functional block, promptly restoring thereof by using the image in the persistent memory and the changes log.
US09110844B2
When a stateful service is implemented in a cloud architecture, a state service system receives a user interface definition for a service and generates a client proxy and optionally a storage proxy. The stateful service implements service instances to service requests from clients. The client proxy receives and logs messages from a client in a state service component and a storage proxy logs interactions with a data store. When a service instance serving existing clients is changed, the proxies replay the logged information to the new service instance to recover or maintain state for individual client sessions.
US09110842B2
A control device for a vehicle including a nonvolatile memory which is electrically erasable and writable detects, on start-up, whether or not an error occurs in updated data read from the nonvolatile memory, and when an error has been detected, performs a reset after saving error information. When being restarted by the reset, the control device for a vehicle determines on the basis of the error information whether or not there is updated data in which an error has occurred, and when there is updated data in which an error has occurred, overwrites the updated data with a fixed value prior to the error detection. Accordingly, there can be suppressed a case in which the error detection is performed while the updated data with an abnormality is present causing the reset and the error detection to be repeated.
US09110840B2
An example of a base apparatus for use by a tablet computer is disclosed. The base apparatus can include a first peripheral device capable of operating according to a first wireless communication protocol; a first demultiplexer coupled to the first peripheral device; and a first wireless communication module coupled to the first demultiplexer. The first demultiplexer is to transmit signals received from the first peripheral device to the tablet computer in a wired way or transmit signals received from the first peripheral device to the first wireless communication module based on whether the tablet computer is connected to or detached from the base apparatus. The first wireless communication module is to transmit wirelessly signals received from the first demultiplexer to the tablet computer.
US09110828B2
An integrated circuit device includes a transmitter circuit including an output driver. The integrated circuit device includes a first register to store a value representative of a drive strength setting associated with the transmitter circuit such that the output driver outputs data in accordance with the drive strength setting. The integrated circuit device also includes a second register to store a value representative of an equalization setting associated with the transmitter circuit such that the output driver outputs data in accordance with the equalization setting. The integrated circuit device further includes a third register to store a value representative of a slew rate setting associated with the transmitter circuit such that the output driver outputs data in accordance with the slew rate setting.
US09110825B2
A network unit, comprising a processor and a random access memory (RAM) component coupled to the processor, wherein the RAM component comprises a memory management unit (MMU) and a data RAM, wherein the MMU comprises a complete page address table for translating a virtual memory address received from the processor into a physical memory address, and wherein the complete page address table is substantially static.
US09110824B2
A method for correcting data bit of at least a cell of a flash memory includes: determining a contributing factor of level distribution corresponding to an electric level of a first cell to generate a first determination result; and, correcting/modifying the data bit corresponding to the electric potential of the first cell according to the first determination result.
US09110822B2
A data storage device includes a non-volatile memory that includes a three-dimensional (3D) memory. A method includes receiving first data and second data from a host device. A first error-correcting code (ECC) codeword associated with the first data is written to a first word line of the non-volatile memory, and a second ECC codeword associated with the second data is written to a second word line of the non-volatile memory. The first ECC codeword includes a first bit and a second bit, and the second ECC codeword includes a third bit and a fourth bit. The method further includes writing parity information to a parity storage portion of the non-volatile memory that is distinct from the first word line and from the second word line. The parity information includes a parity bit that is based on the first bit, the second bit, the third bit, and the fourth bit.
US09110801B2
At least one physically inconsistent system resource is identified in response to a failure of an application, where the physically inconsistent system resource was left in a physically inconsistent state as a result of the failure of the application. Available backout operations for any system resources updated by the failed application other than the physically inconsistent system resource are ignored. An automated partial backout of the physically inconsistent system resource is performed. This abstract is not to be considered limiting, since other embodiments may deviate from the features described in this abstract.
US09110799B2
A method and apparatus for providing intelligent error messaging is disclosed wherein a user of a mobile communications device is provided with descriptive error messaging information to assist the user in overcoming errors associated with the processing of electronic messages and data.
US09110796B2
Apparatus and circuitry are provided for supporting collection and/or verification of data integrity information. A circuitry in a storage controller is provided for creating and/or verifying a Data Integrity Block (“DIB”). The circuitry comprises a processor interface for coupling with the processor of the storage controller. The circuitry also comprises a memory interface for coupling with a cache memory of the storage controller. By reading a plurality of Data Integrity Fields (“DIFs”) from the cache memory through the memory interface based on information received from the processor, the DIB is created in that each DIF in the DIB corresponds to a respective data block.
US09110790B1
A method is used in managing memory in displaying data storage system information. A graphical user interface (GUI) is provided that includes a GUI component representative of a logical object in a data storage system. In an object pool, a software object is stored corresponding to the GUI component. In the object pool, the software object is made available for garbage collection when the GUI releases a reference to the software object.
US09110789B1
A method of applying an address space to data storage in a non-volatile solid-state storage is provided. The method includes receiving a plurality of portions of user data for storage in the non-volatile solid-state storage and assigning to each successive one of the plurality of portions of user data one of a plurality of sequential, nonrepeating addresses of an address space. The address range of the address space exceeds a maximum number of addresses expected to be applied during a lifespan of the non-volatile solid-state storage. The method includes writing each of the plurality of portions of user data to the non-volatile solid-state storage such that each of the plurality of portions of user data is identified and locatable for reading via the one of the plurality of sequential, nonrepeating addresses of the address space.
US09110777B2
A system has at least a first circuit portion and a second circuit portion. The first circuit portion is operated at normal AC frequency. The second circuit portion is operated in a back-up mode at low AC frequency, such that the second circuit portion can rapidly come-online but has limited temperature bias instability degradation. The second circuit portion can then be brought on-line and operated at the normal AC frequency. A system including first and second circuit portions and a control unit, as well as a computer program product, are also provided.
US09110776B2
An image forming apparatus includes a main processing portion set as a root complex of PCI Express, a startup control portion to control startup of the main processing portion, and a connection portion connectable with an option board having a sub processing portion set as a root complex of PCI Express. The startup control portion includes a detection portion to detect the option board connected to the connection portion, an acquisition portion to acquire ability information about the option board at a stage before the main processing portion starts up, when the option board is detected, a selection portion to select one of the main processing portion and the sub processing portion, based on the acquired ability information, and a switch portion to start one selected from the main processing portion and the sub processing portion as a root complex.
US09110767B2
The COBOL reference architecture (CRA) system and the transactional workflow driver (TWD) provide an efficient and effective way to extend an existing application using modern architecture techniques without rewriting the existing application. The (CRA) system and TWD provide a way to generate new and interchangeable COBOL language functionality for multiple interactive types (e.g., transaction servers and/or transaction managers) running in various computing environments.
US09110759B2
We describe a method of activating functionality of an item of software installed on a mobile device, the method comprising: installing said software on said mobile device, wherein said installing includes registering in an operating system of said mobile device a link between an application URI scheme and said software such that a URI having said application URI scheme will be passed to said installed software for processing; scanning a code into said mobile device, wherein said code includes a code URI comprising said application URI scheme and activation data for said item of software; interpreting said application scheme of said code URI using said registered link to pass said code URI to said installed software; and processing said code URI using said installed software to activate a function of said item of software using said activation data in said code URI.
US09110757B2
In one embodiment, a computer system creates a first template VM that includes a first OS VMDK and a first software binary VMDK, and clones the first template VM to create a linked clone VM. The linked clone VM executes a guest OS by accessing the first OS VMDK and a software application by accessing the first software binary VMDK. The computer system further creates a second template VM that includes a second software binary VMDK, where the second software binary VMDK includes one or more upgrades to the software application that are not included in the first software binary VMDK. The computer system then detaches the first software binary VMDK from the linked clone VM and attaches the second software binary VMDK to the linked clone VM. The linked clone VM thereafter executes the software application by accessing the second software binary VMDK.
US09110756B1
Methods and systems for deploying software packages are provided. In an example, a deployment service allows users to deploy software packages to target sets of computing devices where the target sets may overlap. The deployment service prevents software packages from being deployed to target sets that would conflict with a software package deployed to at least some of the target set as a result of the target set overlapping with another set.
US09110755B2
Techniques for aggregation of update sets are described. In at least some implementations, techniques enable relationships between the updates to be created, managed, and applied in a variety of ways. For example, updates can be grouped in a set for installation on a computing device as an integrated set. Grouping updates in a set can be based on membership rules that specify whether a particular update may be grouped in a set, and conditions under which the particular update may be grouped in a set. Updates that are included in a set may be associated with interaction rules that specify how updates in the set interact as part of an installation process. In at least some implementations, membership rules and interaction rules for updates can be dynamically created, configured, and/or dynamically reconfigured.
US09110745B2
Systems and methods are provided, for use in a messaging subsystem, which supports flow control of messages between producers and consumers. A system can include at least one producer that is operable to send messages in a batch to one or more consumers via at least one destination; and one or more consumers that are operable to process messages received from the at least one producer via the at least one destination. The system can also include a message broker which includes the at least one destination and which manages communications between the at least one producer and the one or more consumers. The message broker includes a flow controller that is operable to monitor a producing rate and a consuming rate, and dynamically adjust a batch size of the batch at the at least one producer based on the producing rate and the consuming rate to communicate the messages more efficiently.
US09110740B1
The present invention throttles notifications to a user based on changes in particular state values. A computer-implemented method manages notifications of changes to one or more settings of an application. The method includes: displaying a first notification of a change of a setting to a value; updating a count of notifications displayed for the value; and throttling a subsequent notification of a subsequent change of the setting to the value if the count exceeds a threshold.
US09110731B1
Apparatus and associated methodology involving use of a multiple-core processor. A reserved hard allocation of resources partition (HARP) dedicates physical resources for operably supporting a first processing function. The dedicated resources of the reserved HARP include a reserved physical memory that is sized in relation to data processing requirements of the first processing function. The dedicated resources of the first HARP also include a command buffer residing in the reserved physical memory. The dedicated resources of the first HARP also include a reserved physical core of the multiple core processor. The apparatus also includes a second HARP having resources that are used for operably supporting a different second processing function. The second HARP resources operably put transaction requests from the second processing function to the command buffer in the first HARP.
US09110725B1
The present invention discloses user interface for creating a dynamic computing environment using allocateable resources. The interface enables the fast, efficient selection and configuration of processing resources for the computing environment. The resources are fully selectable and allocable by a system architect. In a first embodiment, a primary company, Design2Deploy, Inc.® provides the ability for a customer or system architect to design a system by allocating resources and specifying how the resources are to be used. The system architect may create a computing environment from a remotely-accessible user interface such as a web page on the Internet. Thus, the system architect can create, modify and operate the environment from anywhere in the world.
US09110722B2
A processor-implemented method, system, and/or computer program product allocates computer processing work. Input data, which has been deemed to be in need of processing, is stored in a first computer. A virtual machine that is capable of processing the input data is stored on a second computer. A first set of constraint rules contains constraint rules against moving the input data from the first computer, and a second set of constraint rules contains constraint rules against moving the virtual machine from the second computer. Based on the first and second constraint rules, either the virtual machine is moved to the first computer or the input data is moved to the second computer.
US09110716B2
An information handling system includes a set of power and performance profiles. Based on which of the profiles has been selected, the information handling system selects a thread scheduling table for provision to an operating system. The thread scheduling table determines the sequence of processor cores at which program threads are scheduled for execution. In a power-savings mode, the corresponding thread scheduling table provides for threads to be concentrated at subset of available processor cores, increasing the frequency with which the information handling system can place unused processors in a reduced power state.
US09110715B2
A system and method can support a concurrent priority queue. The concurrent priority queue allows a plurality of threads to interact with the priority queue. The priority queue can use a sequencer to detect and order a plurality of threads that contend for one or more requests in the priority queue. Furthermore, the priority queue operates to reduce the contention among the plurality of threads.
US09110711B2
A mechanism for describing dynamic display objects in a distributed computing environment is described. A service in a distributed computing environment may generate results data for a client in response to client requests. The service may provide schemas describing the presentation characteristics of results data. The schemas may include information for use in presenting the results data. The results data may include data elements, and the presentation schema may include presentation elements each including information describing the presentation characteristics of one or more of the data elements. The client may map data elements to corresponding presentation elements from the schema, and may use the element corresponding to a data element to present the data element. Using the dynamic display objects, display behavior may be altered without having to rebuild code.
US09110709B2
A method is provided for preserving changes to a configuration of a running virtual machine. The method includes reading an initial configuration, starting the virtual machine under application of the initial configuration, modifying the configuration of the virtual machine during runtime, storing the modified configuration of the virtual machine during shutdown, and reading the modified configuration at re-start of the virtual machine and re-starting the virtual machine under application of the modified configuration.
US09110704B2
A method for fast migrating of a source virtual machine located on a source host to one or more destination hosts is provided. A source migration manager of a hypervisor receives identities of a plurality of destination hosts. The source migration manager copies at least one data segment corresponding to a portion of a state of a source virtual machine to the pluralities of destination hosts. The source migration manager receives a command to migrate the source virtual machine to one or more selected destination hosts of the plurality of destination hosts after copying the at least one data segment to the destination hosts. When the source migration manager receives an indication of successful booting of at least one destination virtual machine, the source migration manager terminates transmission of the state of the source virtual machine to the remaining plurality of destination hosts.
US09110696B2
A thin client system comprises a virtual machine server, a thin client terminal, a connection management server, and a virtual machine management server which executes reverting processing of the virtual machine, wherein the connection management server includes a session management unit which determines the virtual machine to be allocated to the thin client terminal based on a to-be-reverted list stored in which virtual machines to be reverted are arranged in descending order of differential disk capacities, and a maintenance processing management unit which requests the virtual machine management server to execute reverting processing, wherein the session management unit when a virtual machine not included in the to-be-reverted list exists, allocates the virtual machine in question to the thin client terminal, and when all the virtual machines are included in the to-be-reverted list, allocates the virtual machine whose differential disk capacity is the smallest to the thin client terminal.
US09110689B2
The optimal configuration of a number of optional pipeline stages within the data paths of systems-on-chip is determined by application of a solver. The solver includes variables such as: the placement of modules physically within the floorplan of the chip; the signal propagation time; the logic gate switching time; the arrival time, after a clock edge, of a signal at each module port; the arrival time at each pipeline stage; and the Boolean value of the state of activation of each optional pipeline stage. The optimal configuration ensures that a timing constraint is met, if possible, with the lowest possible cost of pipeline stages.
US09110672B2
A computer system receives a source code comprising an annotation, wherein the annotation is associated with a portion of the source code and wherein the annotation indicates a first bit-width. The computer system identifies a first data type of the portion of the source code. The computer system receives compatibility information corresponding to the first data type, the compatibility information indicating at least one compatible bit-width of the first data type. The computer system modifies the source code to insert a first code segment.
US09110667B2
According to an embodiment, a control system includes a processing device; a main storage device to store the data; a cache memory to store part of the data stored; a prefetch unit to predict data highly likely to be accessed and execute prefetch, reading out data in advance onto the cache memory; and a power supply unit. The system further includes: a detecting unit to detect whether the processing device is in an idle state; a determining unit that determines whether to stop the supply of power to the cache memory in accordance with the state of the prefetch when determined as idle state; and a power supply control unit that controls the power supply unit so as to stop the supply of power, or controls the power supply unit so as to continue the supply of power.
US09110654B2
During a first execution of software, historical data is logged that indicates which locale objects were used. During a second execution of the software, the historical data is read, and locale objects or subsections of locale objects are dynamically built from locale source files based on the historical data in the log that indicates which locale objects were used during the first execution. Any other locale objects or subsections that are needed that are not built initially during the second execution are dynamically built from locale source files when requested at run-time. Dynamically building locale objects or subsections based on which locale objects were used in one or more previous executions saves time that would otherwise be required to build the locale objects when they are needed at run-time. The result is significant savings in system-wide resources while still allowing for access to a large number of possible locales.
US09110648B2
A power supply circuit includes a power output port, an operational amplifier, a voltage adjusting circuit, a feedback circuit, and a current controlling circuit. The power output port connects with an electronic device under test and provides a power supply which in all respects simulates the behavior of a battery being discharged as it supplies working power, the circuit also mimics the behavior of a battery in testing the battery-recharging abilities of the electronic device.
US09110641B2
A container data center includes a container, a row of racks installed in the container, an air conditioner, and a heat insulation apparatus. A cool channel and a heat channel are defined at two opposite sides of the row of racks. The removable heat insulation apparatus divides the cool channel into a first space and a small second next to the racks, and maintains the cooled air in the second space. Cooled air from the air conditioner is fed into the second space air conditioner, flows through the racks to remove heat generated, and enters the heat channel.
US09110639B2
Embodiments include systems and methods for controlling power distribution and supply across independently powered modules in a storage library. Embodiments operate in context of a data storage library having a base module and one or more expansion modules. Each expansion module is independently powered, and each is in communication with the base module via a powered data communications network. In some embodiments, when the base module power supply is on, a base controller in the base module provides network power over the powered data communications network. The network power causes expansion controllers in each expansion module to boot up and power on the power supplies of their respective modules. When the base module is powered down, power is no longer available to the expansion controllers, and the respective power supplies can be hard-coded to shut down automatically under that condition.
US09110632B2
An illustrative embodiment of an apparatus for containing a set of portable devices comprises a primary bar affixed to a surface of a portable computing device; a secondary bar parallel to and spaced apart from the primary bar; a first tertiary bar; and a second tertiary bar, and wherein a combination of the primary bar, the secondary bar, the first tertiary bar and the second tertiary bar are configured to form a rectangular bounding box for containing one or more portable devices; and a set of slide slats spanning a distance between the primary bar and to the secondary bar, wherein each slat is parallel to and spaced apart from an adjacent slat in the set of slide slats and wherein the set of slide slats are located overhead of the one or more portable devices to contain the one or more portable devices within the bounding box.
US09110629B2
This application relates an adapter device for tablet computer. This adapter device comprises a stylus and an adapter for fixing the stylus onto the tablet computer. The adapter is comprised of a buckling part and a plug-in part, wherein the buckling part is configured to fix the stylus and the plug-in part is plugged into an interface port of the tablet computer. The stylus can be attached onto the tablet computer by the adapter so as to bring convenience for user to achieve and improve accuracy of input. It also provides convenient means for stylus storage to prevent the stylus from loss.
US09110626B2
A display area having rendered data thereon is divided into a plurality of tiles and an update frequency for each tile is determined. A determination is then made as to whether the update frequency of each tile exceeds a threshold. For each tile whose update frequency exceeds the threshold, that tile is marked as a candidate tile. Adjacent candidate tiles are then associated to form a heat map. The heat map is then analyzed to determine whether to encode the rendered data associated with the heat map.
US09110625B2
A portable terminal has a first display and a second display, and is transformable between a first form and a second form. The first form is formed by arranging the first display and the second display to form a combined display, and the second form is formed by overlaying the second display upon the first display. In the first form displaying is performed on the combined display and in the second form displaying is performed on only the second display. The portable terminal detects a tilt of the portable terminal at a primary surface of the second display. When the portable terminal is in the first form, the tilt that is detected is corrected and displaying is performed based on the corrected tilt. When the portable terminal is in the second form, displaying is performed based on the detected tilt.
US09110623B2
The present invention provides a mechanism to acquire content that has not been converted into print data from a vendor server providing a print service.The mechanism acquires content data corresponding to content identification information from an application server if location information about print data acquired on the basis of the content identification information that is acquired coincides with location information about print data included in notification information that is acquired.
US09110614B2
A terminal device may send authentication information to a printer, obtain, from a print intermediation server by using the authentication information, M pieces of file identification information for identifying M files in a case where M pieces of file related information and the authentication information are being registered in association in the print intermediation server, control a display unit of the terminal device to display a first selection screen causing a user to select first file identification information from among the M pieces of file identification information, and send, to the printer, a print instruction including the first file identification information. The authentication information and the first file identification information may be used by the printer, in order to obtain, from the print intermediation server, print data created from a first file identified by the first file identification information.
US09110611B2
A process and system for minimizing an image processing apparatus from remaining in a waiting state when communication with a client application has been lost. Various implementations are described in which processing requests are canceled based on losses of communication with the client application.
US09110603B2
Provided are a computer program product, system, and method for identifying modified chunks in a data set for storage. Information is maintained on a data set of variable length chunks, including a digest of each chunk and information to locate the chunk in the data set. Modifications are received to at least one of the chunks in the data set. A determination is made of chunks including data affected by the modifications. The determined chunks including data affected by the modifications are processed to determine new chunks and for each determined new chunk and for each determined new chunk, new digest information of the new chunk. The new digest information on the at least one new chunk and information to locate the new chunk in the data set are added to the set information.
US09110602B2
A content alignment system according to certain embodiments aligns a sliding window at the beginning of a data segment. The content alignment system performs a block alignment function on the data within the sliding window. A deduplication block is established if the output of the block alignment function meets a predetermined criteria. At least part of a gap is established if the output of the block alignment function does not meet the predetermined criteria. The predetermined criteria is changed if a threshold number of outputs fail to meet the predetermined criteria.
US09110592B2
A method of operating a computing device includes dynamically managing at least two types of memory based on workloads, or requests from different types of applications. A first type of memory may be high performance memory that may have a higher bandwidth, lower memory latency and/or lower power consumption than a second type of memory in the computing device. In an embodiment, the computing device includes a system on a chip (SoC) that includes Wide I/O DRAM positioned with one or more processor cores. A Low Power Double Data Rate 3 dynamic random access memory (LPDDR3 DRAM) memory is externally connected to the SoC or is an embedded part of the SoC. In embodiments, the computing device may be included in at least a cell phone, mobile device, embedded system, video game, media console, laptop computer, desktop computer, server and/or datacenter.
US09110590B2
A touch-sensitive display surface having touch-capacitive and vibration sensors. This surface allows the user to rest their fingers on the keys of an onscreen keyboard and type as they would on a regular keyboard. As the user places their fingers on the touch screen, the system relocates the onscreen keyboard to the location where the fingers are resting. The touch sensors report the signal strength level of each key touched to a processor, but no keystroke is issued by the processor until a corresponding “tap” (i.e., vibration) is detected. When a tap is detected, the processor references the status of the touch capacitance sensors before, during, and/or immediately after the moment in time the tap occurred. The size, position, and orientation of the onscreen keyboard keys are dynamically set as determined by the user initiating a home-row definition event by resting their fingers momentarily on a virtual home-row.
US09110588B2
An optical touch device utilizes two images sensed by two image sensing units, which are diagonal to each other, to determine whether a number of touch points located at a central touch area is equal to 1. When the number of touch points are larger than 1, the optical touch device further utilizes another two images sensed by another two image sensing units, which are also diagonal to each other, to assist in determining the number of touch points located at the central touch area, so as to improve the accuracy of determination.
US09110585B2
Disclosed are a method for providing a user interface by mapping various types of multimedia to patterns drawn on a display, and a mobile terminal thereof. A user may draw a pattern according to his or her preference, and a controller may generate an object by mapping one or more multimedia data to the pattern. The controller may play the mapped multimedia data by tracking the multimedia data-mapped pattern. The controller may store the multimedia data-mapped pattern (object) in a memory. And, the controller may transmit the object to a selected specific party to provide an enhanced user interface (UI).
US09110581B2
Touch, multi-touch, gesture, flick and stylus pen input may be supported for remoted applications. For example, a touch capable client device may receive touch input for a remoted application executing on a server. In such an instance, the touch input may be transmitted to the server for processing. The server may modify the application display or the application functionality and provide an output to the client device. In some arrangements, the output may correspond to instructions for modifying a display of the application while in other examples, the output may correspond to an image of the changed application display. Additionally or alternatively, determining a functionality associated with touch input may be performed based on user definitions, user preferences, server definitions (e.g., operating system on the server), client definitions (e.g., operating system on the client) and the like and/or combinations thereof. Aspects may also include resolving latency and enhancing user experience.
US09110569B2
Recording a user's preference for content is disclosed. A first indication that a user has a first preference for the content is received. In response to receiving the first indication, the content is associated with the first preference. A second indication that the user has a second preference for the content is received. In response to receiving the second indication, the content is additionally associated with the second preference.
US09110568B2
Tabs of online content can be positioned according to the relative importance of each tab to a user. A user's interaction with a plurality of online content is monitored, and user activity metadata generated by, and associated with, the user's interaction with the online content is collected. A plurality of tabs of the online content is opened in a graphical user interface, and a relative importance of each of the plurality of tabs to the user is determined based on the user activity metadata associated with the online content in the tab. At least a subset of the tabs are positioned relative to each other within the graphical user interface based at least on the relative importance of each tab.
US09110567B2
The present invention provides a highly scalable architecture for a three-dimensional graphical, multi-user, interactive virtual world system. In a preferred embodiment a plurality of users interact in the three-dimensional, computer-generated graphical space where each user executes a client process to view a virtual world from the perspective of that user. The virtual world shows avatars representing the other users who are neighbors of the user viewing the virtual word. In order that the view can be updated to reflect the motion of the remote user's avatars, motion information is transmitted to a central server process which provides positions updates to client processes for neighbors of the user at that client process. The client process also uses an environment database to determine which background objects to render as well as to limit the movement of the user's avatar.
US09110563B2
A 3 dimensional (3-D) user interface system employs: one or more 3-D projectors configured to display an image at a first location in 3-D space; one or more sensors configured to sense user interaction with the image and to provide user interaction information; and a processor configured (i) to receive the user interaction information from the one or more sensors; (ii) to correlate the user interaction with the image; and (iii) to provide one or more indications responsive to a correlation of the user interaction with the image, including displaying the image at a second location in 3-D space.
US09110560B1
A method and apparatus for processing shop order instances for an aircraft. The shop order instances for the aircraft are identified. A current state of assembly of the aircraft is identified. A status of the shop order instances is identified. Parts present in the aircraft are identified for the current state of assembly of the aircraft. Graphical representations of the parts present for the current state of assembly for the aircraft for a group of shop order instances in a graphical user interface are displayed on a display device using a model of the aircraft. A set of graphical indicators in association with the graphical representations of the parts displayed in the graphical user interface are displayed. The set of graphical indicators indicates the status of the shop order instances.
US09110543B1
It is an object of the present invention to provide an apparatus and method for emulating touch and gesture events on a capacitive touch sensor array comprising: an electric field detection means for measuring the electric field intensity emitted as a function of time from a first plurality of scan electrodes of said capacitive touch sensor array; a predictive scan pattern means to infer the scan times and scan stimulus waveforms of a second plurality of scan electrodes at a plurality of emulated touch locations spanning an emulated gesture movement on said capacitive touch sensor array from said measured electric field intensity; and an electric field synthesizing means to create a time sequence of time variant electric fields coincident to said inferred scan time, and coherent and proportional to said inferred scan stimulus waveform for each said second plurality of scan electrodes; and a capacitive coupling means to couple said synthesized electric fields to said second plurality of electrodes inducing voltages which emulate time sequential touch events at said plurality of emulated touch locations animating said emulated gesture movement.
US09110537B2
An in-vehicle apparatus includes a plurality of operations sections, a detection section, and a cancellation section. The operation sections are configured to receive an operation by a user while driving of a vehicle and respectively include distortion detection elements that respectively transmit detection signals in accordance with loads generated due to the operation. The detection section detects the operation to the operation sections based on the detection signals. The cancellation section determines whether loads are generated in the operation sections in a same period based on the detection signals transmitted from the distortion detection elements and cancels the detection signals transmitted from the distortion detection elements in the same period when the loads are generated in the same period.
US09110527B2
A system, method, and device for increasing uniformity between displays incorporating components from different manufacturers. Incorporating components from different manufactures in different displays may cause the different displays to appear differently even under similar conditions. By modifying the operating parameters used to drive the display according to performance characteristics for various conditions, displays incorporating components from different manufacturers may be configured to produce a substantially similar picture under similar conditions. The various conditions may include stimulus information, such as temperature or touch activity.
US09110513B2
An information display apparatus with proximity detection performance contains a display device that displays image information, a sensor constituted of plural detection electrodes, and an adjusting device of detection resolution that adjusts the detection resolution to be detected based on a distance between the sensor and an object that is contacted to any one of the detection electrodes.
US09110512B2
An interactive input system comprises computing structure; and an input device detecting at least one electronic device displaying a recognizable pattern within a three-dimensional (3D) input space and providing output to the computing structure. The computing structure processes the output of the input device to recognize the pattern displayed by the at least one electronic device in the 3D input space; detect the state of the at least one electronic device; and modify image data by applying a transition to digital content associated with the displayed pattern based on the detected state of the at least one electronic device.
US09110506B2
A tactile feedback apparatus for a capacitive sensing device is comprised of a dielectric insulator having a surface. A finger receiving recess is defined in the surface. The finger receiving recess is configured for receiving a deflected portion of a finger. The finger receiving recess is comprised of a finger deflecting feature and a tactile feedback feature. The finger deflecting feature is coupled to the surface and structured such that a variety of finger sizes pressed into the finger receiving recess would deflect into a predictable and repeatable shape for affecting the capacitive sensing device in a substantially uniform manner. The tactile feedback element is coupled to the surface and disposed such that the tactile feedback element contacts the deflected portion of the finger to provide tactile feedback to the finger only when the finger is sufficiently deflected into the finger receiving recess to actuate the capacitive sensing device.
US09110502B2
Motion-sensing display apparatuses supported near a user's eye including partially transparent screens at least partially disposed within the user's field of vision, image generators positioned to display an image on a first side of the screen, motion capture devices positioned near the screen and configured to capture a user gesture occurring beyond the screen in the user's field of vision, and processors in data communication with the image generator and the motion capture device, the processors configured to execute computer executable instructions in response to the user gesture. In some examples, motion-sensing display apparatuses include cameras. In some further examples, image generators display user interfaces on screens.
US09110495B2
Techniques for utilizing two or more mobile devices equipped with projectors to generate a combined seamless user interfaces by stitching projection areas generated by the projectors.
US09110472B2
A moving robot and a method to build a map for the same, wherein a 3D map for an ambient environment of the moving robot may be built using a Time of Flight (TOF) camera that may acquire 3D distance information in real time. The method acquires 3D distance information of an object present in a path along which the moving robot moves, accumulates the acquired 3D distance information to construct a map of a specific level and stores the map in a database, and then hierarchically matches maps stored in the database to build a 3D map for a set space. This method may quickly and accurately build a 3D map for an ambient environment of the moving robot.
US09110467B2
The disclosure relates to a marine vessel having a control system for automatically steering the marine vessel for the purpose of aiding an angler who has hooked a fish. The control system includes a GPS unit for determining the orientation of the marine vessel, a sonar unit for determining the bearing of a fish, and an algorithm for minimizing the error between the two. The control system will execute steering commands in the propulsion system in order to minimize the error in order to aid the angler as he tries to land the hooked fish.
US09110452B2
A process modeling technique uses a single statistical model developed from historical data for a typical process and uses this model to perform quality prediction or fault detection for various different process states of a process. The modeling technique determines means (and possibly standard deviations) of process parameters for each of a set of product grades, throughputs, etc., compares on-line process parameter measurements to these means and uses these comparisons in a single process model to perform quality prediction or fault detection across the various states of the process. In this manner, a single process model can be used to perform quality prediction or fault detection while the process is operating in any of the defined process stages or states.
US09110451B2
Each of a host controller and a motor control apparatus included in a motor control system that drives a motor includes a step of determining, with respect to motor rotation state estimation information estimated based on an electric current and a voltage to the motor, whether an operation state of the motor is normal according to what kind of a relation an operation command output by the host controller and a detected motor position or motor speed have.
US09110447B2
A watch includes a main body and a sound input body. The sound input body includes a microphone, a signal transmitting coil unit, a power receiving coil unit, and a power receiving unit. The main body includes an interface unit, a signal receiving coil unit coupling the signal transmitting coil unit, a signal amplification unit, a power transmitting unit, a power transmitting coil unit, and a control unit. The microphone converts a voice signal input to an electric signal, which is transmitted to the control unit by the signal transmitting coils coupling with the signal receiving coils. The control unit executes corresponding function in response to the electric signal. The electric signal obtained by the control unit is transmitted to the power receiving unit by the power transmitting coils coupling with the power receiving coils to power the microphone.
US09110445B2
Control mechanism for a timepiece movement, including, in a housing in a main plate, a control stem that is movable in a longitudinal direction and including a groove cooperating with a stud comprised in a pull-out piece for actuating the pivoting of the pull-out piece on the main plate, this pull-out piece is held in position by a jumper spring, and the mechanism including a bridge cooperating with the main plate to confine the stem, and this bridge includes a housing in which there is a movable limiter piston, arranged to abut on one end of a trunnion comprised in the pull-out piece under the application of a force in a transverse direction substantially orthogonal to the longitudinal direction, to allow the release of the stem after a given travel of the limiter piston.
US09110443B2
Systems and methods for shear-corrected digital hologram acquisition, wherein the shear-corrected geometry is highly suited for two (or more) color operation with either broadband or laser illumination. An apparatus for shear-corrected recording of a spatially heterodyne hologram with broad-band or laser illumination includes: an illumination source; a beamsplitter optically coupled to said illumination source(s); a reference beam corner-mirror pair for translation and phase-shaping of the object beam optically coupled to the beamsplitter; an object optically coupled to the beamsplitter; a focusing lens optically coupled to both the reference beam corner-mirror pair and the object; and a digital recorder optically coupled to the focusing lens. A reference beam is incident upon the translating and phase-shaping corner-mirror pair, and the reference beam and an object beam are focused by the focusing lens at a focal plane of the digital recorder to form a spatially heterodyne hologram.
US09110433B2
An image forming apparatus includes a control unit that performs two types of stop operations in which an image bearing member is rotated or is not rotated after forming an image. The control unit selects the stop operation according to operation time of the image bearing member.
US09110430B2
A cleaning device for use with an image forming apparatus includes: a frame; and a cleaning member for removing a developer from an image bearing member (drum). The cleaning member includes: a blade portion contacted to the drum; and a flexible supporting member, the supporting member including one end portion where the blade portion is provided, another end portion including a portion-to-be-fixed, and a bent portion between the one end portion and the another end portion and a contact portion. When a distance between the portion-to-be-fixed and the drum in a longitudinal central side of the portion-to-be-fixed is D1, and a distance between the portion-to-be-fixed and the image bearing member in each of longitudinal end sides of the portion-to-be-fixed is D2, the distances D1 and D2 satisfy: D1≦D2.
US09110429B2
A controller determines a mode at a current time point, and corrects, on the basis of the determined mode and an elapsed time from a start time of the mode clocked by a timer to a current time point, an in-apparatus temperature detected by an in-apparatus temperature sensor on the basis of correction data so that the corrected temperature is calculated as an outside-air temperature.
US09110427B2
An image forming apparatus includes a pair of side walls disposed opposite each other; a driven unit supported between the side walls; a drive unit with drive transmission gears attached to one of the side walls and drives the driven unit; and a reinforcing member connecting the pair of side walls. One end of the reinforcing member is attached to the side wall opposite the other side wall to which the drive unit is attached and the other end is attached to the drive unit. The driven unit is an image forming unit including at least an image carrier. The image carrier includes a rotary shaft, both lateral ends of which are supported by the pair of side walls. A gear portion engaging the drive transmission gears of the drive unit is disposed on one end of the rotary shaft of the image carrier.
US09110418B2
A color image forming method, including: forming electrostatic latent image on electrostatic latent image bearing member; developing the image to form visible image with at least two toners containing releasing agent and selected from black, magenta, cyan and yellow toners; transferring the visible image to recording medium; fixing the transferred image thereon with fixing member having no releasing agent on surface thereof; and forming overcoat layer on the fixed image by polymerizing overcoat composition, wherein when lightness—L1, chromaticity—a1 and chromaticity—b1 according to L*a*b* color system of the fixed image formed with the at least two toners and lightness—L2, chromaticity—a2 and chromaticity-b2 of the fixed image after the overcoat composition is dropped at 0.4 mg/cm2 from height of 10 mm above the fixed image and the overcoat composition is removed after 10 seconds have passed are applied to the following formula (1), color difference ΔE* is 3.0 to 30.0: ΔE*=[(a2−a1)2+(b2−b1)2+(L2−L1)2]1/2 (1).
US09110416B2
An image heating device for heating a toner image while nip-conveying a recording material, in a nip, on which the toner image is carried, includes a heating member; and a pressing roller, including an elastic layer, for forming the nip in contact with the heating member. The elastic layer of the pressing roller includes a thermosetting silicon rubber containing a thermal conductive filler. The thermosetting silicon rubber includes pore portions formed with resin microballoons and a pore connecting portion for connecting the pore portions. The elastic layer has a thermal conductivity of 0.15 W/mK to 0.5 W/mK.
US09110404B2
An image forming apparatus includes a toner case, an apparatus main body, and a cover. The toner case includes a case main body, a shutter, and an operation part. The case main body has a discharge port discharging a toner. The shutter opens/closes the discharge port. The operation part is connected to the shutter. The operation part is movable between a port closing position where the operation part makes the shutter close the discharge port and interferes with the cover and an port opening position where the operation part makes the shutter open the discharge port and permits the cover to be closed. When the cover is closed in the state in which the operation part is located at the port closing position, the cover presses the operation part and the operation part moves from the port closing position to the port opening position.
US09110402B2
An information storage device installed in a removable device configured to be removably installed in an image forming apparatus body, includes: an information storage unit that stores information communicated between the image forming apparatus body and the removable device; a terminal that comes in contact with a body side terminal; and a substrate that holds the information storage unit and the terminal and includes a hole configured to be engaged with a protruding section installed in the image forming apparatus body. The terminal includes a plurality of terminals each including one of a plurality of metallic plates arranged in a transverse direction thereof. An earth terminal, which comes in contact with a body side earth terminal formed in the protruding section, is formed in the hole. The hole is disposed at a position sandwiched between two metallic plates among the plurality of metallic plates.
US09110400B2
A charging member includes a contact section and a supported section. The contact section is in contact with a charged body. The supported section is integrated with the contact section and is supported by a support member. The supported section has a lower hardness than the contact section.
US09110399B2
An optical writing device for forming an electrostatic latent image on a photoreceptor by exposing the photoreceptor to light modulated in accordance with image data. The optical writing device has: a substrate; a light-emitting-element array including a plurality of light-emitting elements supported by the substrate to be arranged in a main-scanning direction; and a light-receiving-element array substantially in parallel to the light-emitting-element array, the light-receiving-element array including a plurality of light-receiving elements supported by the substrate to be arranged in the main-scanning direction. For light-quantity measurement of one of the light-emitting elements, at least an output value output from one of the light-receiving elements of which center is located in a different position, with respect to the main-scanning direction, from a center of the one of the light-emitting elements is used.
US09110393B2
An image forming apparatus having a first motor for rotating a roller for transporting recording paper includes a second motor supplied with electric power from the same power line as the first motor, a driver circuit connected to the power line and generating driving electric power based on electric power from the power line to feed the driving electric power to the second motor, and a controller controlling, on detecting a jam of the recording paper and an open state of a cabinet cover, the driver circuit such that driving electric power is supplied from the power line to the second motor.
US09110386B2
A method comprises providing a semiconductor substrate having at least one layer of a material over the substrate. A sound is applied to the substrate, such that a sound wave is reflected by a top surface of the layer of material The sound wave is detected using a sensor. A topography of the top surface is determined based on the detected sound wave. The determined topography is used to control an immersion lithography process.
US09110378B2
An illumination optical system for projection lithography has an optical assembly for guiding illumination light to an object field to be illuminated in an object plane. The illumination optical system divides a bundle of the illumination light into a plurality of part bundles, which are allocated to various illumination directions of the object field illumination. The illumination optical system is configured in such a way that at least some of the part bundles are superimposed on one another in a first superimposition plane according to a first superimposition specification and in a second superimposition plane, which is spaced apart from the first superimposition plane, according to a second superimposition specification. The result is an illumination optical system, in which an influencing and/or a monitoring of an illumination intensity distribution over the object field is made possible, as far as possible without influencing an illumination angle distribution.
US09110372B2
Novel, wet developable anti-reflective coating compositions and methods of using those compositions are provided. The compositions comprise a polymer and/or oligomer having acid functional groups and dissolved in a solvent system along with a crosslinker and a photoacid generator. The preferred acid functional group is a carboxylic acid, while the preferred crosslinker is a vinyl ether crosslinker. In use, the compositions are applied to a substrate and thermally crosslinked. Upon exposure to light, the cured compositions will decrosslink, rendering them soluble in typical photoresist developing solutions (e.g., alkaline developers).
US09110365B2
An imaging apparatus includes an omnidirectional imaging unit that captures and generates an image of a visual field all around an axis as omnidirectional image data; an image converter that converts at least a part of the omnidirectional image data, which is generated by the omnidirectional imaging unit, to image data having a rectangular display area and thereby generates conversion image data; and a display unit that displays an image corresponding to the conversion image data, which is generated by the image converter. The omnidirectional image data forms an annular shape.
US09110356B2
A camera accessory is detachably mounted at a camera body that includes a first body contact point, a second body contact point, a third body contact point, a fourth body contact point and a fifth body contact point and detects disengagement of the camera accessory when the fifth body contact point sustains a signal level corresponding to a first truth value continuously over a length of time equal to or greater than a predetermined time length. In the camera accessory, the accessory-side communication control device executes control so as to ensure that the signal assuming a level corresponding to the first truth value is not continuously output from the fifth accessory contact point any longer than the predetermined time length while the operating voltage supply from the camera body is provided via the first accessory contact point.
US09110352B2
A high confinement nonlinear optical fiber is provided along with methods of parametric amplification for use thereof The nonlinear optical fiber may include a plurality of concentric layers which are configured to provide different guiding regimes to low-frequency and high-frequency components through transverse geometry and refractive index profiling, thus reducing waveguide dispersion. The resulting optical fiber provides a parametric device with phase-matching in any spectral region of interest, such that a fiber optic parametric amplifier (FOPA) implementing the optical fiber can amplify in any spectral window of interest. A narrow-band FOPA configured to minimize phase mismatching is also provided for use with the optical fiber, and may be implemented as a light source or a monochromator.
US09110347B2
A method of fabricating a display apparatus includes forming a lower electrode on a lower substrate, forming a partition structure and an ink-injection tube connected to one end of the partition structure, the partition structure including first partitions, and second partitions, and cell regions defined by the first and second partitions, covering the partition structure with an upper electrode, and injecting an electronic ink through the ink-injection tube to fill the cell regions of the partition structure.
US09110346B2
An electrochromic device includes: a substrate having an inner surface; at least one first electrode layer formed on the inner surface; at least one second electrode layer formed on the inner surface and spaced apart from the first electrode layer; and an electrochromic unit formed on the first and second electrode layers and including an electrochromic layer and an electrolyte layer that is in contact with the electrochromic layer. When a potential is applied between the first and second electrode layers, the electrochromic layer can undergo chemical reduction or oxidation reactions and change color.
US09110344B2
A pixel electrode and a direction control electrode capacitively coupled to the pixel electrode are provided in a pixel. A pixel thin film transistor is connected to a gate line, a data line, and the pixel electrode. A direction control electrode thin film transistor is connected to a previous gate line, a previous data lines or a next data line, and the direction control electrode. The gate lines are supplied with scanning signals, and each scanning signal includes first and second pulses in a frame. The first pulse of a scanning signal is synchronized with the second pulse of a previous scanning signal.
US09110340B2
An embodiment of the present invention discloses an array substrate comprising: a base substrate; a common electrode layer formed on the base substrate; a protective layer formed on the common electrode layer; and pixel electrodes formed onto the protective layer, wherein the base substrate is formed thereon with a plurality of protrusions parallel to each other, the common electrode layer is overcoated onto the protrusions, portions of the common electrode layer covering the protrusions are formed as protrusion electrode parts, and the pixel electrode comprises portions arranged alternately with the protrusion electrode parts. The embodiment of present invention also provides a liquid crystal panel comprising the above array substrate, as well as a liquid crystal display device.
US09110338B2
A mask for curing frame sealant and a liquid crystal display (LCD) panel manufacturing method are provided in the present invention. A transition region is formed in a joining area between a shading region and a transparent region. The shading region is adjacent to the transparent region and the transition region joins the shading region, the transition region includes at least two shading portions and a transparent portion. The shading portion and the transparent portion are alternatively arranged. When the mask is utilized for exposure, the irradiation transmittance in the transition region is lower than the irradiation transmittance in the transparent region and higher than the irradiation transmittance in the shading region.
US09110326B2
A liquid crystal display device (100) includes a liquid crystal display cell (10), a light-transmitting cover (20) having a lens portion (22) and disposed on a viewer side, a backlight (40) disposed on an opposite side to the viewer side, a light diffusion layer (38) disposed between the backlight (40) and the light-transmitting cover (20), and a refraction-index adjusting layer (28) that fixes the liquid crystal display cell (10) and the light-transmitting cover (20) to each other. A refraction index difference between the light-transmitting cover (20) and the refraction-index adjusting layer (28) is smaller than a refraction index difference between the light-transmitting cover (20) and air.
US09110313B2
There are provided a display in which a sealing section is prevented from being spread and the sealing section is allowed to be provided in a desired region, and an electronic unit including the display. The display includes: a substrate including a sealing region and a step section, the sealing region surrounding a display region, and the step section surrounding the sealing region from outside; a display layer provided in the display region; and a sealing section provided in the sealing region.
US09110310B2
This invention discloses a device comprising multiple functional layers with multiple energization elements formed on substrates, wherein at least one functional layer comprises an electrical energy source. In some embodiments, the present invention includes a component for incorporation into ophthalmic lenses that has been formed by the stacking of multiple functionalized layers.
US09110309B2
The disclosure relates to a method for selecting progressive ophthalmic lenses for a given frame and wearer, the progressive ophthalmic lenses having one area for distance vision and one area for near vision, said given frame having two recesses suitable for receiving a progressive ophthalmic lens, respectively, said two recesses defining a recess midplane. The method includes the following steps: a) fitting said wearer with said given frame; b) determining the position of a first point of intersection between a first direction of the gaze of said wearer in a distance vision posture and said recess midplane; c) determining the position of a second point of intersection between the gaze of said wearer in a near vision posture and said recess midplane; d) assessing the distance between said intersection points; and, e) selecting progressive ophthalmic lenses in which the progression length corresponds to said distance assessed between said intersection points.
US09110308B2
A five-beam laser device that is designed in a self-leveling way and includes three laser sources, wherein two laser beams created by the laser sources are each divided into two partial beams, wherein one of the partial beams in each case meets with the beam of the third laser source at a point P.
US09110302B2
An endoscope optical system has a first lens group having positive refractive power, an aperture diaphragm, a second lens group having negative refractive power and a third lens group having positive refractive group, the second lens group moving along an optical axis to perform focusing, the first lens group having a first lens having negative refractive power and a second lens having positive refractive power, and the optical system satisfying the following conditional equation: −5.0
US09110298B2
A naked-eye stereoscopic display apparatus satisfies θ=arctan {(Ax·px)/(Ay·py)}, GF=Bx·Lx/px, Ay≧2 and Bx≧2, Lx=α·px+β·py·tan θ, and GH=(α·px)2+(β·py)2. In these expressions, px is a pixel pitch in a horizontal direction, py is a pixel pitch in a vertical direction, Lx is a lens pitch of cylindrical lenses in the horizontal direction, θ is an inclination angle of cylindrical lenses, Ax and Ay are integers prime to each other, and α and β are integers. Bx is a minimum natural number in which a numeric value GF becomes an integer. When α0 is defined as the value of α that minimizes the numeric value GF, α0 is not a multiple of the number of types of color pixels. When Lx=δ·px is established, the naked-eye stereoscopic display apparatus satisfies tan θ=(7−δ)·(px/py) and 5.3≦δ≦5.4.
US09110295B2
A method includes defining a designation point on a target within a view area of a scope coupled to a firearm and determining an angular motion deviation of a muzzle of the firearm from the designation point. The method further includes initiating firing of the firearm when the angular motion deviation is below an acceptable level.
US09110294B2
A source light beam is split into an illumination beam and a highlight beam. The highlight beam can be controllably shaped into a shaped highlight beam based on a brightness analysis of an image to output. The illumination beam and the shaped highlight beam are combined and provided to an imaging device that generates the image using the combined beam. An array of reflectors, such as a MEMS mirror device, can be used in conjunction with a stacked rod array to generate the shaped highlight beam. The illumination beam and the shaped highlight beam can be combined using offset lenses or a polarizing beam splitter.
US09110293B2
An optical system for producing color images includes: an objective lens system having an entrance aperture; a multi-faceted prism positioned at the entrance aperture of the objective lens system and including at least a first face having a first optical filter formed thereon and a second face having a second optical filter formed thereon; and a monochromatic detector array positioned to receive light from the objective lens system. The multi-faceted prism intercepts light from a scene and splits a pupil of the objective lens system into two or more spectrally separated sub-images which are projected onto the monochromatic detector array.
US09110287B2
The catadioptric system includes a first imaging optical system collecting light from an object and a second imaging optical system causing the light from the first imaging optical system to form an intermediate image and to cause the light from the intermediate image to form an optical image. The first imaging optical system includes a first optical element including a first light transmissive portion and a first back reflective portion, and a second optical element including a second light transmissive portion and a second back reflective portion. The first light transmissive portion, the second back reflective portion, the first back reflective portion and the second light transmissive portion introduce the light from the object to the second imaging optical system. The second imaging optical system includes an aspheric lens having a negative refractive power on and around the optical axis and a positive refractive index in its peripheral portion.
US09110282B2
An optical imaging method based on a feedback principle in which the specific scan pattern is adapted according to the shape of the sample. The feedback approach produces nanometer-resolved three dimensional images of very small and moving features in live cells and in a matter of seconds. Images of microvilli in live cultured opossum kidney cells expressing NaPi co-transporter proteins with different GFP constructs and images of cell protrusions in a collagen matrix are produced with a resolution of about 20 nm. Along cell protrusions in three dimensional cellular adhesions could be identified to the extracellular matrix.
US09110281B2
This disclosure provides systems, methods and apparatus for masked reflective structures which can be integrated into display devices. In one aspect, masks and etch leading layers can be used to control the etching of a stack of layers to form masked reflective structures having a desired profile. In particular, tapered edges at a particular angle can be formed, and the resulting structures used in a roll-to-roll process to fabricate a device component.
US09110280B2
A device (110, 151, 200) with a viewable surface (201) including a plurality of transparent pedestals (210) having a reflective material (406) disposed on its sides (408) make smudges forming thereon unnoticeable by taking advantage of optical characteristics including contrast and the user's visual acuity. The pedestals (210) generally have a width (412) of less than 50 microns, a height (414) equal to twice the width (412), and a spacing (416) between adjacent pedestals (210) equal to the width (412). The device (110, 151, 200) may be an electronic device, and more particularly a portable electronic device such as a cell phone.
US09110276B2
A wide field-of-view infrared optical imaging system with extended spectral coverage into the 1.0 to 2.5 μm wavelength range. In one example, an optical imaging system includes an imaging detector sensitive to light in a wavelength range of at least 1.0 μm to 5.0 μm, and a plurality of lenses optically coupled together and configured to focus incoming light onto the imaging detector, the plurality of lenses each comprised of a material that is transparent to the light in the wavelength range of at least 1.0 μm to 5.0 μm, wherein a pupil of the optical imaging system is located external to the plurality of lenses between the plurality of lenses and the imaging detector.
US09110275B2
A zoom lens includes, in order from an object side to an image side, a first, a second, a third, a fourth and a fifth lens units respectively having positive, negative, positive, negative, and positive refractive powers. The first lens unit includes negative, positive, and positive lenses in order from the object side to the image side. The second lens unit includes negative, negative, and positive lenses in order from the object side to the image side. Each lens unit moves during zooming. The predetermined conditional expressions are satisfied.
US09110268B2
A combination of a pulling grip assembly and a fiber optic cable assembly for installing the fiber optic cable, including: a flexible grip having an open loop region for pull-force engagement and a closed region engaged with the strength member in a fiber optic cable assembly; a first heat shrunk member positioned about a portion of the distal end of the fiber optic cable assembly and the distal end of cable; and a second heat shrunk member positioned about a portion of the closed region of the flexible grip and the proximal end of the fiber optic cable assembly. A method of using the pulling grip assembly and a quick release pulling grip kit for installing fiber optic cable, as defined herein, are also disclosed.
US09110263B2
A multi-core plastic optical fiber is used for multi-channel communication purposes. An alignment tool comprising a light source, selective filter and a detachable alignment-tube having a guide notch is provided to map the individual cores of a multi-core plastic optical fiber and prepare the connection of optical transceivers to both exposed ends of a pre-cut length of fiber. The alignment method results in a pre-cut length of fiber having alignment-tubes with guide notches secured to both ends. Transceiver guide projections mate to the notches, creating a complete optical multi-path between the transceiver active elements through the fiber cores. An automatic method of assembling optical transmitters to a multi-core fiber and mating optical receivers uses no alignment tools and tubes. This method dictates a specific placement of the optical transmitters in relation to the cores and receivers, assigning each transmitter to a preferred receiver based on detected light signal criteria.
US09110258B2
An optical fiber coupling connector includes a circuit board, light-emitting modules, light-receiving modules, an optical coupling module, a receiving member, and optical fibers. The optical coupling module includes a main body and converging lenses. The main body has a first optical surface, a second optical surface perpendicular to the first optical surface, and a reflection surface oblique relative to the first and second optical surfaces. The converging lenses are formed on the first optical surface and are aligned with the light-emitting modules and the light-receiving modules. The receiving member includes a front end portion and a rear end portion at opposite sides and defines through holes extending from the front end portion to the rear end portion. The receiving member is coupled with the main body, and the front end portion faces the second optical surface. The optical fibers are received in the through holes.
US09110252B2
A device for shifting the imaging axis of a microscope for inspecting endfaces of a fiber-optic connector having multiple rows of endfaces has a supporting body for receiving a microscope; a first swinging lever mounted on top of the supporting body and rotatable about a first swinging axis perpendicular to the imaging axis of the microscope; a first connecting piece extending from the first swinging lever towards the imaging axis; a second swinging lever pivoted on the first connecting piece and rotatable about a second swinging axis perpendicular to the first swinging axis; and a fitting tip connected to the second swinging lever for interfacing with the fiber-optic connector. Using two sets of biasing means and adjustment drivers, the imaging axis passing through the supporting body and the fitting tip can be shifted in two mutually perpendicular directions to selectively align with any endface of the fiber-optic connector.
US09110235B2
The present application relates to retroreflective sheeting that is capable of use in a license plate and that can be accurately read and/or detected by an ALPR system. The retroreflective sheeting is a microsphere-based retroreflective sheeting that provides reduced retroreflectivity at high entrance angles. The retroreflective sheeting can also be a microsphere-based retroreflective sheeting that exhibits reduced retroreflectivity of incident infra-red light from high entrance angles and substantially unaffected retroreflectivity of incident visible light from entrance angles in the vicinity of the normal.
US09110231B2
An inner focus lens system, in order from an object side, comprising: a first lens unit including a most-object-side negative first lens element; a positive second lens unit; and a negative third lens unit, wherein an aperture diaphragm is included, the first lens unit, the third lens unit, and the aperture diaphragm are fixed relative to an image surface in focusing, the second lens unit moves relative to the image surface in the focusing, and the conditions: BF/Y<1.7 and TH/f>1.6 (BF: a distance from an apex of an image-side surface of a most-image-side lens element to the image surface, Y: a maximum image height, TH: a distance from an apex of an object-side surface of a most-object-side lens element to the apex of the image-side surface of the most-image-side lens element, f: a focal length of the lens system) are satisfied.
US09110227B2
The motor drive apparatus includes a driven member, a stepping motor to drive the driven member, a driver to produce a drive signal for driving the stepping motor and whose signal value periodically changes, a memory to store data for setting a reference signal value as the signal value and a target movement amount of the driven member for each one-step drive of the stepping motor to be driven according to the drive signal having the reference signal value, and a detector to detect an actual movement amount of the driven member for each one-step drive of the stepping motor actually driven according to the drive signal having the reference signal value. The driver changes the signal value of the drive signal from the reference signal value to another signal value so as to reduce difference between the target movement amount and the actual movement amount.
US09110225B2
A metrology system serves to examine an object arranged in an object field using EUV illumination light. An illumination optics of the metrology system has a collector mirror which is arranged in the beam path directly downstream of an EUV light source. Downstream of the collector mirror, less than three additional illumination mirrors are arranged in the beam path between the collector mirror and the object field. An intermediate focus is arranged in the beam path between the collector mirror and the additional illumination mirror. The metrology system further includes a magnifying imaging optics for imaging the object field into an image field in an image plane. As a result a metrology system is obtained which comprises an illumination optics that ensures an efficient illumination of the object field by means of illumination parameters which are well adapted to the illumination situation of current EUV projection exposure apparatuses.
US09110221B2
In a photonic waveguide, there is provided an undercladding layer and a waveguide core, having a cross-sectional height and width, that is disposed on the undercladding layer. The waveguide core comprises a waveguide core material having a thermo-optic coefficient. A refractive index tuning cladding layer is disposed on top of the waveguide core. The refractive index tuning cladding layer comprises a refractive index tuning cladding material having an adjustable refractive index and an absorption length at a refractive index tuning radiation wavelength. A thermo-optic coefficient compensation cladding layer is disposed on top of the refractive index tuning cladding layer. The thermo-optic coefficient compensation cladding layer comprises a thermo-optic coefficient compensation material having a thermo-optic coefficient that is of opposite sign to the thermo-optic coefficient of the waveguide core material. The thermo-optic coefficient compensation cladding layer provides at least partial compensation for the waveguide core thermo-optic coefficient.
US09110217B2
An electronic device is provided and includes a substrate assembly comprising a first area and a frame at a periphery of the first area and a lens, which is configured to be affixed to the first area, and which comprises a second area and a curved area at a periphery of the second area. The curved area is separated from the frame by a gap and is configured to reflect light across the gap to hide the gap from an observer looking into the gap.
US09110208B2
An autostereoscopic three-dimensional image display device including a first light guide plate having a first surface and a second surface, the second surface being provided with a first prism changing a path of light input from a first light source on a side of the first light guide plate toward the first surface; a second light guide plate having a third surface and a fourth surface, the fourth surface being provided with a second prism changing a path of light from a second light source on a side of the second light guide plate toward the third surface; a barrier film between the first and second light guide plates and interrupting part of light from the first light guide plate; and a lenticular film above the third surface of the second light guide plate and refracting a path of light input from the second light guide plate.
US09110206B2
A light guide plate includes a light incident surface for incident light, a light emitting surface for emitting the light, and microstructures formed on the light emitting surface to collimate the light.
US09110187B2
A sensor assembly having improved characteristics for use in surveying a subterranean structure includes a divergence sensor for positioning at or below a ground surface, where the divergence sensor includes a container containing a material and a pressure sensor immersed in the material. In addition, the sensor assembly includes a single-component seismic sensor that is external to the container of the divergence sensor.
US09110169B2
A collision mitigation system is proposed which makes use of forward mounted long range ladar sensors and short range ladar sensors mounted in auxiliary lamps to identify obstacles and to predict unavoidable collisions therewith, and a duplex radio link in communication with secondary vehicles, and a number of external airbags deployable under the control of an airbag control unit, to reduce the forces of impact on the host vehicle, secondary vehicles, and bipeds and quadrupeds wandering into the roadway. A suspension modification system makes use of headlight mounted long range ladar sensors and short range ladar sensors mounted in auxiliary lamps to characterize the road surface, identify road hazards, and make adaptations to a number of active suspension components, each with the ability to absorb shock, elevate or lower the vehicle, and adjust the spring rate of the individual wheel suspensions.
US09110160B2
The instant disclosure concerns an antenna system and method for location-finding of a wireless communication device. A cellular multimode antenna is configured to analyze pilot signals from base station towers across a plurality of antenna modes. Information corresponding to the received signals and each antenna mode is analyzed to determine a location fix. In certain optional embodiments, the location fix determined by the cellular multimode antenna is used to determine an optimal mode for a second GPS modal antenna, such that the selected mode of the GPS modal antenna provides optimum signal quality with the global positioning system. In this regard, the cellular multimode antenna estimates the location of the device, and a mode for the GPS modal antenna is selected based on the location fix such that the GPS antenna is capable of quickly determining a precise position of the device.
US09110153B2
A device for measurement by means of a light ray is equipped with a covering device for reducing stray light. The device comprises an array of lenses along an optical axis; a prism attached to one of the lenses with a slanted surface for coupling of the light ray incident from a light source placed lateral to the optical axis, onto the optical axis, so that the light ray can pass through the array of lenses along the optical axis; a receiver for receipt of a share of the light ray reflected by an object; and a covering device for at least one area of the prism that scatters a share of the light ray as stray light to the receiver.
US09110149B2
A device includes a radar signal detector that can determine a signal strength of a police radar signal and a direction of a source of the police radar signal. Additionally, the device includes a display in communication with the radar signal detector that provides a single display region having a visual appearance which varies based on both the direction and on the signal strength.
US09110147B1
An unknown location of a transmitter of interest is determined based on wireless signals transmitted by both the transmitter of interest and a reference transmitter positioned at a known location. The transmitted signals are received at a plurality of non-earthbound platforms each moving in a known manner, and phase measurements for each received signal are used to determine the unknown location.
US09110130B2
A probe head of vertical probe card and a manufacturing method of a composite board thereof are provided. The probe head includes guide plate, composite board, and probe pin. The composite board includes first board layer and second board layer which are laminated together by joining operation. The composite board further includes through hole which is made by drilling and passed all the way through the first board layer and the second board layer. The friction coefficient of the first board layer is less than that of the second board layer, and the thermal expansion coefficient of the second board layer is less than that of the first board layer. The probe pin is penetrated all the way through the through hole of the composite board. By this, friction between the probe pin and composite board is reduced so as to stabilize the position of the probe pin.
US09110121B2
A spinning current Hall sensor configured to provide a sequence of input signals in response to a bias current being applied to a sequence of terminals of Hall sensing elements of the Hall sensor, the terminals of the Halls sensing elements configured to be interconnected in a sequence of configurations between a bias current supply and ground, with the bias current supply being connected to and applying the bias current to a different one of the terminals of each configuration. A chopping circuit demodulates the sequence of input signals to provide a corresponding sequence of demodulated positive and negative signals, with a residual offset calibration signal for the spinning current Hall sensor being based on the sequence of demodulated positive and negative signals.
US09110112B2
An occupant sensor device includes a sensor body unit disposed in a base part of a seat in a vehicle, and an occupant detection device. The sensor body unit is divided into at least two parts, such as a first sensor part and a second sensor part, where the first sensor part is positioned in front of the second sensor part. Based on a capacitance between the sensor body unit and a vehicle body, the occupant detection device detects an occupant type of an occupant that is seated on the seat. In particular, the occupant detection unit is able to detect the occupant type based on a first capacitance provided by the first sensor part, a second capacitance provided by the second sensor part, and a total capacitance, which is a total of the first capacitance and the second capacitance.
US09110111B1
Methods and systems to determine a final value of random telegraph noise time constant and magnitude
A method includes, for a device and at each of a plurality of sampling frequencies, measuring a parameter of the device to generate a plurality of signals and each signal represents a time series of values of the parameter. Further, the method includes for each of the plurality of signals, identifying at least two stable states in the time series for each signal. Still further, the method includes determining a time constant associated with each stable state of each signal, determining a relationship between the time constants of each stable state and sampling frequency, and computing a final time constant value for each steady state by computing a derivative of the time constants as a function of sampling frequency relationship and comparing the derivative to a threshold.
US09110110B2
Bidirectional 3 phase power meter for compensating reverse load flow and method for metering thereby
The present invention relates to a bidirectional 3 phase power meter for compensating reverse load flow and a method for metering thereby. According to the present invention, there is provided a bidirectional 3 phase power meter for compensating reverse load flow which allows calculating power receiving and power transmitting apparent power and power factor using the detected voltage/current and a method for metering thereby.
US09110107B2
A battery test circuit for testing batteries in a working circuit having a plurality of batteries includes a DC step up converter. The DC step up converter may be selectively interconnected between a first one of a plurality of batteries and a second one of a plurality of batteries, to draw a test current from the first battery and to supply current at an elevated voltage to the second battery. The test circuit further includes an indicator output for providing a signal indicative of whether the first battery provides the test current substantially at its rated voltage.
US09110105B2
A capacitor component is adapted for capacitive coupling to an electrical power apparatus in which a PD is suspected, such as a shielded power cable; and an impedance transformance device has an input side connected directly to the capacitor component. Together the two components are used as a sensor to pick up and convey PD signals to a PD signal-analyzing system. Although the two components inherently form a classic high-pass RC filter, in accordance with the invention the input impedance at the capacitor side is much greater than the output impedance at the signal-analyzing system side. The effect is to pass much more of the lower frequency components of the PD signal for analysis by the PD signal-analyzing system than if the tranformance device were not included.
US09110101B2
A system for intrusion detection in a field area network where data is transmitted via packets, includes a processor for analyzing the packets to ascertain whether the packets conform to a sets of rules indicating an intrusion, and a database for storing an alert indicating an intrusion if the packets conform to at least one rule in the sets. The sets of rules are for field network layer data, internet protocol traffic data and field area application traffic data. A method for detecting intrusion in a field area network where data is transmitted via packets, including analyzing the packets to ascertain whether the packets conform to the sets of rules, and storing an alert indicating an intrusion if the packets conform to at least one rule in the sets of rules.
US09110092B1
This invention relates to multi-purpose probe-based apparatus, and to methods for providing images of surface topography, and detection and quantitative mapping of local mechanical and electromagnetic properties in non-resonant oscillatory mode. These methods may include filtering of incoming probe signals. These incoming probe signals provide time deflection curves, parts of which are used for the control of scanning and collection of data that reflects sample adhesion, stiffness, elastic modulus and viscoelastic response, electric and magnetic interactions. These methods permit adaptive choice of an AFM's deflection set-point, which allows imaging at the contact repulsive force for precise surface profilometry, as non-resonant oscillation brings tip and sample into intermittent contact. These methods permit choosing a desired deformation model that allows an extraction of quantitative mechanical properties including viscoelastic response from deflection curves. These methods also permit local quantitative measurements of tip-sample current and detection of surface potential, capacitance gradients and piezoresponse in non-resonant oscillatory mode. The stable thermal environment reduces apparatus thermal drift and improves apparatus performance.
US09110085B2
The invention generally relates to methods of measuring cleaved von Willebrand factor (VWF) fragments. More specifically, the invention relates to methods of measuring the ability of a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) to cleave VWF in vivo. The invention also relates to methods of using various animal models which demonstrate ADAMTS13 activity similar to that of a human. The invention further relates to methods of measuring the cleavage products of rVWF in mammals, particularly in humans and in human plasma.
US09110083B2
Biomarker proteins that can be used in the diagnosis of early-stage ovarian cancer (OC) are described. The biomarker panels not only permit the distinction of patients with ovarian neoplasia (benign or malignant) from normal subjects, but they also allow the identification of patients with early-stage (stage I/II) ovarian cancer from those patients with benign ovarian tumors or normal individuals. The invention additionally provides methods for detecting and treating various cancers, including cancer of the ovary using OC-related molecules.
US09110081B2
Methods for preventing IBS, reducing the likelihood of developing IBS and/or treating IBS by administering COT inhibitors and/or COT neutralizers to a subject in need thereof are described. Methods of eliciting a specific immune response and methods of vaccinating a subject to prevent IBS or to reduce the likelihood of developing or having IBS are also provided. Methods of diagnosing IBS by detecting the presence or absence of COT or a COT marker in a subject are described.
US09110080B2
The present invention relates generally to a methodology for assaying the binding of a peptide to an individual, specific, soluble HLA molecule using fluorescence polarization. The peptides utilized in the method may be identified by indirect methods utilizing T lymphocytes, or by a direct method of epitope discovery described herein.
US09110079B2
A method and a kit for establishing an in vitro prognosis on a patient exhibiting SIRS, the method comprising: (i) measuring the level of expression of the CX3CR1 gene in vitro from the biological material of a patient sample by bringing into contact said sample with a specific reagent of the CX3CR1 gene; and (ii) comparing the expression level of the CX3CR1 gene of the patient to a predetermined expression threshold; wherein (iii) if the expression level of the CX3CR1 gene of the patient is less than the predetermined expression threshold, the survival prognosis of the patient is poor, and if the expression level of the CX3CR1 gene of the patient is greater than the predetermined expression threshold, the survival prognosis of the patient is good.
US09110077B2
The invention concerns a method for identifying a ligand capable of selectively modulating a functional cascade involving a target, and uses thereof for high-throughput screening of molecules of interest, in particular therapeutic (medicine). Said method comprises at least the following steps: a) identifying an antibody or an antibody fragment comprising at least one of the variable domains of an immunoglobulin chain, capable of binding to said target and modulating said functional cascade involving said target; b) screening from a bank of molecules, ligands modulating the bond between said target and the antibody or antibody fragment identified in a); and c) identifying among said modulating ligands obtained in b), those capable of modulating said functional cascade.
US09110061B2
The present invention refers to the use of gene sequences or portions thereof characterized in that the same belong to the classes of in vitro and ex vivo induced, repressed or conserved genes in Mycobacterium tuberculosis currently infected human macrophages and to corresponding peptides or consensus peptides or proteins for the preparation of specific bio-markers for the diagnosis and prevention of active or latent disease.
US09110059B2
A bio-pin is provided. The bio-pin can be used for cell transfer and treatment, cell tracing, and targeting of specific tissues and cells using a peptide-based complex in which a cell-penetrating peptide or a cell-adhesive peptide is bound to one or both ends of a cell membrane protein, and used in a molecular imaging system, a medical appliance, and the like.
US09110058B2
A porous solid phase for binding assay that enables a test sample such as whole blood to be analyzed promptly, conveniently, accurately, and inexpensively without requiring a pretreatment, and a binding assay method using said porous solid phase are disclosed. At least one surfactant is incorporated into the porous solid phase for binding assay prior to addition of a test sample, the at least one surfactant being selected from the group consisting of (A) a sugar-containing surfactant that comprises a compound shown by a general formula (I), (B) a sugar-containing surfactant that comprises a sucrose fatty acid ester wherein the constituent fatty acid has 5 to 14 carbon atoms, and (C) a steroid surfactant.
US09110052B2
A biological information acquisition method for acquiring information on a living body on a basis of a quantified value of a physiologically active substance originated from the living body, includes a step of collecting the physiologically active substance from a body surface of the living body.
US09110051B2
The present invention provides a screening method for identifying test agents that modulate cell membrane cholesterol activity. The modulating activity of the test agents may be measured using lytic compounds, which cause cell lysis or increases in cell permeability in response to cell membrane cholesterol levels. The invention further provides therapeutic agents that are identified using the screening method. The therapeutic agents either increase or decrease the cell membrane cholesterol activity, cholesterol concentration and/or both in vivo and/or in vitro.
US09110040B2
An exhaust gas measurement device includes a pressure regulator for keeping a pressure of sample gas in a sensor flow line or a bypass flow line to be a set pressure value, a flow rate sensor provided on the bypass flow line for measuring a flow rate of the sample gas flowing through the bypass flow line, and an attention attracting part for displaying that the flow rate of the sample gas is reduced in the case where the flow rate measurement value measured by the flow rate sensor becomes equal to or smaller than an attention attracting flow rate value larger than a pressure controlling limit flow rate value by a predetermined value, the pressure controlling limit flow rate value being a lower limit flow rate value that is pressure-controllable by the pressure regulator.
US09110037B2
Disclosed are methods and apparatus for performing inspection or metrology of a semiconductor device. The apparatus includes a plurality of laser diode arrays that are configurable to provide an incident beam having different wavelength ranges. At least some of the laser diode arrays form two dimensional stacks that have different wavelength ranges from each other. The apparatus also includes optics for directing the incident beam towards the sample, a detector for generating an output signal or image based on an output beam emanating from the sample in response to the incident beam, and optics for directing the output beam towards the detector. The apparatus further includes a controller for configuring the laser diode arrays to provide the incident beam at the different wavelength ranges and detecting defects or characterizing a feature of the sample based on the output signal or image.
US09110036B2
Disclosed is an ECA probes assembly capable of providing reliable and durable ECA inspections of dovetail slots without the use of an external guiding mechanism. The design combines a novel universal probe manipulator with a probe support suited for a wide range of probe supports which fit a rage of turbine disks. The probe support embodies a rigid yet expandable core, exerting a force pushing the array probe against the inner cavity of the dovetails. The pushing force is strategically located in critical areas of the dovetail leading to array probe to be self-guiding into the dovetail, and to provide optimum performance with consistent and stable lift-off.
US09110034B1
Night vision devices utilize image intensifier tubes to see in low light conditions. A man-portable tester allows an operator to check for defects and determine the image resolution of the image intensifier tube quickly and easily without a power source or a darkened room.
US09110027B2
The present invention relates to a method, device, and kit for analyzing a sample for determining the presence or amount of an analyte, particularly carbohydrate, more particularly sugar, in the sample using a fabric.
US09110022B2
Methods and systems for detecting radiation for example, terahertz radiation, with the aid of acoustic signal generation and detection include: directing an optical beam into a volume of gas; ionizing at least a portion of the volume of gas with the optical beam to produce a plasma; and detecting an acoustic signal produced from an interaction of a radiation wave with the plasma. The methods and systems are particularly adapted for remote detection of chemicals, biological substances, and explosives, among others. The capability of the methods and systems can be enhanced by employing multi-color laser excitation to produce the plasma and varying the time delay between the multi-color pulses.
US09110011B2
Disclosed are a remote measurement system and method for pesticide fog distribution and drifting tendency in aerial pesticide application, which relate to the technical field of hazardous substance monitoring. The system comprises: a collection module, used for collecting infrared radiation in a detected area, and enabling the infrared radiation to be incident on an optical module; the optical module, used for obtaining, according to the incident infrared radiation, an infrared imaging spectrum in the detected area where a pesticide fog cloud cluster is distributed, and sending the infrared imaging spectrum to a processing module; the processing module, used for analyzing the infrared imaging spectrum, identifying the pesticide fog cloud, obtaining a concentration image of the pesticide fog cloud through inversion, and predicting a drifting tendency of the pesticide fog according to the concentration image. The system and method of the present invention can comprehensively reflect the drifting condition of the pesticide fog in the air in real time, and can obtain the concentration and components of the pesticide fog. The method and system improve the pesticide application efficiency, and prevent damages on the environment and residential areas while saving the cost.
US09109999B2
A method of performing transducer self-diagnostics and self-healing on an array of sensor transducers bonded to a structure for health monitoring includes measuring impedance to detect whether a transducer is missing, or a connection is damaged. Pitch-catch signals generated between one or more pairs of transducers are analyzed for detecting defects according to selected criteria of defect size and location to determine whether the sensors are damaged or partially/fully disbonded. Based on the resulting map of operational transducers, signal transmission paths are added/extended between additional pairs of transducers to maintain inspection coverage of the structure according to the selected criteria.
US09109988B2
A corrosion sensor includes an insulating substrate, a thin film of a first metallic material formed on the substrate; and an array of areas what includes a second metallic material provided at the surface of the thin film. A method for manufacturing such a sensor is also disclosed. An exemplary embodiment is disclosed in which the thin film is patterned to define a number of tracks, the resistance of which can be monitored in order to determine the degree to which the thin film has corroded.
US09109978B2
A light hood for a fiber identifier tool that includes a head portion having interior photo detectors, a slot for receiving an optical fiber to be tested, and a clamp mechanism for urging the fiber to bend in the vicinity of the photo detectors when the mechanism is operated. The hood has a generally T-shaped body that defines a lower hood portion arranged to engage the clamp mechanism and operate the mechanism when the lower hood portion is pulled downward by a user. An upper hood portion of the body is configured so that when the lower hood portion is engaged with the clamp mechanism and pulled downward, the upper hood portion descends to cover the head portion of the tool including the slot. Outside light is then blocked from entering the slot and reaching the photo detectors whenever a fiber is tested by the tool, thus preventing false indications.
US09109971B2
A respiratory condition analysis apparatus includes a respiratory signal acquisition section configured to acquire a time-series respiratory signal including respiratory sound of a living body, a respiratory segment identification section configured to identify a respiratory segment that is a time segment including the respiratory sound in the respiratory signal, a feature value generation section configured to generate a predetermined feature value of the respiratory signal for the identified respiratory segment, and a respiratory abnormality degree generation section configured to generate a degree of abnormality of the respiratory sound included in the respiratory signal on the basis of the feature value.
US09109959B2
A method is provided for measuring a resistance value of a resistive component, which provides for connecting a pull up resistance, in series to the component and supplying a first voltage value to a free end of the pull up resistance and a second lower voltage value to a free end of the component, monitoring a signal indicative of a voltage value between the component and the pull up resistance, determining the difference between the monitored signal and a generated PWM signal having a high voltage value and low voltage value, integrating the difference, obtaining an output signal, varying a duty cycle of the PWM signal based on the variation over time of the output signal, acquiring a duty cycle of the PWM signal, and determining the resistance value of the resistive component based on the duty cycle value and of the pull up resistance value.
US09109955B2
First spectral data (spectral transmittance) of a printed object, and second spectral data (spectral reflectance) of the printed object are obtained. Further, third spectral data (spectral radiance distribution) of a transmissive light source, and fourth spectral data (spectral radiance distribution) of a reflective light source are obtained. Then, using the first, second, third and fourth spectral data, colorimetric value data of the printed object in a given observational environment is calculated.
US09109952B2
An electronic device having one or more sensors is provided. The sensors may include any suitable type of sensor that emits or receives radiation (e.g., light waves) from the environment. The electronic device may include openings through which radiation may reach the sensors while keeping the sensors hidden from view. In some embodiments, the sensors may be placed underneath an opening used for an audio receiver such that radiation is piped to the sensors using a light path or a chamfered surface along the opening. In some embodiments, the sensors may be embedded in a screen such that the radiation emitted by the sensors exits the screen instead of being reflected on the screen. In some embodiments, the sensors may be placed along the periphery of the display, such that access to the sensors is provided via discontinuities in a gasket used to couple the display to the electronic device.
US09109951B2
A sample cell can be designed to minimize excess gas volume. Described features can be advantageous in reducing an amount of gas required to flow through the sample cell during spectroscopic measurements, and in reducing a time (e.g. a total volume of gas) required to flush the cell between sampling events. In some examples, contours of the inners surfaces of the sample cell that contact the contained gas can be shaped, dimensioned, etc. such that a maximum clearance distance is provided between the inner surfaces at one or more locations. Systems, methods, and articles, etc. are described.
US09109950B2
A method for correcting spatial response for an imaging Fourier transform spectrometer comprises the following steps: a prior step of calculation of the equalization parameters comprising a gain and an offset from data forming calibration scenes; a step of determination of equalization coefficients at a so-called pseudo superpixel level determining the gains and offsets at macropixel level from the data from a raw image that are collected by the imaging spectrometer in image mode, and gains and offsets determined in the prior step; and a step of equalization at pseudo superpixel level, applying the equalization coefficients to a macropixel from an acquisition in the interferogram mode of the imaging spectrometer in order to restore an equalized interferogram.
US09109948B2
A method and system for coupling optical signals into silicon optoelectronic chips are disclosed and may include coupling one or more optical signals into a back surface of a CMOS photonic chip in a photonic transceiver, wherein photonic, electronic, or optoelectronic devices may be integrated in layers on a front surface of the CMOS photonic chip. Optical couplers, such as grating couplers, may receive the optical signals in the front surface. The optical signals may be coupled into the back surface of the chips via optical fibers and/or optical source assemblies. The optical signals may be coupled to the optical couplers via a light path etched in the chips, which may be refilled with silicon dioxide. The chips may be bonded to a second chip. Optical signals may be reflected back to the optical couplers via metal reflectors, which may be integrated in dielectric layers on the chips.
US09109940B2
An apparatus includes a probe configured to be mounted in a tank for at least partial immersion in a liquid. The probe has a body disposed inside the fuel tank. A capacitance-to-digital (CDC) circuit is disposed on the probe in the tank, such that the CDC is disposed inside the fuel tank and is operably connected to the body.
US09109938B2
A sensing device includes at least one electrode pair (2, 3, 4) and one sensing circuit (140) connected to the electrode pair (2, 3, 4). The sensing circuit (140) switches the value of its own output voltage when a substance establishes contact across the electrodes (2, 3, 4). The device further includes one output circuit (180) connected to the output of the sensing circuit (140) and adapted to provide an output signal (s7) representative of the presence of a substance across the electrode pair (2, 3, 4). The device also allows the output signal to take different voltage and/or current and/or frequency values, in particular such that values can be discerned which are representative of the presence or level of substances and/or representative of faults of the device.
US09109933B2
An electromagnetic flowmeter includes a yoke of a solenoid unit, which is accommodated in the interior of a body. The yoke is U-shaped in cross section, with a pipe unit including a measurement conduit being arranged in the interior of the yoke. One end portion and another end portion of the measurement conduit are formed with true circular shapes in cross section, whereas an intermediate portion thereof between the one end portion and the other end portion is formed with an oval shape in cross section. On the measurement conduit, cross-sectional straight line portions thereof, which are formed in the intermediate portion, are arranged in a vertical direction. Coils of the solenoid unit and excitation plates are arranged in facing relation to the cross-sectional straight line portions.
US09109929B2
A fluid flow conditioning conduit for a fluid flow control gate which generates a conditioned fluid flow coupled to a flow meter which measures the velocity of the conditioned fluid flow allowing calculation of the volume of the conditioned fluid flow.
US09109926B2
A blood glucose meter having a compact housing, a display unit disposed on the housing, the display unit including a display light source to illuminate the display unit, an input unit disposed on the housing, the input unit configured to provide input functions for the blood glucose meter, and a power source provided within the housing for providing power to the blood glucose meter, where the housing includes a port integrated on said housing configured to receive a blood glucose test strip, and corresponding methods of measuring blood glucose meter is provided.
US09109915B2
An approach for generating one or more personalized travel routes based on recorded routes and calculated routes is disclosed. An apparatus and method determines to generate at least one intersection point between at least one calculated route and at least one recorded route, wherein the at least one calculated route and the at least one recorded route include one or more common endpoints, and cause a generation of at least one personalized route by causing a combination of one or more segments of the at least one recorded route with one or more other segments of the at least one calculated route based, at least in part, on the at least one intersection point. The apparatus and method to determine the personalized route can cause a filtering of the at least one recorded route based on at least one filtering criterion to determine one or more candidate recorded routes.
US09109914B2
A method and system for calculating an energy efficient route is disclosed. A route calculation application calculates one or more routes from an origin to a destination. For each of the routes, the route calculation application uses impedance factor data associated with each segment in the route. The impedance factor is calculated using probe data when the probe data is available for a road segment. When probe data is unavailable, the impedance factor is calculated using machine learning techniques that analyze the results of the impedance factor classifications for road segments having probe data.
US09109906B2
Disclosed is a route evaluation device that enables traveling along a route in consideration of an operation of the driver of another vehicle, and can realize a safer traffic environment. A route evaluation device includes a route candidate generation section that generates route candidates of a host-vehicle, a route prediction section that predicts routes of another vehicle, a classification section that classifies the interference states of the route candidates of the host-vehicle and the predicted routes of another vehicle into a plurality of interference forms, and a route evaluation section that evaluates the routes of the host-vehicle on the basis of the interference forms classified by the classification section.
US09109902B1
A monitoring device with a pedometer preferably comprises an article, an optical sensor, an accelerometer, a short range wireless transceiver, and processor. The optical sensor preferably comprises a photodetector and a plurality of light emitting diodes. A sensor signal from the optical sensor is processed with a filtered accelerometer output signal from the accelerometer to generate a pedometer function.
US09109894B2
The invention relates to integrated circuits, and more particularly, to systems, devices and methods of integrating a gyro sensing circuit with a gyroscope to detect a shock or a disturbance, and accurately differentiate rotation-based sense signals from noises introduced by the shock or disturbance. The gyro sensing circuit may be implemented in a differential or non-differential demodulation scheme, and comprises at least one demodulation unit and a peak detector. The at least one demodulation unit demodulates a gyro output signal provided by the gyroscope with a reference signal. In a demodulated gyro output signal, a shock signal or a gyro disturbance signal is substantially isolated out from interested gyro sense signals that are used to sense a rate of rotation. A peak detector samples the modulated gyro output signal, determines whether the signal exceeds a threshold level VTH and outputs a shock flag indicating a corresponding determination result.
US09109888B2
A light emission reference signal, the timing of which is adjusted by a first delay time control circuit, is input as a timing adjustment signal to a light emitter driver. The light emission reference signal, which is delayed by a second delay time control circuit, is output as an offset signal. The offset signal and a light emission timing signal from the light emitter driver are input to a timing correction phase comparator, and a phase comparison result is output from the timing correction phase comparator. The phase comparison result is input to a timing correction control logic circuit, and a delay adjusting signal based on the phase comparison result is output from the timing correction control logic circuit. The delay adjusting signal is input to the first delay time control circuit, whereby the timing of the light emission reference signal is adjusted.
US09109884B2
A method for manufacturing an electric resistance steel pipe having a good toughness at a welded portion is provided, the method being capable of stably manufacturing an electric resistance welded steel pipe having a desirable toughness at a welded portion although a steel strip serving as a base material has a dimensional variation. Groove shapes and are applied to edges and of an open pipe, an edge shape monitor continuously captures images of the edges and immediately before electric resistance welding, and the captured images are input to an arithmetic processing unit for image processing.
US09109881B2
Methods of capturing improved-contrast mode spectra of a double ion-exchanged (DIOX) glass sample using prism coupling of index np. The DIOX glass sample has a refractive index profile with a first region adjacent the surface that satisfies 0.0005 ≤ λ n ⅆ n ⅆ x ≤ 0.0009 , where λ is a wavelength of measuring light. The prism-sample interface includes an interfacing liquid of index nf that differs from np by no more than 0.03, and that can exceed np. The mode spectra have a contrast that is higher than that obtained by conventional prism coupling by using gradient illumination or partially blocked illumination that reduces the amount of background reflected light from the coupling prism. The improved-contrast mode spectra can be processed using conventional means to determine at least one stress characteristic of the DIOX glass sample.
US09109875B2
Disclosed is a template and method for use in the roofing industry for cutting roofing shingles on site in multiple useful lengths with each individual cut. The template, formed of a durable material such as aluminum, comprises a base plate having an upwardly facing planar surface. Border walls rise from two adjacent sides of the planar surface of the base plate and have abutment surfaces facing inwardly towards the planar surface of the base plate. Permanent markings on the abutment surfaces and the planar surface are visible at a fixed point above the template so as to enable a person with a T-square and a cutting instrument to cut a standard size shingle piece into two useful pieces or to cut multiple shingles stacked on top of one another into two useful pieces.
US09109874B2
A precision fabrication form system for preparing a poured-concrete (with upwardly projecting anchor bolts) footing for anchorably supporting the base of an elongate, upright, structural-frame column. The system includes a reversibly stackable plurality of independent, intercooperative, fabrication-form templates—grade, pedestal, base-plate, anchor-bolt and centerline—reversibly assembleable in a predetermined stack order above a prepared ground excavation into which concrete pouring to be associated with such a footing is to occur, certain ones of these templates being infinitely adjustable relative to one another and to the ground in both pre-pour and post-pour conditions to accommodate staged, precision, X-axis, Y-axis, Z-axis, and pitch, roll and yaw axes dispositions for the concrete and anchor bolts in such a footing.
US09109872B2
A calibration device for gauges for the measurement of the geometrical characteristics of cylinders, such as the diameter, profile, rotundity and eccentricity errors, wherein such gauges include a pair of movable opposing arms equipped with feelers or sensors at their free ends, includes a pair of abutments reciprocally approachable and/or withdrawable by means of motors until a sample measure is obtained, as desired, within the measuring range of the gauge, on which the calibration device is assembled, revealed by means of measuring means cooperating with the abutments, such that consequently the feelers or sensors are respectively abutted or approached to the abutments to reveal the sample measure.
US09109868B2
A coordinate measuring device includes a measuring probe measuring three-dimensional coordinates; a measuring arm supporting the measuring probe and outputting position information for calculating the three-dimensional coordinates; a controller connected to the measuring arm and detecting the three-dimensional coordinates based on the position information; and a display displaying a menu. The controller further displays the menu on the display when a predefined menu display operation performed using the measuring probe is detected.
US09109853B2
Among other things, methods and apparatus regarding collection, dissemination and display of information concerning paintball loaders and markers are disclosed. A loader includes a heads-up display, electronic devices for gathering, storing and disseminating information, and an antenna for sending and receiving data. Wireless voice communications among paintball players is possible via associated headsets. There is also disclosed paintball equipment and methods for controlling both the firing and loading mechanism of paintball equipment. Current systems or mechanisms have individual and discrete electronic control systems for firing operations, e.g. located in the paintball gun itself, and loading operations, e.g. located inside the paintball loader. The present disclosure unifies the electronic control of said firing and loader operations into a single electronic circuit board located on either the paintball gun or paintball loader.
US09109848B2
A firearm includes a receiver and a bolt carrier disposed in the receiver. The bolt carrier is moveable between a firing position and a rearward position. A rod is fixed relative to the bolt carrier and a hand guard is coupled to the receiver about the rod. A handle assembly is slideably supported by the hand guard and is moveable toward the receiver to define a charging motion and away from the receiver to define a forward assist motion. The handle assembly receives the rod during both of the charging and forward assist motions. An arm is coupled to the base and is moveable between a disengaged position spaced from the rod and an engaged position abutting the rod. When the arm is in the engaged position, the handle assembly is moved to move the rod and the bolt carrier in either of the charging and the forward assist motions.
US09109847B1
A shotgun reloading apparatus to conserve user effort and movement in reloading shells in a shotgun to enhance shooting efficiency is provided. The reloading apparatus includes a base member coupled to a side portion of the shotgun, and a storage member coupled to the base member and having a cradle and a plurality of fingers such that space between the cradle and fingers is sufficient to secure a shotgun shell in a first position where a longitudinal axis of the shell is parallel to a longitudinal axis of a breech of the shotgun. This enables a user to rotate the secured shell from the first position to a second position proximate the breech to permit a disposal of the shell into the breech to reload the shotgun.
US09109845B2
An outdoor heat exchanger in cooling operation includes: a first header pipe into which a refrigerant compressed by a compressor flows; a first heat exchanging unit connected with the first header pipe and allowing a refrigerant to exchange heat with the air; a bypass pipe through which the refrigerant exchanging heat in the first heat exchanging unit flows; a first distribution pipe connected with the bypass pipe; a distribution pipe check valve that is disposed in the first distribution pipe and preventing the refrigerant exchanging heat in the first heat exchanging unit from passing through the first distribution pipe; a second header pipe into which the refrigerant passing through the bypass pipe flows; a second heat exchanging unit connected with the second header pipe and allowing a refrigerant to exchange heat with the air; and a second distribution pipe through which the refrigerant exchanging heat in the second heat exchanging unit passes.
US09109844B2
A heat exchanger, illustratively utilized in a fuel-fired pool heater, circumscribes a burner operative to discharge hot combustion gases outwardly through the heat exchanger. The heat exchanger has a tube portion helically coiled about an axis, with a series of heat transfer fins circumscribing the tube portion and spaced apart along it length. The fins on longitudinally adjacent pairs of coils of the tubing have nested facing edge portions which collectively form a seal area that coils between the tubing portion adjacent coil pairs in axially spaced relationships therewith, the seal area substantially impeding combustion gas flow therethrough in a direction generally transverse to the axis of the heat exchanger. Additionally, the fins have deformed laterally outer portions that define a coiled, circumferentially spaced series of restricted combustion gas outlets in substantial axial alignment with the helically coiled tube portion.
US09109842B2
A fuel air heat exchanger for a gas turbine engine having fuel and air conduits in heat exchange relationship with one another, and a distribution conduit in heat exchange relationship with a component to be cooled. The distribution conduit is in fluid communication with the outlet of each air conduit. The heat exchanger also includes a secondary air inlet in fluid communication with the distribution conduit and a flow selection member selectively movable between first and second configurations. In the first configuration, the flow selection member closes the fluid communication between the secondary inlet and the distribution conduit. In the second configuration, the flow selection member opens the fluid communication between the secondary air inlet and the distribution conduit.
US09109839B2
The present invention relates to liquid to air evaporative heat exchange apparatus, mainly for cooling towers, air conditioning units, and humidifies alike. The present invention incorporate an evaporative module embedded with a liquid delivery system through all of its layers. Such a design allows for an even and smooth liquid distribution, while at the same time maximized the duration and surface area for heat exchange to take place. The evaporative module of the present invention can be sealed off at various sections to redirect air flow. Such a design serves dual functions as a drift eliminator or regulator.
US09109838B2
This invention relates to a gas blowing nozzle for blowing a gas to a molten metal in a furnace, the gas blowing nozzle including: a first nozzle section including a plurality of first narrow metal pipes having open furnace-side tips exposed to an inside of the furnace and being in the state of capable of blowing a gas to the molten metal in the furnace, a first surge tank communicated with the first narrow metal pipes, and a first refractory protecting the first narrow metal pipes and the first surge tank; and a second nozzle section including a plurality of second narrow metal pipes, a second surge tank communicated with the second narrow metal pipes, and a second refractory protecting the second narrow metal pipes and the second surge tank.
US09109827B1
A revolving framed refrigerator device having an inverted U frame having an interior side, a top end, a pair of spaced apart legs, and a center, a motor disposed within the frame proximal the center, a rotation control disposed on one leg, the rotation control in operational communication with the motor, a multi-doored refrigerator disposed within the frame, the refrigerator having a front side spaced apart from a back side, a first side spaced apart from a back side, a top side spaced apart from a bottom side, the top side connected to the motor, a plurality of doors disposed on the front side, a plurality of doors disposed on the back side, and a bearinged base wherein the rotation control rotates the refrigerator to a desired position.
US09109816B2
A transcritical R-744 refrigeration system with an energy efficiency ratio of a level comparable to that of refrigeration systems using common refrigerants by mechanically subcooling of the R-744 refrigerant. Mechanical subcooling increases the refrigeration capacity without increasing the power consumption of the refrigeration system's compressors. The compressors used to provide the refrigeration capacity for the subcooling process operate at much more favorable conditions, therefore have a very high energy efficiency ratio. The result is higher refrigeration capacity and lower power consumption.
US09109812B2
A solar heating cell includes a core substantially in the form of a parallelepiped having two open sides. O-rings are disposed within channels running about the edges of the two open sides and glass plates are clamped with compression clips to the two open sides forming air and watertight seals with the O-rings. The solar heating cell is filled with a liquid mixture, primarily water. A solar heating panel is made by mounting a number of the solar heating cells on a support apparatus in an opening through an external wall of a building.
US09109810B2
This ventilation system (1), notably for a gas turbine, comprises at least one fan (2) opening into an air extraction duct (5).It comprises at least one device (6) for varying the pressure drop in the air extraction duct (5), comprising a means (8) of regulating the air flow rate in the air extraction duct (5).
US09109797B2
A metallic wick assembly includes at least one mesh member and a sleeve member. The at least one mesh member includes a first length defined between first and second ends thereof. The sleeve member is mounted around the mesh member and includes a second length defined between two longitudinal opposite ends thereof. The second length is less than the first length. A third length is defined between a distal end of the sleeve member and the first end of the mesh member. The sleeve member is slidable with respect to the mesh member to adjust the third length for controlling the flame scale.
US09109794B2
A method of generating steam by heating water in a steam generator comprising a plurality of steam generating channels, wherein water is supplied at a constant rate to each steam generating channel through respective water supply lines, and wherein a sufficient pressure drop is provided across each water supply line in order to prevent flow reversal in the plurality of steam generating channels.
US09109793B2
An illuminated-display unit useable to provide artwork with rotating, glowing effects is described. The illuminated-display unit includes a base, a plate, and a dome. The base has a top surface with a central receptacle and an annular channel, a control panel, and light sources housed therein. The plate is disposed within the receptacle and the dome is disposed on the base to engage the annular channel and thereby accept the plate within its interior. Ink drawings or artwork are drawn on surfaces of the plate and the dome. The light sources are illuminated to provide internally reflected light within the plate and base. The ink on the plate and base refracts the internally reflected light and/or chemically or physically reacts thereto to provide a glowing effect. The dome and/or the plate are rotatable manually or mechanically to provide an animated effect to the illuminated display.
US09109792B2
A switch illumination device positioned outside a switch is introduced. The switch illumination device includes a switch panel, a light-emitting unit, and a fastening and unfastening structure. The switch illumination device further includes a fastening and unfastening structure whereby the light-emitting unit is coupled to switch panel. Hence, the light-emitting unit can not only be fixed to the switch panel but also be removed therefrom, thereby effectuating nocturnal illumination, emergency illumination, and mobile illumination.
US09109790B2
Liquid container, container illumination device, container member, and container illumination system
According to one embodiment, a liquid container includes a tank unit and a light emitting unit. The tank unit is capable of storing a liquid in an interior of the tank unit. At least one portion of the tank unit is light-transmissive. The light emitting unit contacts the at least one portion. The light emitting unit includes a first electrode opposing an outer surface of the at least one portion, a second electrode provided between the first electrode and the at least one portion, the second electrode being light-transmissive, and an organic light emitting layer provided between the first electrode and the second electrode.
US09109785B2
Provided is an LED traffic signal which can inhibit snow accretion, ice accretion, frost accretion, freeze of snow, freeze of ice, freeze of frost, and the like promptly without fail and which can obtain satisfactory visibility. The snow-melting LED signal includes: an LED signal light including in order: a lens cover; a heat generating sheet; an LED mask plate; an LED lens module; and a printed board protection cover; and a signal body for housing the LED signal light.
US09109781B2
An apparatus is described that includes a light source, a first reflector, a lens and a second reflector. The first reflector is positioned to reflect a first portion of light from the light source, wherein the first portion of light is radiated from the light source in a central forward solid angle as defined by an outer edge of the first reflector. The lens is disposed azimuthally horizontal to the light source for accepting a second portion of light from the light source emitted in a peripheral forward solid angle. The second reflector reflects the first portion of light after reflectance from the first reflector and the second portion of light after passing through the lens in a composite beam, wherein the first reflector and the lens are configured such that the first and second portions of light behave as though they were emitted from a point source at the focus of the second reflector.
US09109780B2
A safety aroma-diffusing night lamp assembly includes a body holding a coupling socket at the top, a lamp bulb inserted into the coupling socket and electrically connected to the body, a lampshade defining a bottom coupling hole coupled to the coupling socket and a top opening for holding an aroma capsule, and an aroma capsule including a disposable heat-transfer container mounted in the top opening of the lampshade and a solid aromatic substance contained in the disposable heat-transfer container and heatable by the radiating heat energy of the lamp bulb to release an aromatic smell.
US09109779B2
A defocused optic (110, 210) for mixing of light output from a multichip LED (101, 201). The defocused optic (110, 210) includes an outer reflector having a concave inner surface (122, 26, 222, 226) with a varied profile. The outer reflector surrounds an interior reflector (140, 240) having a convex surface (142, 242). The convex surface (142, 242) of the interior reflector (140, 240) is positioned to generally face a multichip LED (101, 201) and may optionally have a varied profile. Appropriate selection of the design parameters of the profiles of the concave inner surface (122, 126, 222, 226), the profile(s) of the convex surface (142, 242), and the rotational angular range over which said profiles are present enables appropriate mixing of the light output from a given multi-chip LED (101, 201).
US09109778B2
A solar-powered hanging lantern includes an interchangeable shade. The article comprises a housing having an upper surface with a solar cell and a lower surface with a light source. A rechargeable battery and electronics within the housing charge the battery using the solar cell and illuminate the light source when ambient light falls to a predetermined level. The housing includes a cylindrical sidewall with a diameter and a peripheral rim extending outwardly form the cylindrical sidewall. A shade is provided having an upper, generally cylindrical opening slightly larger than the diameter of the housing, the shade being installed onto and over the housing such that the cylindrical opening rests on the peripheral rim, with an elastomeric ring being placed onto and over the housing to maintain the shade in position. The ring may be an O-ring and/or may include an inner groove to receive the opening of the shade.
US09109776B2
The present invention is a segmented LED lighting system. In particular, the present invention is directed to a set of channel segments connected by a flexible lens sleeve that can be positioned in a variety of ways. A printed circuit board with at least one LED is mounted in each channel segment. Each segment preferably has a base with two ribbed vertical sides. The lens sleeve is preferably coextruded from flexible acrylic and has opaque side grips that grip the ribbed vertical sides and a translucent lens portion with an air gap. Pairs of encapsulated PCB modules are preferably connected in series to allow the system to be cut in the field.
US09109775B2
An accent lighting source utilizes a light source having a metal heat dissipating housing with an aperture within which at least one point light source, such as from an LED, is mounted. The aperture is closed by a lens/diffuser structure. The light source is mounted within a housing for the accent light source. The housing has a design configuration that supports one or more of a preferred accent lighting installation on a horizontal or vertical surface. Exemplary horizontal surfaces include the top of a post member, a deck surface, a stair surface or an overhanging or ceiling surface. Exemplary vertical surfaces include a stair riser and the side of post or wall surface.
US09109768B2
An illumination system operable for use as a string of Christmas lights may include a plurality of lamps connected in series. Each lamp may include a lamp luminary, a lamp stem, a lamp holder, and a pair of cables connected to the lamp holder. The lamp stem may have an insertion portion. The lamp holder may have an accommodation space formed therein. When the lamp stem is disposed in the accommodation space, the insertion portion may be clamped between a pair of first protrusions to separate the protrusions. When the lamp stem is removed from the accommodation space, the pair of first protrusions may resume contact through the elastic nature of the cable and the protrusions. The illumination system may be simple in structure and may be convenient for use.
US09109765B2
A lighting module includes a strip-shaped carrier. At least one light source, and at least one electrical contact element that can be contacted at the edge, are present on the strip-shaped carrier. The at least one light source may be a semiconductor lighting element. The at least one electrical contact element is designed as a material volume element.
US09109748B2
In one embodiment, the disclosed method for lubricating a machine bearing system includes monitoring a bearing system using a vibration sensor, such as an accelerometer, receiving a signal from the vibration sensor, calculating a parameter based on the signal; and adding a lubricant to the bearing system based upon the parameter. In another embodiment, a system may include a vibration sensor, a monitor configured to receive a signal from the vibration sensor and calculate a spike energy value, and a lubrication device configured to add a lubricant to a bearing system based on the spike energy value. The system and method help reduce maintenance and repair costs, while prolonging the life of the machine system components being monitored.
US09109747B2
A linear motion machine includes a base having an upper surface configured to support one or more work pieces and an instrument movably mounted to the base via a plurality of guideways permitting movement of the instrument relative to the base along three axes. At least one of the pluralities of guideways includes an elongated guideway member made of a plurality of elongated generally planar web members. Each of the elongated generally planar web members has a length and a pair of opposite side edges running along the length. The plurality of elongated generally planar web members are bonded together at least at one or more of the side edges to form the elongated guideway member. The elongated guideway member includes a ceramic material.
US09109746B1
A mounting apparatus for portable electronic devices provides a hands-free support for utilizing various portable electronics, such as smart phones or tablets. The mounting apparatus includes a specialized base for use with a floor, table, wall, or headboard surface. An upper assembly secures to the electronic device and can be tilted to a desired orientation. The upper assembly also includes an illuminating accessory for ease of viewing in dim lit situations and an attachable privacy curtain.
US09109745B2
A hanger system capable of securing an illuminated fixture to a load bearing element is presented. The hanger system includes a cap, a base, a gripper, and at least two cables. The cap includes a top wall with a first hole and a first side wall with at least one ridge. The base includes a bottom wall and a second side wall. A sleeve extends from the bottom wall toward the top wall and is aligned with the first hole. At least two channels extend from the bottom wall and contact the second side wall. A slot is disposed along the contact between each channel and the second side wall. The slot at least partially traverses the bottom wall within each channel. The base is slidably disposed within the cap with the ridges slidably engaged along the slots. The gripper secures the cap to the base via a lower stem and is removably attachable to an upper cable via an upper stem. The lower cables are removably attachable at one end to the illuminated fixture and at another end to the channels.
US09109737B2
A device, for sealing the end face of a tube, includes an inner tube which has a smaller diameter than the tube to be sealed and is introduced at the end face into the tube to be sealed; a sealing body which is provided to seal a ring gap between the inner tube and the tube to be sealed, the sealing body being arranged in a movable manner on the inner tube; a turbine configured to be driven by a fluid flow from the tube; and a mechanical transmission. The mechanical transmission is connected between the turbine and the sealing body, and acts to translate rotational movement of the turbine from the fluid flow into a movement of the sealing body, thereby bringing the sealing body from a position having reduced sealing capacity into a position having higher sealing capacity.
US09109722B2
The present invention provides an apparatus for detecting and/or repositioning annulus spacers used to maintain the position of a pressure tube withm a calandria tube of a nuclear reactor. The method comprises the steps of: vibrationally isolating a section of the pressure tube; vibrating the wall of said pressure tube within said isolated section; detecting vibration of the wall at a minimum of two axial positions within said isolated sections; and detecting the reduction in vibration level of the wall at one or more of said axial positions in comparison to the remaining axial positions. The apparatus comprises a tool head to be inserted into the pressure tube, the tool head comprising a first end and a second and a clamping block m each of said ends. The clamping blocks are used to vibrationally isolate a section of the pressure tube located between said ends. The apparatus also comprises piezo-actuators operable to vibrate said pressure tube; and accelerometers used for measuring vibration of said pressure tube.
US09109721B1
An apparatus for filtering water has an interface and a filtration/purification canister removably mountable onto the interface. Connecting the canister to the interface automatically opens a check valve in the interface to permit water to flow from the interface into and through the canister, and then back to and through the interface to an outlet port. Disconnecting the canister from the interface automatically closes the check valve, stopping the flow of water. The interface provides for water boiler expansion pressure relief, while guarding against any water contaminated downstream of the apparatus from backflowing into the filtration/purification canister and contaminating the portion of the filtration/purification canister downstream of the filter/conditioning/purifying medium held within the filtration/purification canister and thereby causing water exiting the outlet port of the filtration/purification canister to be contaminated.
US09109712B2
The present invention is directed to a tap handle assembly for positioning about an installed tap body that includes an outwardly extending spindle. The tap handle assembly has a handle body means that has a body aperture and engagement means for engaging an outer end of the spindle, a pin positionable and moveable within the body aperture, and a biasing means to bias the position of the pin within the body aperture. When the tap handle assembly is assembled with the tap body, the pin is biased to the tap body to substantially prevent the movement of the spindle and to restrict the flow from the tap.
US09109706B2
A coking drum is provided, especially for petroleum coke production, which has an approximately cylindrical basic body and also at least one inlet opening and outlet opening, a shut-off valve (1, 1′) being arranged at the outlet opening and/or inlet opening. The coking drum is characterized in that there is provided, at approximately the same height as the shut-off valve (1, 1′), at least one input opening (19, 19′) for feeding residual materials, especially from a vacuum distillation process upstream of the coking, into the coking drum.
US09109703B2
A seal backup ring is provided with undulating surfaces which create circumferential convergence with a relatively rotatable surface. The backup ring is configured so that differential pressure acting across a rotary seal forces portions of the backup ring against the relatively rotatable surface, closing, or substantially closing, the extrusion gap that the rotary seal is exposed to. In response to relative rotation between the backup ring and the mating relatively rotatable surface, the circumferential convergence promotes hydrodynamic lubrication within the dynamic interface that exists between the backup ring and the relatively rotatable surface. The modulus of elasticity of the backup ring is greater than the modulus of elasticity of the rotary seal.
US09109699B2
A structure for mounting a piston ring mounted around a piston head of a piston is provided. The structure includes a ring groove formed along the piston head with a guide recess circumferentially formed in the ring groove in a certain section. The piston ring is rotatably fitted into the ring groove. A guide protrusion is formed on the piston ring and is provided in the section of the guide recess such that the guide protrusion is rotated within the section. The structure is configured such that when a plurality of piston rings is mounted around the piston head, rotation sections of the end gaps of the piston rings are not aligned with each other.
US09109697B2
An automatic transmission includes an input member, a planetary gear mechanism, a plurality of engagement mechanisms, an output member, a shift position detector, an input rotational speed detector, a controller, and a switching mechanism. The controller is configured to set the switching mechanism in a reverse-rotation prevention state when a shift position is set in a forward movement range and configured to set the switching mechanism in a fixed state when the shift position is set in a backward movement range. The controller is configured to control the plurality of engagement mechanisms so that the input member is capable of rotating and rotation of the output member is prevented in a case in which a vehicle is moving backward, the shift position is switched from the backward movement range to the forward movement range, and a vehicle speed is greater than or equal to a first predetermined speed.
US09109681B2
Technologies relating to differential output control are disclosed. A differential output control apparatus may be coupled between a rotating device output and a controlled rotating output. The differential output control apparatus may comprise an adjustable mechanical link coupling two linked differential inputs, and configured to adjust a relative rotation speed or relative torque of the linked differential inputs. The differential output control apparatus may receive the rotating device output and adjust the adjustable mechanical link to control the rotation speed and/or torque of the controlled rotating output.
US09109679B2
A continuously variable transmission includes a gearbox with a forward mode and a reverse mode. The gearbox includes a plurality of gear members and further includes at least two torque transmitting devices such as, a clutch and a brake that are selectively employed to engage various combinations of the gear members such that a particular combination is associated with one of the forward mode and the reverse mode.
US09109672B2
A multi-stage transmission having eight forward and one reverse gear, including planetary gearsets, shafts and shift elements. The sun gear of gearset (P1) is connected to shaft (3) and the ring gear of gearset (P3) and can couple the housing via brake (03). The input shaft couples the carrier of gearset (P1) and can couple, via clutch (15), shaft (5) which couples the ring and sun gears of respective gearsets (P2, P3). The ring gear of gearset (P1) couples shaft (6), which can couple, via clutch (67), shaft (7), which couples the sun gear of gearset (P2). Shaft (8) couples the carrier and sun gear of respective gearsets (P3, P4). Shaft (4) couples the carrier of gearset (P4) and can couple, via brake (04), the housing. The output shaft couples the ring gear of gearset (P4) and the carrier of gearset (P2). Clutch (56) can connect shafts (5, 6).
US09109662B2
A wave generator for a wave gear device is provided with a pair of first rollers arranged in a position that is point-symmetric in relation to the center of a flexible externally toothed gear, a pair of second rollers, and a pair of third rollers. The first rollers are located on a long axis of the flexible externally toothed gear that is being flex into an ellipsoidal shape, and the second and third rollers are located in positions that are linearly symmetric in relation to the long axis between the long axis and a short axis. Support bearings of the first rollers are larger than those of the second and third rollers. The rolling fatigue life of a roller-type of the wave generator can be to be enhanced.
US09109659B2
An underwater shackle for heavy loads is described, comprising a shackle body (10) equipped with respective side plates (12a, 12b) and an upper, intermediate suspension (14) for connection to a lifting, strap, a lifting cable or the like, and also a lower locking bolt (20) for connection to the load. The locking bolt (20) is arranged to a hydraulically driven cylinder arrangement (30) so that it can move, where the cylinder arrangement (30) is placed adjoining one of the side plates (12a) and the cylinder arrangement (30) is arranged to be pressurized by a pressure medium to move the locking bolt (20) between a withdrawn position in the cylinder arrangement (30) and a locking position in the shackle body (10). A pressure distributor (40) is arranged with the cylinder arrangement (30) to receive and distribute the pressure medium, where the pressure distributor (40) comprises supply channels (44, 4) that run together with the first and the second inlet channels (34, 36) in the cylinder arrangement (30).
US09109656B2
A power transmission belt has a body with a length, a width, an inside and an outside. The body has at least one load carrying member embedded in rubber and extending in a lengthwise direction. The body defines a plurality of teeth spaced along the length of the belt on at least one of the inside and outside of the body. At least one of: (a) the at least one load carrying member has an occupying rate (R) that is not less than 75%, with R=n×Dc/B×100 where: n=number of load carrying members aligned along the width of the body; Dc=diameter of load carrying member(s); and B=width of the body; and (b) the at least one load carrying member has a cross-sectional area taken transversely to the length of the body that is in a range of 1.10 to 1.70 mm2 per 1 mm of belt width.
US09109655B2
Provided are elements arranged along a ring of a drive power transfer belt wound on pulleys of a belt-drive continuously variable transmission. Each element has a recess at one side of the element and a projection projecting from the other side to fit into the recess of the adjacent element. The projection has a first engagement portion provided at its base side such that a predetermined engagement gap is created on the radially outer side when the projection fits in the recess of the adjacent element, and a second engagement portion provided at the tip side of the projection and decreasing in diameter toward the tip of the projection from the first engagement portion. The gradient with which the diameter of the second engagement portion decreases is larger than the gradient with which the diameter of the first engagement portion decreases toward the tip of the projection.
US09109654B2
A compact and failsafe magnetorheological energy absorber design including both a light weight piston (LWP) embodiment in which linear motion is subjected to a linear damping force, and a light weight rotary vane (LWRV) embodiment in which linear motion is converted into rotary motion and is subjected to a rotary damping force. Both embodiments allow increased damper stroke within a compact mechanical profile. A new lightweight Magnetorheological energy attenuation system (LMEAS) for a vehicle seat is also disclosed using the new LMRW MREA.
US09109652B2
The invention relates to a selection of components of a disc brake, in particular for commercial vehicles, having a brake caliper having an installation opening for installing a brake shaft, a first brake shaft and a second brake shaft, wherein the two brake shafts are coordinated with the brake caliper in such a manner that they can be used to apply the brake. According to the invention, the first brake shaft, but not the second, fits through the installation opening. The further invention relates to a disc brake, in particular for commercial vehicles, having a brake shaft and a brake caliper having an installation opening for installing the brake shaft, wherein the brake shaft is coordinated with the brake caliper in such a manner that said brake shaft can be used to apply the brake. According to the invention, the brake caliper and the brake shaft each have a coding, which allows installation of the brake shaft through the installation opening only if the two codings match.
US09109638B2
A switchable coupling, in particular for vehicle auxiliary assemblies, is provided. The coupling includes an actuating system actuated electrically, mechanically, pneumatically or hydraulically between a driving element and an output element, and a switching element movable between switching start and end positions counter to the force of one or more resetting elements upon actuation of the actuating system. In the end position, the switching element connects the driving and output elements such that the output element and an auxiliary coupling connected thereto rotate with the driving element. After deactuation, locking bodies located on the auxiliary coupling produce an connection between the driving and output elements which continues to conduct torque between the driving and output elements. The connection is interrupted only when the rotational speed of the driving element falls below a limit value. The coupling does not require a permanent supply of power in the open or closed state.
US09109630B2
A rolling bearing unit includes: a rolling bearing having an inner ring, an outer ring arranged, multiple rolling elements, and a cage; and a cage guide member that is formed integrally with the outer ring or formed as a member different from the outer ring, and that is fixed to the housing side. The cage guide member has a guide projection projected into an annular space between the inner and outer rings and having an outer peripheral face a part of which serves as the guide face, and a grease supply portion having a grease reservoir portion in which the grease is reserved. A supply port through which the grease is supplied from the grease reservoir portion to the guide face is formed on the outer peripheral face of the guide projection, at a position closer to a base end portion of the guide projection than the guide face.
US09109629B2
A bearing cage, including an outer circumferential surface, an inner circumferential surface, a radial surface aligned in a direction orthogonal to the axis of rotation, at least one chamber located in material forming the bearing cage and one of at least one first channel connecting the at least one chamber to the radial surface and at least one second channel connecting the at least one chamber to one of the inner circumferential surface or the outer circumferential surface, or at least one first channel connecting the at least one chamber to the inner circumferential surface and at least one second channel connecting the at least one chamber to the outer circumferential surface.
US09109626B2
A bearing support that includes a body through which a bore extends and a plurality of grooves formed in a wall of the bore. Each groove extends from a first end of the bore and terminates prior to a second end of the bore. A bearing can be secured within the bearing support by injecting adhesive into one or more of the grooves.
US09109619B2
The invention relates to a screw having a screw head (2), a screw shank (1) and a corrugated conical flange (4) which decreases in thickness toward the outside, which flange (4) will abut on a component part as the screw is being screwed into the latter. The two lateral surfaces (5, 6) of the flange (4) from the screw shank (1) to the outer edge (7) of the flange taper continuously toward the outside with the thickness of the flange (4) decreasing at the same time, with its corrugation (8) extending substantially over the entire radial width of the flange (4).
US09109618B2
A blind rivet having a hollow rivet body made of plastic, an elongated shank with a bore, a head at one end of the shank and a foot end on the opposite end of the shank, and having, in the bore, a mandrel that has a mandrel shank with a drawing end and a mandrel head that acts on the foot end, the shank has a first region located between the head and the foot end, and has a second region with reduced cross-section and reduced wall thickness as compared to the first region. The regions arranged such that, as a result of a process in which the head is pressed against one side of a workpiece and the foot end is simultaneously drawn toward the other side of the workpiece with the aid of the mandrel, the wall of the shank forms a roll fold with an annular bead.
US09109615B2
A method and apparatus for associating an edge of a first object with a second object. An insert comprising a structure holding a fastener element may be positioned within a hollow portion at the edge of the first object. The structure may be configured to span an entire thickness of the first object at the edge of the first object. The structure may be adhesively bonded to the first object. The second object may be attached to the edge of the first object using the fastener element.
US09109614B1
Embodiments of the present invention use compressed air to store and deliver electrical, mechanical, and/or thermal power with high round-trip efficiency. Various embodiments may be scalable for use in a variety of environments—from wind farms to power plants to motor vehicles. An energy storage system according to the present invention can operate as a stand-alone storage system that connects electrically to the grid, it can be tightly integrated with a wind turbine, and/or it can be co-located with a thermal power generation facility and operate with even higher efficiency by scavenging low-grade waste heat.
US09109613B2
In a braking-force generator: a master cylinder generates first braking force corresponding to an operational input through a manipulator; a hydraulic-pressure generator connected to the master cylinder through a shutoff valve generates second braking force corresponding to the operational input through the manipulator when the shutoff valve is closed; an abnormality detector repeatedly determines whether or not an operational state of the hydraulic-pressure generator is abnormal; and a controller prohibits generation of the second braking force, opens the shutoff valve, and transmits the first braking force to the hydraulic-pressure generator, when the operational state is abnormal. In the case where the abnormality detector determines that the operational state changes from an abnormal state to a normal state while manipulation with the manipulator is being performed, the controller keeps prohibition of the generation of the second braking force and keeps the shutoff valve open until the manipulation is terminated.
US09109609B2
An electrical submersible pump motor has motor oil flowing through external circulation tubes for cooling the motor. A substantial portion of the exterior of each tube is submerged in and exposed to wellbore fluid. Heat is transferred from the motor to the motor oil, and then circulated through the external circulation tubes to conduct heat to the wellbore fluid. Internal or external motor oil pumps may be used to propel the motor oil through the circulation tubes. Guards or baffles may be used to protect the circulation tubes and to influence the flow of production fluid over the circulation tubes.
US09109589B2
A main-bearing outer diameter of an electric motor is made smaller than a rotor outer diameter without causing a drop in production efficiency, and the ease of performing a shrink-fitting step is also enhanced by making it possible to mount a rotor to a main shaft in an early stage. A bearing journal portion (14b) of a main shaft (14) of an electric motor is formed in a shape into which an inner race (18b) of a main bearing (18) can be press-fitted from both sides in the axial direction thereof, and, in addition, an outer diameter of the bearing journal portion (14b) is made larger than an outer diameter of a rotor press-fitting portion (14a), whereas a bearing bore portion (5a) of a partition member (5) is formed in a shape into which an outer race (18a) can be press-fitted from both sides in the axial direction thereof. It is preferable that a space (S) into which a press-fitting tool for press-fitting the main bearing (18) can be inserted be provided between the rotor press-fitting portion (14a) of the main shaft (14) and the bearing journal portion (14b) thereof.
US09109581B2
An offshore wind turbine comprising a tower, where said wind turbine at a level above sea level comprises at least one structure for storing at least one container, said container having the size and measures of a standard container, where said structure is arranged on the side of the tower, and a method of manufacturing such a concrete structure for an offshore wind turbine. The structure for storing one or more containers includes a deck, and at least one bed for supporting at least one container along the container's lower surface and/or edges, where the structure is a concrete structure. By manufacturing the structure from concrete, a very robust and strong structure is achieved.
US09109572B2
A system and method to recapture energy of a hydraulic motor is disclosed. The system includes a plurality of pistons disposed about a periphery of a flywheel, wherein each piston is compressed by a roller during each revolution of the flywheel. As each piston is engaged and pushes against the roller, the piston is biased inward and forces hydraulic fluid out of the cylinder recapturing energy as pressure to the system when the flywheel is rotating under its own rotational inertia. In addition, the piston pushing against the roller causes the flywheel to continue to rotate. As the force acting on the piston causes the flywheel to rotate, the next piston starts to approach the position of the prior piston. This action continues as long as the fluid is under pressure when it enters each cylinder.
US09109555B2
A valve casing of a flow regulating valve is welded to an end of a downstream section of a manifold body. Two passages are formed in the valve casing of the flow regulating valve. The valve casing accommodates a valve plate for switching at least one of the passages selectively between an open state and a closed state. A joint portion between the manifold body and the valve casing has height difference such that the portion in the vicinity of the passage corresponding to the valve plate is located at a position higher than the portion in the vicinity of the other one of the passages.
US09109552B2
An integrated canister purge valve for a turbocharged vehicle engine includes a valve member having a housing and being constructed and arranged to control vapor purge flow from a fuel tank and canister structure to an air intake manifold. A body is coupled to the housing. The body defines an interior space. Structure separating the interior space into a first chamber and a second chamber isolated from the first chamber. The first chamber has an inlet port and an outlet port. A vacuum generator is provided in the first chamber and in fluid communication with the inlet and outlet ports. A first check valve is in the first chamber between the vacuum generator and the valve member and a second check valve is in the second chamber between the valve member and a manifold outlet port.
US09109547B2
An exhaust gas recirculation (EGR) cooler for cooling exhaust gas includes at least one channel configured to allow the exhaust gas to flow through it, and a casing defining a cooling chamber around the at least one channel. The cooling chamber is configured to enable heat transfer between the exhaust gas and the coolant. The at least one channel has an interior surface and an exterior surface made of a first metal and a second metal, respectively, and configured to be in contact with the exhaust gas and the coolant, respectively. The second metal has a higher thermal conductivity than the first metal. The casing includes a coolant inlet and a coolant outlet configured to enable the coolant to enter and exit the cooling chamber, and an exhaust gas inlet and an exhaust gas outlet configured to enable the exhaust gas to enter and exit the at least one channel.
US09109542B2
In a carburetor (1) including a choke valve (7) on the upstream side inside an aspiration passage (3) and a throttle valve (8) on the downstream side, the valves (7) and (8) are disposed at positions such that the valves adjacently oppose each other when having been turned to be in the fully open state, a bulging part (11) that bulges toward the region (A1) between the adjacently opposing valves (7) and (8) is integrally provided inside a venturi (9), and the aspiration passage (3) is divided into an air-fuel mixture passage (4) located on the side where a main jet (10) is provided and an air passage (5) through which leading air circulates by the bulging part and the valves (7) and (8), both of which are in the fully open condition.
US09109536B2
In some aspects, an aircraft engine thrust reverser lock system includes a pin-capturing member. The pin-capturing member includes a body that is rotatable about an axis defined by a pivot extending through the body. The body includes an interior surface that defines a slot. The slot has an opening that is sized to receive a pin into the slot. One side of the slot includes a protruded sidewall surface that protrudes into the slot toward an another sidewall surface of the slot. The protruded sidewall surface defines an apex between the open and closed ends of the slot. Between the apex and the closed end of the slot, the protruded sidewall surface faces the rotational axis.
US09109530B2
The invention relates to a piston (10, 110, 210) for an internal combustion engine, comprising a piston head (11, 111, 211) and a piston skirt, the piston head (11, 111, 211) having a circumferential ring section (15, 115, 215) and a circumferential cooling channel (16, 116, 216) in the region of the ring section (15, 115, 215). The cooling channel has a cooling channel floor (17, 117, 217) and a cooling channel ceiling (18, 118, 218). According to the invention, the cooling channel (16, 116, 216) has a narrowing (20, 120, 220).
US09109523B2
Methods and systems are provided for estimating a PCV flow to an engine based on the output of an exhaust gas oxygen sensor. During DFSO conditions, a reference voltage of the sensor is modulated initially with an intake throttle open and then with the intake throttle closed. PCV flow leaking past the piston valves in an aging engine, as well as an ambient humidity estimate, are inferred based on the outputs of the sensor during the modulating with the intake throttle open and closed.
US09109522B2
The invention relates to a method of controlling a combustion engine (1) comprising at least one cylinder (2) and a manifold (3) and an exhaust gas recirculation (EGR) circuit including an EGR valve. The EGR valve (6) is controlled by carrying out the following stages: a) measuring a pressure difference ΔP in a portion of the exhaust gas recirculation circuit including the EGR valve; b) selecting a burnt gas fraction set point BGRsp in the intake manifold (3); c) calculating an opening set point for the EGR valve (6) from a pressure drop relation applied in a portion of the exhaust gas recirculation circuit including the EGR valve, depending on difference ΔP at the EGR valve and on the burnt gas fraction set point BGRsp in the intake manifold; and d) controlling the EGR valve (6) as a function of the opening set point of EGR valve (6).
US09109519B2
A method for controlling at least one air system state in an intake manifold of an internal combustion engine, at least one control variable which influences the at least one air system state being predefined with the aid of an actuator; at least one control variable limitation of the actuator is taken into account in the control.
US09109515B2
A gas seal for aerospace engines has a stationary seal housing, a rotating seal plate mounted on the engine drive shaft and a carbon ring seal movably supported in the housing with a face which mates with the face of the seal plate to create a gas seal therebetween. A plurality of flexible pins have first ends supported on the housing and second ends slidably connected with the carbon ring seal to permit the latter to shift axially. A plurality of compression springs bias the two seal faces together. The housing has a first twist lock which selectively engages a second twist lock on the carbon ring seal to movably retain the latter in the housing. The second ends of the spring pins resiliently deflect during mutual rotation of the carbon ring seal and the housing to facilitate engagement and disengagement of the first and second twist locks.
US09109514B2
A method for recovering air in an aircraft includes bleeding bypass air from an engine bypass, bleeding core air from an engine core, and placing the bypass air and the core air in a heat exchange relationship to produce heated bypass air and cooled core air. The method further includes directing the heated bypass air to one or more of: the engine bypass, a cowl de-icing system, and a wing anti-ice system.
US09109509B2
A unit for an aircraft thruster is provided that includes a first ferrule configured to be attached to a second ferrule and a first connection flange configured to be secured to a second corresponding connection flange secured to the second ferrule. The connection flange includes a portion forming a plane extending along a radial direction with respect to the first ferrule. A link between the first ferrule and the corresponding connection flange is offset to a distance from said plane corresponding to a length for damping a shear-generating flexural moment, generated by fluxes of forces passing through the first ferrule.
US09109506B2
Method and system for operating a compression engine on ether containing fuel obtained by conversion of a primary fuel based on alcohol comprising the steps and means for: (a) continuously withdrawing the primary fuel based on alcohol from a fuel tank and pressurising the primary fuel based on alcohol in its liquid form to a final engine injection pressure; (b) continuously introducing the pressurized primary fuel based on alcohol into a fuel accumulation chamber; (c) continuously distributing the pressurized primary fuel based on alcohol into pipes connecting the accumulation chamber with fuel injectors of the engine; (d) prior to the fuel injectors continuously converting the pressurised primary fuel based on alcohol to an ether containing fuel by contact with an alcohol dehydration catalyst being arranged in each of the pipes upstream the fuel injectors; (e) continuously injecting the ether containing fuel at injection pressure into the engine; and (f) continuously withdrawing a part of the introduced primary fuel based on alcohol from the accumulation chamber; and (g) depressurising and recycling the withdrawn primary fuel based on alcohol to the fuel tank.
US09109502B1
A supercharger assembly includes a centrifugal blower for delivering pressurized air to an engine air manifold of an engine; a variable transmission for driving the blower; a motor for adjusting a gear ratio of the variable transmission; and a control system for controlling operation of the motor to provide user selectable and/or programmable levels of supercharger boost. The control system may include a user input device for selecting a performance level of the supercharger assembly; at least one engine sensor for sensing an operating parameter of the engine; at least one environmental sensor for sensing a characteristic of the inlet air; and a programmable controller for controlling operation of the motor in accordance with the user selected performance level and outputs of the engine sensor and the environmental sensor.
US09109497B2
A vehicle cooling device includes a pump, circulation paths connected to the pump for circulating coolant between a cooling object and a heat exchanger, a solenoid valve for opening and closing at least one of the circulation paths, and a control unit for controlling pump operation. The solenoid valve includes a valve body movable between a position separated from a valve seat and a position abutting the valve seat, the valve body being held in abutment with the valve seat, and a solenoid maintaining the abutment when energized. The valve body allows coolant fluid pressure to move the valve body separate from the valve seat when the solenoid is not energized and the pump is in operation, and the control unit performs controlling to stop the pump and start solenoid energization when conditions are ready for stopping coolant circulation through the circulation path in which the solenoid valve is disposed.
US09109492B2
An exhaust purification system of an internal combustion engine including an ammonia oxidation catalyst device and an ammonia holding device arranged immediately upstream of the ammonia oxidation catalyst device is provided. The ammonia holding device has a solid acid, holds ammonia to restrain the ammonia from flowing into the ammonia oxidation catalyst device when a temperature of the ammonia oxidation catalyst device is within a N2O producing temperature range, and releases the held ammonia to make the ammonia flow into the ammonia oxidation catalyst device when the temperature of the ammonia oxidation catalyst device is out of the N2O producing temperature range.
US09109490B2
An electric heating catalyst (EHC) in which a short circuit between a heat generation element and a case in EHC is suppressed. The EHC includes a heat generation element (catalyst carrier) electrically energized to generate heat; a case receiving the heat generation element; an insulating support member between the heat generation element and the case; a tubular inner pipe inserted into the insulating support member and located between the heat generation element and the case. The inner pipe has an end protruding into an exhaust gas from the insulating support member's end face, and the inner pipe has an electrically insulating layer formed on an entire surface, or the inner pipe is formed of an electrically insulating material; and an inner pipe heater supplied with electricity through a path different from a path through which electricity is supplied to the heat generation element, thereby heating the inner pipe's protrusion portion.
US09109489B2
In a vehicle including an EHC containing a catalyst base material and an insulator insulating the EHC from the outside, an ECU estimates a temperature of the catalyst base material and a temperature of the insulator immediately after a state of the vehicle is switched from a Ready-OFF state to a Ready-ON state, as a base material temperature for determination THcpost and an insulator temperature for determination THipost, respectively. Then, when base material temperature for determination THcpost is lower than a base material threshold temperature THcth and when insulator temperature for determination THipost is lower than an insulator threshold temperature THith, the ECU allows EHC power feed, and otherwise it does not allow but prohibits EHC power feed.
US09109484B2
The purpose of the present invention is to provide a DPF travel-time regeneration control system of stably raising the temperature even during travel and capable of decreasing the frequency of DPF regeneration when the vehicle is stopped. In this control system, if the DPF (5) needs to be regenerated, the vehicle is traveling on cruise control, and the exhaust temperature detected by an exhaust temperature sensor (11) is higher than a threshold value, then fuel is injected into the exhaust pipe by a fuel injection means (7), and if the exhaust temperature is lower than the threshold value, the exhaust temperature is raised by operating the exhaust brake without injecting fuel into the exhaust pipe.
US09109483B2
An exhaust system for an internal combustion engine, having a first exhaust tract and a second exhaust tract, wherein a first silencer device is arranged in an end section of the first exhaust tract and a second silencer device is arranged in an end section of the second exhaust tract, and the two exhaust tracts are connected in an inter-communicating manner by a crosstalk point, and, in the first or second exhaust tract downstream of the crosstalk point, there is provided a valve for the selective closure of the respective exhaust tract, wherein a distance between the valve and the crosstalk point is dimensioned such that, at a particular rotational speed of the engine, an exhaust line path between the valve and the crosstalk point serves as a quarter lambda resonator such that, at the rotational speed of the internal combustion engine, disturbing noises of the exhaust system are reduced.
US09109481B2
A method for controlling an exhaust gas recovery system for an engine includes generating a signal to control exhaust gas flow through an exhaust gas heat exchanger, and generating a diagnostic code based on a difference between coolant temperature downstream of the exhaust gas heat exchanger and coolant temperature downstream of the engine. A vehicle has an engine, and an exhaust heat recovery system with an exhaust gas heat exchanger, a first temperature sensor downstream of the engine, and a second temperature sensor downstream of the exhaust gas heat exchanger. A controller for the vehicle is configured to: (i) generate a signal to control exhaust gas flow through the exhaust gas heat exchanger, and (ii) generate a diagnostic code based on a difference between coolant temperature measured by the first and second temperature sensors.
US09109473B2
A valve-timing control apparatus includes a phase change mechanism configured to change a valve timing, a cover member provided near a front end side of the phase change mechanism; slip rings provided to one of a front end portion of the phase change mechanism and a facing surface of the cover member which faces the phase change mechanism; a pair of brushes provided to another of the front end portion of the phase change mechanism and the facing surface of the cover member to be axially slidable. One end portion the pigtail harness is connected with the corresponding brush. Another end portion of the pigtail harness is connected with a connector terminal under a deflected state, at a location radially shifted from an axis of the corresponding brush. The another end portions of the pair of pigtail harnesses are separated from each other by a partition wall.
US09109471B2
A cam structure driving a tappet having a crowning on a top face and connected to a base end section of an intake or exhaust valve of an engine, includes: a camshaft rotating in synchronization with a crankshaft of the engine; a cam lobe mounted on the camshaft, and including: a base cam including: a base circular section having a mounting hole for the camshaft; and a valve lift section having a cut-out section in a tip end portion; and a roller provided in the cut-out section and having a cylindrical section with a constant diameter. A center section in a width direction of the base cam makes contact with the tappet at a position deviated from a center of the top face of the tappet, and the cylindrical section makes contact with the center of the top face of the tappet.
US09109470B2
Systems and methods for mounting a timing belt pulley to a crankshaft can include a crankshaft rotatable about a center longitudinal axis, the crankshaft including a pin assembly configured for connection to a reciprocating piston. A timing belt pulley can be positioned against the pin assembly and configured for engaging the pin assembly such that the timing belt pulley is coupled to the crankshaft for rotation about the center longitudinal axis. For example, the pin assembly can include a slot formed on an exterior surface thereof, and the timing belt pulley can include a key extending towards the pin assembly and configured for engaging the slot.
US09109446B1
A variable displacement engine comprises a block having one or more cylinders disposed in parallel around a rotating power shaft. A piston in each cylinder is connected to a connecting rod. A wobble plate, including a first ring, a second ring and a bearing assembly, is mounted on the shaft. The first ring rotates with the shaft and pivots about a pivot axis. The second ring is concentrically adjacent the first ring, has rod bearings connected to each connecting rod, and is connected to the block to prevent relative rotation. The bearing assembly is connected between the rings to allow relative rotation therebetween while constraining the rings to remain parallel. A displacement actuator connected to the wobble plate moves the pivot axis along the shaft to change the displacement, while a piston control linkage changes the wobble plate angle to maintain a constant compression ratio.
US09109441B2
An injection apparatus for use in a wellbore is disclosed wherein the apparatus includes a tubular housing and a shield housing disposed outside the tubular housing, the shield housing including a chamber in fluid communication with the tubular housing. The apparatus further includes a piston disposed within the shield housing, the piston coupled to a biasing member, wherein movement of the piston controls fluid communication between the chamber and the wellbore, and wherein the movement of the piston is caused by a pressure change of a fluid within the tubular housing.
US09109439B2
A hybrid telemetry system for passing signals between a surface control unit and a downhole tool is provided. The downhole tool is deployed via a drill string into a wellbore penetrating a subterranean formation. The hybrid telemetry system includes an uphole connector, a downhole connector, and a cable operatively connecting the uphole and downhole connectors. The uphole connector is operatively connectable to a drill string telemetry system for communication therewith. The downhole connector is operatively connectable to the downhole tool for communication therewith.
US09109434B2
A system includes a downhole formation fluid sampling tool and a processor. An optical spectrometer of the downhole formation fluid sampling tool is able to measure an optical characteristic of a formation fluid flowing through the downhole formation fluid sampling tool over a plurality of wavelengths. The optical spectrometer generates optical spectra data indicative of this optical characteristic. The processor is designed to receive the optical spectra data generated by the optical spectrometer and to estimate a formation volume factor of the formation fluid based on the optical spectra data.
US09109428B2
An insert for a downhole plug for use in a wellbore is provided, comprising a body having a bore at least partially formed therethrough, wherein one or more threads are disposed on an outer surface of the body for engaging the plug; and at least one interface is disposed on an end of the body for connecting to a tool to screw the insert into at least a portion of the plug.
US09109422B2
A ball launching system includes a ball launcher with a removable ball pod and sleeve assembly that retains balls prior to injection. An interchangeable ball pod with a chamber corresponding to the ball diameter, fits into a pod sleeve and comprise the ball pod and sleeve assembly. The ball launcher further includes a housing with a moveably disposed piston that engages with the ball thereby launching it. The housing also includes a thru hole through which the piston may travel to externally indicate its position within the housing. The ball launching system also includes a control system having control inputs, which may be located remote to the ball launcher. By applying a pre-determined sequence of control inputs, the piston may engage with the balls retained in the ball pod and sleeve assembly to force the balls to be launched from the ball launcher.
US09109418B1
A method and apparatus is provided which will improve the integrity of a pipeline by removing moisture and solid particulates that have been entrapped within a gas originating from an underground storage cavern following pressure reduction before introducing the gas into the pipeline.
US09109415B2
A system for pump down operations includes a diversion valve unit that is adjustable between a pumping position and a diversion position and a controller coupled to the diversion valve unit. The system further includes a fluid reservoir, a downhole fluid path between the fluid reservoir and a tool downhole, a driving unit in the downhole fluid path for advancing the tool, and a diversion fluid path between a portion of the downhole fluid path downstream of the driving unit and the fluid reservoir or another fluid receptacle. The diversion valve is in the diversion fluid path and the controller automates the diversion valve position for the diversion valve unit based on a monitored wireline speed or a monitored wireline tension for a wireline unit.
US09109413B2
The present invention includes consolidated hard materials, methods for producing them, and industrial drilling and cutting applications for them. A consolidated hard material may be produced using hard particles such as B4C or carbides or borides of W, Ti, Mo, Nb, V, Hf, Ta, Zr, and Cr in combination with an iron-based, nickel-based, nickel and iron-based, iron and cobalt-based, aluminum-based, copper-based, magnesium-based, or titanium-based alloy for a binder material. Commercially pure elements such as aluminum, copper, magnesium, titanium, iron, or nickel may also be used for the binder material. The mixture of the hard particles and the binder material may be consolidated at a temperature below the liquidus temperature of the binder material using a technique such as rapid omnidirectional compaction (ROC), the CERACON® process, or hot isostatic pressing (HIP). After sintering, the consolidated hard material may be treated to alter its material properties.
US09109403B2
A drill bit assembly having an electrically isolated gap joint for electromagnetic telemetry comprises a drill bit, a pin body, an electrically insulating gap joint therebetween, and an electrical conductor extending across the gap joint. The bit head has a cutting end and an opposite connecting end with an engagement section. The pin body has a tubular body with an axial bore therethrough, and comprises a connecting end with an engagement section. The pin body connecting end is connected to the bit head connecting end such that the engagement sections overlap. The electrically insulating gap joint fills an annular gap between the bit head and pin body engagement sections such that the bit head and pin body are mechanically connected together at the connecting ends but are electrically separated. The electrical conductor has one end electrically contacting one of the bit head and pin body, and the other end communicable with electronics equipment.
US09109396B2
A ladder includes a stair section having a plurality of steps, a vertical upright that connects to a top of the stair section, a base that connects a bottom of the stair section and a bottom of the vertical upright, and one or more wheels connected to the bottom of the vertical upright. The ladder may also include a front locking step and a rear wheel assembly. A narrow base extends between a step of the stair section above a bottom step or locking step and the vertical upright.
US09109394B2
The disclosed adjustable ladder support mechanism solves the problem of unstable extension ladders with a mobile base that can be moved by one man, the base then expanded in both length and width. With the stable base set up, the ladder can be extended, the angle adjusted, and the operator can safely climb the ladder. Worries of the ladder slipping sideways off the ledge against which it is leaned are eliminated.The adjustable ladder support mechanism has two main sections: the base, which provides stability, and the tower, which raises the ladder above the ground.
US09109391B2
A method is disclosed for determining a branching point within a hollow organ in image data representing the spatial structure thereof. In at least one embodiment, the method includes setting a start point within the hollow organ; determining at least one local threshold which corresponds to the presence of a wall of the hollow organ; carrying out a region growing method using the threshold; analyzing the connectivity of a number of outer growth layers; and localizing a branching on the basis of the connectivity analysis. Moreover, at least one embodiment of the invention relates to a correspondingly designed branching determination unit.
US09109380B2
A motor vehicle door lock is provided with a catch with an actuating-lever mechanism which acts on the catch. There is also a locking lever which, together with the actuating lever, renders the actuating-lever mechanism inactive when accelerating forces of predetermined magnitude occur, for example in the event of a crash. The actuating lever and locking lever disable the actuating-lever mechanism mechanically, as a result of the accelerating forces occurring, by associated deflection. Following dissipation of the accelerating forces, the actuating lever and locking lever reconnect the actuating-lever mechanism.
US09109379B1
A keyless padlock having a padlock body, a shackle, a locking mechanism located in the body and associated with the shackle to lock the shackle to the body in a locked condition and to release at least a part of the shackle in an unlocked condition, the locking mechanism including a signal receiver, at least one control assembly and at least one actuator, the locking mechanism being unlocked upon verification of a signal including an unlock code transmitted by a mobile computing device.
US09109370B2
The invention relates to a scaffolding post (25) made of metal, including a tube (26) and a tubular tube connector (27) integrally molded therewith. In a transition region between the tube connector (27) and the tube (26) a stop (46) is formed, the stop being in the form of an annular post-supporting end face (50) running perpendicularly to the longitudinal axis of the scaffolding post (25) and circumferentially around the longitudinal axis. The slide-on area (37) of the tube (26) has a plurality of indentations (86), each extending in the direction of the longitudinal axis of the scaffolding post (25) and each being designed with a tube inner cross-section reduction. The indentations are arranged distributed in the circumferential direction around the longitudinal axis of the scaffolding post (25) at regular intervals or equidistant and each extends continuously for a length in the tube slide-on region (37), starting directly from a tube-supporting end face in the direction of the tube connector (27). The indentations (86) are each configured in an L-shape or T-shape with a longitudinal supporting indentation (90) and a transverse centering indentation (91). In the region of the post-supporting end face (50) the tube connector (27) includes a centering region (65) spanning a first tube connector outside diameter and further includes a supporting region (73) spanning a second tube connector outside diameter, wherein the first tube connector outside diameter is slightly larger than the second tube connector outside diameter. The tube (26) includes a substantially circular cylindrical tube portion (55), which merges in the direction of the free tube connector end directly, substantially sharp-edged via an annular edge or with a slight transitional radius, into the post-supporting surface (50).
US09109368B2
A rain-screen siding system for buildings, including clips to support siding boards parallel with a flat surface of a building wall structure but spaced apart from the building wall to allow air to circulate between the building wall structure and the siding boards. The clips include paired, opposed channels and the siding boards have tongues that fit into the channels. Drainage grooves are defined in the clips. Bottom support members may extend horizontally to support the siding boards at the bottom of the rain screen siding. Corner closing members are provided to protect end faces of siding boards at an exterior corner of a building wall.
US09109361B2
A building connection between a plurality of vertical wall studs made with a plurality of bridging members to brace the wall studs. The bridging members are formed with mounting sections that are received in openings of the wall studs and the mounting sections are bracketed by connecting sections that are used to join the bridging members to each other. The bridging members interface with the web of the wall studs to brace them.
US09109360B2
An insulating fire and blast resistant window and door buck is described that is designed for use with an insulated concrete wall form. The window and door buck described provides a core of concrete for fire and blast protection while also providing structural concrete for attaching window and door elements. In some embodiments, the window and door buck comprises two pieces of insulation that are separated by a gap and held together by a tie piece. The insulation pieces are proportioned to so that an alignment element fits inside the cavity of the wall form. When the buck is placed in an insulated wall form and concrete is poured into the form a strip of concrete fills the gap, resulting in a fire and blast resistant wall.
US09109354B2
A modular structure formed by panels is disclosed, having a center compartment and first and second side compartments coupled to the opposing sides of the center compartment. Each panel of the modular structure is joined to each respective adjacent panel via a panel joining assembly to substantially prevent moisture from entering the modular structure. An upper roof panel coupled to the center compartment is joined to first and second lower roof panels coupled to the first side compartment and the second side compartment, respectively, via first structural joining assemblies so that the upper roof panel is elevated relative to the first and second lower roof panels to substantially prevent moisture from entering the modular structure.
US09109350B2
The invention provides a fluid delivery assembly for use with a water discharge fixture, such as a faucet. The fluid delivery assembly includes a tube assembly, a cartridge housing and a retaining assembly. The fluid delivery assembly provides for water flow from hot and cold water inlets to the faucet. The fluid delivery assembly may be assembled by hand without the need for tools, allowing for easy replacement of the fluid delivery assembly without the need to disassemble the faucet assembly or to replace the entire faucet assembly.
US09109348B2
A monitor includes a display in a form of a liquid crystal display, a rubber frame having a surrounding face that surrounds an outer circumferential surface of the liquid crystal display, and a front case having a housing that houses the liquid crystal display attached with the rubber frame. The rubber frame includes a projection that projects from a surface of the surrounding face and that is elastically deformed by contacting with an inner circumferential surface of the housing.
US09109341B1
Disclosed herein is a ground anchor body having a rotation release structure. The ground anchor body includes a waterproof cap, a head coupler, a wedge, a tubular guide, a movable body, and a compression spring. The head coupler is coupled to a lower end of the waterproof cap. A tapered hole is longitudinally formed in the head coupler. The wedge is disposed in a tapered hole of the head coupler to hold the PC strand. The guide is installed in the waterproof cap. A slide slot is longitudinally formed in the guide. The movable body is disposed in the guide and provided with a slide protrusion inserted into the slide slot. The wedge is coupled to the movable body, and a key depression is formed in the movable body so that an end of the PC strand is key-coupled to the movable body. The compression spring elastically compresses the movable body downward.
US09109324B2
A tumble dryer with a fire-extinguishing facility includes a fire sensor for detecting a fire in a laundry drum of the tumble dryer, and an extinguishing medium supply device for introduction of an extinguishing medium into the laundry drum of the tumble dryer on actuation of a fire-extinguishing device. The extinguishing medium supply device includes a laundry freshening device.
US09109323B2
A washing machine includes: a synchronous motor unit installed at the bottom of a tub; a drain valve housing installed at the bottom of the tub; a link unit disposed between the synchronous motor unit and the drain valve housing; a wire unit having one side connected to the synchronous motor unit and the other side connected to the link unit; a spring member having one side connected to the link unit and the other side connected to the drain valve housing; a clutch lever unit rotatably installed on a clutch base unit and rotated in connected with the movement of the link unit caused by the operation of the synchronous motor unit; a cam lever unit connected to the clutch lever unit; a lift lever unit contacted with the cam lever unit; and a coupling unit engaged with a rotor unit or clutch body unit.
US09109320B2
The method according to the invention for sterilizing temperature-sensitive laundry items comprises the following steps: in the dry state, the laundry items are exposed to a process air flow having a defined temperature Tp and over a specified time period, then the laundry items heated in such a way are cooled to a target temperature Tptarget significantly lower than the temperature Tp, and then the cooled laundry items are washed in a washing process. The washing-drying unit according to the invention has a control device (CTRL) for carrying out said method.
US09109317B2
An automatic washing machine including a tub, a drum mounted for rotating within the tub, a treating chamber for receiving laundry to be treated, a door selectively moveable between opened and closed conditions to provide access to the treating chamber, a position sensor configured to sense the opened and closed conditions of the door and accordingly output a door condition signal, a humidity reduction device coupled to the treating chamber, and a controller configured to execute a treating cycle of operation and operably coupled with the position sensor to receive the door condition signal and the humidity reduction device to control its actuation, and further configured to operate the humidity reduction device and to rotate the drum to reduce the humidity in the treating chamber in response to the door being opened and subsequently closed after the completion of the treating cycle of operation.
US09109316B1
This disclosure relates to the field of fabric (i.e. clothes) washing apparatus which are portable, and operable without a running source of water, and without a power source. The washing apparatus operates with a volume of liquid cleaner (water) and manual manipulation of a handle. The apparatus may also be dis-assembled by a user without tools for shipping or storage in a much smaller space.
US09109312B2
The present invention relates to an application head for applying fiber strips made up of a structural assembly determining a path conveying multiple fiber strips (2) to an application area (3), each fiber strip (2) passing through a drive roller (5) and a tension regulator (6), whereas in the application area (3) the fiber strips (2) are pressed individually by a compactor system (8) comprising a series of independent partial rollers (9), each of which is arranged with a fastening comprising a system for height wise movement and a floating system.
US09109296B2
A method for etching a selected area of a conductive metal oxide layer deposited on a support is provided. The method comprises removing the area via electrochemical route in the presence of a polarized microelectrode and an electrochemical solution. In addition, an etched layer obtained with the foregoing method is provided.
US09109293B2
An electrocatalyst for the electrochemical conversion of carbon dioxide to hydrocarbons is provided. The electrocatalyst for the electrochemical conversion of carbon dioxide includes copper material supported on carbon nanotubes. The copper material may be pure copper, copper and ruthenium, copper and iron, or copper and palladium supported on the carbon nanotubes. The electrocatalyst is prepared by dissolving copper nitrate trihydrate in deionized water to form a salt solution. Carbon nanotubes are then added to the salt solution to form a suspension, which is then heated. A urea solution is added to the suspension to form the electrocatalyst in solution. The electrocatalyst is then removed from the solution. In addition to dissolving the copper nitrate trihydrate in the deionized water, either iron nitrate monohydrate, ruthenium chloride or palladium chloride may also be dissolved in the deionized water to form the salt solution.
US09109278B2
The present invention provides a method of forming a self-assembly fullerene array on the surface of a substrate, comprising the following steps: (1) providing a substrate; (2) pre-annealing the substrate at a temperature ranging from 200° C. to 1200° C. in a vacuum system; and (3) providing powdered fullerene nanoparticles and depositing them on the surface of the substrate by means of physical vapor deposition technology in the vacuum system, so as to form a self-assembly fullerene array on the surface of the substrate. The present invention also provides a fullerene embedded substrate prepared therefrom, which has excellent field emission properties and can be used as a field emitter for any field emission displays.Finally, the present invention provides a fullerene embedded substrate prepared therefrom, which can be used to substitute for semiconductor carbides as optoelectronic devices and high-temperature, high-power, or high-frequency electric devices.
US09109273B2
A cold rolled steel sheet and a hot dip galvanized steel sheet, which have high strength and elongation, such as a tensile strength of 980 MPa or more and an elongation of 28% or more, and excellent delayed fracture resistance, and manufacturing methods thereof. The cold rolled steel sheet has a composition including 0.05 to 0.3 weight percent C, 0.3 to 1.6 weight percent Si, 4.0 to 7.0 weight percent Mn, 0.5 to 2.0 weight percent Al, 0.01 to 0.1 weight percent Cr, 0.02 to 0.1 weight percent Ni and 0.005 to 0.03 weight percent Ti, 5 to 30 ppm B, 0.01 to 0.03 weight percent Sb, 0.008 weight percent or less S, balance Fe and impurities. The hot dip galvanized steel sheet has a hot dip galvanized layer or a hot dip galvannealed layer on the cold rolled steel sheet.
US09109266B2
ProblemsDevelopment of a process of producing inexpensive and safe hexose and compositions of the same.Means for ResolutionA process of producing a sugar composition comprising a definite amount of an target hexose, comprising treating a starting liquid sugar material comprising a starting sugar material hexose or a mixture comprising hexose in a system in the presence of one or more types selected from the group consisting of basic ion exchange resins, alkalis and calcium salts to initiate an isomerization reaction as an equilibrium reaction to transform the starting sugar material hexose to the target hexose to prepare a sugar mixture comprising a definite amount of the target hexose and having a sugar constitution different from that of the starting sugar material, and hexose compositions containing D-allose and D-psicose and the use of the hexose compositions.
US09109260B1
A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5′GCGATTTCYGAAYGGGGRAACCC (SEQ ID NO: 1), the other primer consisting of DNA having the sequence 5′TTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 2) and testing the resulting amplicon by hybridization to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococeus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci, and coagulase-negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilized on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
US09109259B2
Polynucleotides which are novel causative genes for cancer are elucidated, and a detection method of the polynucleotides or polypeptides encoded by the polynucleotides, and a kit and a primer set for detection are provided, based on the knowledge gained by the elucidation. In the detection method, a fusion gene comprising part of an SDC4, CD74, EZR, SLC34A2, LRIG3, or TPM3 gene and part of a ROS1 gene, or a fusion protein encoded by the fusion gene is detected. The primer set or the detection kit comprises a sense primer designed based on a portion encoding SDC4, CD74, EZR, SLC34A2, LRIG3, or TPM3 and an antisense primer designed based on a portion encoding ROS1.
US09109253B2
A method for detecting a genetic polymorphism associated with Lavender Foal Syndrome or a predisposition thereto in a subject, the method including screening a genomic material sample from the subject for the presence of at least one polymorphism in a MYO5A gene.
US09109246B2
Provided are methods to identify modulators and in particular inhibitors of body malodour formation employing peptidase enzymes, the peptidase enzymes and corresponding nucleotide sequences, expression vectors, transfected host cells, methods of forming the peptidase enzymes and methods to prevent body malodour.
US09109236B2
A non-naturally occurring microbial organism having an isopropanol, 4-hydroxybutryate, or 1,4-butanediol pathway includes at least one exogenous nucleic acid encoding an isopropanol, 4-hydroxybutryate, or 1,4-butanediol pathway enzyme expressed in a sufficient amount to produce isopropanol, 4-hydroxybutryate, or 1,4-butanediol. The aforementioned organisms are cultured to produce isopropanol, 4-hydroxybutryate, or 1,4-butanediol.
US09109235B2
The present invention provides enriched polynucleotides, and enriched polypeptides having pectinase activity. The present invention also includes methods of using the polynucleotides and polypeptides described herein. For instance, the methods include producing metabolic product, such as ethanol.
US09109229B2
This invention is a process for improving the production levels of recombinant proteins or peptides or improving the level of active recombinant proteins or peptides expressed in host cells. The invention is a process of comparing two genetic profiles of a cell that expresses a recombinant protein and modifying the cell to change the expression of a gene product that is upregulated in response to the recombinant protein expression. The process can improve protein production or can improve protein quality, for example, by increasing solubility of a recombinant protein.
US09109228B2
Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3′-untranslated region of CD154.
US09109227B2
The present invention relates to FLT3 receptor antagonists or inhibitors of FLT3 receptor gene expression for the treatment or the prevention of pain disorders.
US09109221B2
Semi-permeable particle can be used to facilitate chemical reactions such as catalytic reactions. The semi-permeable particles are permeable to molecules having a molar mass of 1000 Daltons or less and have a mode particle size of at least 1 μm. The semi-permeable particles have multiple discrete cavities containing an aqueous solution or suspension of an organic catalytic material. The semi-permeable particles are also impermeable to the organic catalytic materials so they are retained within the multiple discrete cavities, and the semi-permeable particles can be reused multiple times for the same or different chemical reaction.
US09109216B2
A recombinant gram-negative bacterial cell comprising one or more of the following mutated protease genes: a) a mutated Tsp gene, wherein the mutated Tsp gene encodes a Tsp protein having reduced protease activity or is a knockout mutated Tsp gene; b) a mutated ptr gene, wherein the mutated ptr gene encodes a Protease III protein having reduced protease activity or is a knockout mutated ptr gene; and c) a mutated DegP gene encoding a DegP protein having chaperone activity and reduced protease activity; wherein the cell is isogenic to a wild-type bacterial cell except for the mutated Tsp gene and/or mutated ptr gene and/or mutated DegP gene and optionally a polynucleotide sequence encoding a protein of interest.
US09109210B2
The present invention provides the field of enhancing proteins and in particular to that of proteins enhanced by molecular change. It provides a variant of a phytase that is termed enhanced in that is has better thermostability and/or activity than the original phytase. The invention also provides a nucleic acid coding for said variant, a cassette or an expression vector containing said variant, a host cell expressing said variant, a composition comprising said variant and uses thereof, principally in the preparation of food additives and animal feed.
US09109207B2
The present invention relates to a recombinant process for the production of truncated or mutated dextransucrases while conserving the enzymatic activity or their specificity in the synthesis of the α-1,6 bonds. The present invention relates to nucleic acid sequences of truncated or mutated dextransucrases, vectors containing the nucleic acid sequences and host cells transformed by sequences encoding truncated or mutated dextransucrases. In another aspect, the invention concerns a method for producing, in a recombinant manner, truncated or mutated dextransucrases which conserve their enzymatic activity or which conserve their specificity in the synthesis of α-1,6 bonds and can produce, from saccharose, dextrans with high molar mass and modified rheological properties compared with the properties of dextran obtained with the native enzyme and isomalto-oligosaccharides with a controlled molar mass and dextrans. The dextrans and isomalto-oligosaccharides of the invention can be used namely as texturing agents or as prebiotics.
US09109198B2
A method of processing an adipose tissue to collect adipose derived regenerative cells is provided, wherein the method comprises providing a vessel comprising a fluid jet mixer; introducing the adipose tissue into the vessel; introducing a buffer solution into the vessel; washing the adipose tissue using the fluid jet mixer; introducing an enzyme solution into the vessel; initiating jet mixing into the vessel comprising the adipose tissue, the enzyme solution, and the buffer solution using the fluid jet mixer to digest the adipose tissue to form a digestion product; phase-separating the digestion product into a digested buoyant fat layer and a non-buoyant aqueous layer; and collecting the non-buoyant aqueous layer comprising the adipose derived regenerative cells. A system of processing an adipose tissue to collect adipose derived regenerative cells is also provided.
US09109195B2
Disclosed is a deposition apparatus (100) which is designed to deposit frozen biological material (1) in a target substrate (2) and includes a charging device (10) and a driving device (20). The charging device (10) is designed to supply the biological material (1) to the driving device (20) while the driving device (20) is designed to apply a driving force to the biological material (1). In order to apply the driving force, the driving device (20) is formed such that the biological material (1) can penetrate into the target substrate (2) under the effect of the driving force. Also disclosed are an injector cartridge which is designed to provide frozen biological material in a deposition apparatus as well as a method for depositing biological material (1) in a target substrate (2).
US09109194B2
When multiple kinds of bacterial colonies are present in a petri dish and, for example, a drug tolerance is to be measured, harvesting of mixed colonies of different types of bacteria makes it impossible to accurately determine the drug tolerance. Also, it is required to improve the throughput of a device for harvesting a bacterial colony. From images illuminated from multiple directions, isolating bacterial colonies are automatically extracted. Next, the image feature amounts are calculated from the multiple images that are illuminated from multiple directions and colonies are grouped depending on the feature amounts. Then, bacterial colonies to be harvested are determined based on the results of the grouping.
US09109186B2
Compounds of formula (I) wherein R is methyl or ethyl, having floral, green odor notes, their use as fragrance and perfumed products comprising them.
US09109185B2
An object of the present invention is to provide a sliding member capable of rapidly wrapping a mating member, and reducing the surface roughness of the mating member after wrapping. The present invention relates to a sliding member for sliding with a mating member subjected to hardening treatment, the sliding member including a coating layer containing a binder resin, molybdenum disulfide, and hard substance particles in massive form.
US09109180B2
The present invention relates to a continuous method for the hydrothermal carbonization of renewable raw materials and organic residues, in which, in a first processing stage, a pressure increase essentially to the pressure level of the carbonization occurs, in the second processing stage, the carbonization, which is performed at a pressure of at least 5 bar and at most boiling temperature, the obtained carbonized product is at least partially settled as sediment, and the filling height of the water in the second processing stage is set by removing water, and the temperature of the sediment delivered from the second processing stage is reduced by the vaporization of water and it is supplied to the third processing stage, drying which is heated using steam, in which the drying is performed in steam atmosphere, and subsequently discharged from the process.
US09109176B2
This invention relates to low sulfur marine/bunker fuel compositions and methods of making same. Contrary to conventional marine/bunker fuel compositions/methods, the inventive lower sulfur compositions/methods focus on use of mostly uncracked components, such as (cat feed) hydrotreated gasoils, and/or can also have reduced contents of residual components.
US09109172B2
A low-temperature gasification system comprising a horizontally oriented gasifier is provided that optimizes the extraction of gaseous molecules from carbonaceous feedstock while minimizing waste heat. The system comprises a plurality of integrated subsystems that work together to convert municipal solid waste (MSW) into electricity. The subsystems comprised by the low-temperature gasification system are: a Municipal Solid Waste Handling System; a Plastics Handling System; a Horizontally Oriented Gasifier with Lateral Transfer Units System; a Gas Reformulating System; a Heat Recycling System; a Gas Conditioning System; a Residue Conditioning System; a Gas Homogenization System and a Control System.
US09109171B2
A system includes an integrated gasification vessel including an enclosure including a first section and a second section that may enclose a gasifier, one or more injectors circumferentially disposed within the gasifier. The one or more injectors may supply the gasifier with a fuel. The system also includes a syngas cooler disposed within an annulus of the gasification vessel. The syngas cooler includes a shell that may flow a coolant and the syngas cooler includes a plurality of tubes surrounding the gasifier and that may flow a syngas from the gasifier. The system further includes a reinforcement system configured to reinforce at least a portion of the enclosure and the gasifier. The reinforcement system may include one or more reinforcement beams disposed within the annulus and that may couple the enclosure and the gasifier.
US09109170B2
An improved biodiesel production process includes the steps of processing a feedstock to produce biodiesel, cooling the biodiesel so as to form sediment, and filtering the biodiesel to remove the sediment. The resulting biodiesel from the cold filtration process avoids problems of sediment formation during storage and transportation.
US09109169B2
A gasoline blending components production system useful for producing both aromatics and gasoline blending components from naphtha. The production system includes a light hydrocracked naphtha splitter, a medium hydrocracked naphtha splitter, a naphtha hydrotreater, an isomerization unit, a continuous catalytic reformer and aromatics complex. The production system is operable to produce both refined benzene and para-xylene products in addition to medium hydrocracked naphtha, isomerate, a C7s cut and a C9+ cut, which are useful for gasoline blending without additional treatment. A method for producing gasoline blending components while maximizing aromatic production includes introducing both stabilized hydrocracked naphtha to the light hydrocracked naphtha splitter and straight run naphtha to the naphtha hydrotreater. Operating the production system produces three types of hydrocracked naphtha: a light hydrocracked naphtha, a medium hydrocracked naphtha and a heavy hydrocracked naphtha. Light and heavy hydrocracked naphtha are directed to the naphtha hydrotreater.
US09109162B2
Aspects of the present invention provide a family of phosphor compositions that may be used in the field of lighting applications. These phosphor compositions have crystal structures and chemical bond arrangements that enable broad band absorption and excitation using radiation up to and including the blue wavelength region. A preferred embodiment of the phosphor compositions has a general formula of (AxAy . . . Az)3−(1+q)m(W1−rMor)O6:Lnm,Dqm, wherein x+y+ . . . +z=1; 0≦r≦1; 0≦q≦1; 0
US09109143B2
The present invention is related to adhesive compositions and their applications. In particular, the adhesive compositions described herein comprise a two or more propylene-based copolymers with varying comonomer content.
US09109137B2
The present invention relates to (meth)acrylated compounds (A) prepared from (a) at least one cyclic ether polyol, (b) at least one linking compound (b1) and/or (b2), wherein the linking compound (b1) is selected from cyclic compounds (b11) containing at least one (I) group in the cycle where X=O or NH, from hydroxy acids (b12) and/or from alkylene oxides (b13) containing from 2 to 4 carbon atoms and the linking compound (b2) is selected from epihalohydrins or polyisocyanates, (c) a (meth)acrylating compound; and to their use in radiation curable compositions for the coatings, inks, overprint varnishes, adhesives and composites.
US09109136B2
A photopolymerizable inkjet ink including: at least one selected from the group consisting of (meth)acrylic acid esters negative for skin sensitization and (meth)acrylamides negative for skin sensitization; and at least one selected from the group consisting of vinyl ethers negative for skin sensitization, t-butyl methacrylate negative for skin sensitization, n-pentyl methacrylate negative for skin sensitization, and n-hexyl methacrylate negative for skin sensitization.
US09109133B2
The ink jet ink includes pigment, first resin which has a glass-transition temperature of less than 20° C. and a weight-average molecular weight of not more than 10000, second resin which has a glass-transition temperature of not less than 23° C., and specific polyoxyalkylene glycol monoalkyl ether.
US09109129B2
An inkjet ink of the present invention including: water; an organic solvent; a surfactant; and a colorant, wherein the organic solvent comprises the following (1), (2) and (3): (1) at least one polyhydric alcohol having an equilibrium moisture content of 30% by mass or higher at a temperature of 23° C. and humidity of 80% RH; (2) an amide compound expressed by the Structural Formula (I); (3) a compound expressed by the Structural Formula (II); a compound expressed by the Structural Formula (III), or a compound represented by the General Formula (I), or any combination thereof.
US09109125B2
An ink composition for ultraviolet curable ink jets including monomer A represented by a general formula (I): CH2═CR1—COOR2—O—CH═CH—R3 (I) (in the formula, ‘R1’ represents a hydrogen atom or methyl group, ‘R2’ represents a divalent organic residue having a carbon number of 2 to 20, and ‘R3’ represents a hydrogen atom or a monovalent organic residue having a carbon number of 1 to 11), and a photopolymerization initiator containing an acylphosphine oxide-based photopolymerization initiator and a thioxanthone-based photopolymerization initiator, in which the total content of the acylphosphine oxide-based photopolymerization initiator and the thioxanthone-based photopolymerization initiator is 8% by mass to 16% by mass with respect to the total mass of the ink composition.
US09109115B2
The invention relates to a polyamide moulding compound made of a polyamide (PA MACM12) made of bis(3-methyl-4-aminocyclohexyl)methane (MACM) and dodecanedioic acid, a polyamide (PA PACM12) made of bis(4-aminocyclohexyl)methane (PACM) and dodecanedioic acid, a polyamide (PA MACM10) made of bis(3-methyl-4-aminocyclohexyl)methane and decanedioic acid, a polyamide (PA PACM10) made of bis(4-aminocyclohexyl)methane and decanedioic acid, a polyamide (PA MACM14) made of bis(3-methyl-4-aminocyclohexyl)methane and tetradecanedioic acid, a polyamide (PA PACM14) made of (bis(4-aminocyclohexyl)methane and tetradecanedioic acid and also mixtures and copolyamides thereof. Furthermore, the moulding compound comprises as impact modifier a functionalised styrene-ethylene/butylene-styrene block copolymer and also possibly further additives. Likewise, the invention relates to moulded articles produced from this polyamide moulding compound.
US09109106B2
The present invention relates to polymer compositions comprising a propylene impact copolymer and a processing aid, as well as corrugated boards made from such compositions. The impact copolymer has a melt flow range of from 1.5 to 3.5 g/10 min and a dispersed phase content of from 5 to 30% by weight. The dispersed phase of the impact copolymer has an ethylene content of from 30- to 70% by weight of the dispersed phase. The matrix phase of the impact copolymer is a propylene homopolymer or a random copolymer comprising units derived from propylene and a second copolymer selected from either ethylene or 1-butene wherein the units derived from the second copolymer comprise from 0 to 5% by weight of the dispersed phase.
US09109105B2
A process for preparing a multimodal polyethylene product with at least two different polyethylene resins can include producing a first polyethylene resin in the presence of a Ziegler-Natta catalyst in a reactor. The Ziegler-Natta catalyst used for the production of the first polyethylene resin has an average particle size (D50) of at most 15 μm. The HLMI of the first polyethylene resin is between 0.01 and 5 g/10 min. The process can include separately producing a second polyethylene resin in the presence of a Ziegler-Natta catalyst in a reactor. The MI2 of the second polyethylene resin is between 1 and 150 g/10 min. The process can include physically blending together the first and second polyethylene resins to produce a multimodal polyethylene product. The physical blending can be performed in a device for continuously melting and blending the first and second polyethylene resins.
US09109104B2
There is provided a resin composition affording a melt-molded article having excellent gas barrier properties and flex crack resistance. The present invention relates to a resin composition comprising a polyvinyl alcohol resin (A) having a 1,2-diol structural unit represented by the following general formula (1), a styrene-based thermoplastic elastomer (B), and a polyamide graft block copolymer (C) containing a polymer block of an aromatic vinyl compound and a polymer block of an olefinic compound in a main chain and having a graft chain composed of a polyamide: wherein each of R1, R2, and R3 independently represents a hydrogen atom or an organic group, X represents a single bond or a linking chain, and each of R4, R5, and R6 independently represents a hydrogen atom or an organic group.
US09109103B2
The present invention is directed to a functionalized elastomer comprising the reaction product of a living anionic elastomeric polymer and a polymerization terminator of formula I wherein R1 is C1 to C4 linear or branched alkanediyl; Z is R2, —OR3, or —R4—X; R2, R3 are independently C1 to C18 linear or branched alkyl; R4 is C1 to C18 alkanediyl; X is halogen or a group of structure II, III, IV, V or VI wherein R5, R6, R7, R8, and R9 are independently H or C1 to C8 alkyl; R10 is C2 to C8 alkanediyl; R11 and R12 are independently H, aryl or C1 to C8 alkyl; Q is N or a group of structure VII wherein R13 is C1 to C8 alkyl.
US09109098B2
The present invention provides carbon black, the standard deviation σ of aggregate size distribution of which is obtained by alight scattering method using an ultraviolet ray, the standard deviation σ satisfying the expression (1): σ<−48.7×(24M4DBP/Dst)+161.8 (1). In the expression (1), 24M4DBP represents the dibutyl phthalate absorption number (cm3/100 g) of compressed sample, and Dst (nm) is a Stokes' equivalent diameter providing the mode in aggregate size distribution obtained by a centrifugal sedimentation method. The carbon black can improve both the abrasion resistance and the low rolling resistance of a tire. The present invention also provides a rubber composition mixed with this carbon black, and a pneumatic tire including a tread part formed by using this rubber composition.
US09109097B2
The present invention relates to a method of preparing a super absorbent polymer (SAP). The preparation method for SAP according to the present invention includes: preparing a first polymer by carrying out a thermal polymerization or photo polymerization of a monomer composition comprising a water-soluble ethylene-based unsaturated monomer and a polymerization initiator; preparing a second polymer by carrying out a thermal polymerization or photo polymerization of a monomer composition comprising a water-soluble ethylene-based unsaturated monomer and a polymerization initiator; drying the first polymer; milling the dried first polymer; and mixing the milled first polymer with the second polymer in the free swelling state using the crosslinking solution to cause a crosslinking reaction of the first and second polymers. According to the present invention, it is possible to obtain a super absorbent polymer (SAP) having high centrifuge retention capacity and high absorption under pressure.
US09109092B2
Disclosed is a method for preparing a semi-furanic copolyamide containing at least one furanic dicarboxylic acid moiety and at least one aliphatic diamine moiety in the backbone. The method is based on solid-state polymerization. Particularly, the method uses a biomass-derived furanic dicarboxylic acid as a raw material. A semi-furanic copolyamide prepared by the method has molecular weight and color levels that are practically required in industrial applications. In addition, the semi-furanic copolyamide can replace fossil fuels due to its good thermal stability and is suitable for use as an environmentally friendly bioplastic.
US09109087B2
A branched polyamine comprises about 8 to about 12 backbone tertiary amine groups, about 18 to about 24 backbone secondary amine groups, a positive number n′ greater than 0 of backbone terminating primary amine groups, and a positive number q greater than 0 of backbone terminating carbamate groups of formula (2): wherein (n′+q) is a number equal to about 8 to about 12, the starred bond of formula (2) is linked to a backbone nitrogen of the branched polyamine, L′ is a divalent linking group comprising 3 to 30 carbons, and q/(n′+q)×100% equals about 9% to about 40%.
US09109084B1
Methods of synthesizing polymers including repeat units of the formula comprise the step of polymerizing repeat units of the formula in the presence of a free radical catalyst, where each R and each M is separately and independently selected from the group consisting of H, C1-C12 straight or branched chain alkyl, aryl, amine, amide, and ester groups, halides, and mixtures thereof, and n ranges from about 2-15.
US09109077B2
The present invention relates to foamed polyurethane obtainable by mixing a) polyisocyanates, b) relatively high molecular weight compounds having groups reactive toward isocyanate groups, c) solid particles, d) blowing agents, e) if appropriate, chain extender, crosslinking agent or mixtures thereof, f) if appropriate, catalyst and g) if appropriate, other additives to give a reaction mixture and allowing the reaction mixture to react to completion, the propotion of chain extender being less than 6% by weight, based on the total weight of the components a) to f), the content of solid particles being greater than 15% by weight, based on the total weight of the components a) to f), and the average functionality of the relatively high molecular weight compounds having groups reactive toward isocyanate groups being less 2.5. The present invention furthermore relates to a molding comprising a foamed polyurethane according to the invention, a process for the preparation of the foamed polyurethane according to the invention and the use of a molding according to the invention as a shoe sole.
US09109070B2
Methods of synthesizing a binary polymer functionalized nanoparticle are generally provided. In one embodiment, a first anchoring compound is attached to a nanoparticle, and a first plurality of first monomers are polymerized on the first anchoring compound to form a first polymeric chain covalently bonded to the nanoparticle via the first anchoring compound. In another embodiment, a first polymeric chain can be attached to the nanoparticle, where the first polymeric chain has been polymerized prior to attachment to the nanoparticle. Thereafter, a second anchoring compound is attached to the nanoparticle, and a second plurality of second monomers are polymerized on the second anchoring compound to form a second polymeric chain covalently bonded to the nanoparticle via the second anchoring compound. Nanoparticles are also generally provided having multiple polymeric assemblies.
US09109069B2
The present invention provides a vinyl ester resin composition obtained by an improved production method and having improved quality, by providing a minute polymer particle-containing vinyl ester resin composition containing 100 parts by weight of a vinyl ester resin, 1 to 100 parts by weight of a minute polymer particle, and 0 to 100 parts by weight of a vinyl monomer, wherein the primary particle size of the minute polymer particle is 0.05 μm to 1 μm, and the minute polymer particles are dispersed in the form of primary particles in the minute polymer particle-containing vinyl ester resin composition.
US09109064B2
The present invention relates to an ethylene homo- or copolymerization process, characterized in that an inhibitor is added to the reaction mixture or any of its components before the reaction mixture is fed to the reaction zone. The present invention further relates to the use of an inhibitor to reduce fouling in an ethylene homo- or copolymerization process.
US09109050B2
The present invention concerns a process for preparing of slurries containing suspended and dissolved particles and a solution as well as a slurry are provided onto a hydrocyclone equipment, disk centrifuge or nozzle centrifuge equipment. The dry matter concentration in the collected slurry is higher than the concentration of the mixture of the slurry and the solution as such. The use of a hydrocyclone stage for this specific purpose is disclosed as well.
US09109048B2
The present invention provides a cytotoxic 7 to 25 mer peptide with three or more cationic residues which has one or more non-genetic bulky and lipophilic amino acids, as well as esters, amides, salts and cyclic derivatives thereof as well as methods of preparing the peptides, pharmaceutical compositions containing them and their use as medicaments, particularly as antibacterions or antitumoral agents. In a preferred aspect, the invention provides the use of said peptides in a method of inducing adaptive immunity against tumor growth or establishment in a subject, as well as the use of other lytic agents in a method of inducing adaptive immunity in a subject.
US09109047B2
The present invention relates to methods for generation of high molecular ordered fibrilar structures. More particularly, the method of the invention utilizes CBD's (cellulose binding domain) ability to form dimers for directing ordered assembly of fibrous proteins such as silk proteins into super-molecular fibrilar structures. The invention further provides fibrilar structures such as fibers and articles comprising said fibrilar structures.
US09109041B2
The present invention refers to analog compounds of peptides having the amino acid sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, including analgesic peptides derived from snakes of species such as Crotalus durissus terrificus; their uses in the treatment, diagnosis and prevention of painful conditions or mediated by opioid receptors, their pharmaceutical compositions and their methods of preparation and purification, including their uses in the identification of analgesic compounds.
US09109037B2
The present invention features anti-SOD1 antibodies and methods of using the antibodies for the treatment of amyotrophic lateral sclerosis (ALS) or the amelioration of symptoms associated with ALS.
US09109030B1
Epsi-gam provides a novel fusion protein with the ability to cross-link either of the FcεRI or FcεRII cell surface receptors with an FcγRIIb cell surface receptor in order to block IgE-mediated biological responses.
US09109025B2
The present invention relates to RSPO-binding agents and methods of using the agents for treating diseases such as cancer. The present invention provides antibodies that specifically bind human RSPO proteins and modulate β-catenin activity. The present invention further provides methods of using agents that modulate the activity of RSPO proteins, such as antibodies that specifically bind RSPO1, RSPO2, and/or RSPO3 and inhibit tumor growth. Also described are methods of treating cancer comprising administering a therapeutically effect amount of an agent or antibody of the present invention to a patient having a tumor or cancer.
US09109022B2
Provided are methods of making carrier polypeptide that include incorporating a first unnatural amino acid into a carrier polypeptide variant, incorporating a second unnatural amino acid into a target polypeptide variant, and reacting the first and second unnatural amino acids to produce the conjugate. Conjugates produced using the provided methods are also provided. In addition, orthogonal translation systems in methylotrophic yeast and methods of using these systems to produce carrier and target polypeptide variants comprising unnatural amino acids are provided.
US09109020B2
The invention concerns the use of human or humanized chimeric monoclonal antibodies which are produced in selected cell lines, said antibodies bringing about a high ADCC activity as well as a high secretion of cytokines and interleukins, for treating underpopulations of so-called weak-response patients exhibiting CD16 FCGR3A-158F homozygote or FCGR3A-158V/F heterozygote polymorphism.
US09109015B2
The present invention is related to a method of isolating a biological macromolecule in a composition. Specifically, the present invention is directed to a method of isolating a biomacromolecule in a composition containing an impurity, the method comprising (a) lowering the pH of the composition, (b) adding a divalent cation to the composition, and (c) separating the biomacromolecule from the impurity.
US09109007B2
The invention provides for the synthesis of more effective generators of a T-cell immune response by providing peptide derivatives that are MHC class I-restricted antigens. The peptide derivatives of the present invention are prepared or derived from a parent peptide of 8 to 11 amino acid residues in length, wherein the peptide derivative contains a non-natural amino acid substituted in place of a naturally-occurring amino acid residue at one or more primary anchor positions in the parent peptide or at position 6, position 7, or the C-terminus. The exemplary polypeptides are derived from the survivin, hTERT, CYP1B1 and MART-1 antigens.
US09109004B2
The invention relates to 17-hydroxy-17-pentafluoroethyl-estra-4,9(10)-dien-11-aryl derivatives of formula I with progesterone-antagonizing action and methods of production thereof, use thereof for the treatment and/or prevention of diseases and use thereof for producing medicinal products for the treatment and/or prevention of diseases, in particular uterine fibroids (myomata, uterine leiomyomata), endometriosis, heavy menstrual bleeding, meningiomata, hormone-dependent breast cancers and menopause-associated complaints or for fertility control and emergency contraception.
US09109002B2
Methods and compositions using E-selectin antagonists are provided for the treatment and prevention of diseases and disorders treatable by inhibiting binding of E-selectin to an E-selectin ligand. Described herein are E-selectin antagonists including, for example, glycomimetic compounds, antibodies, aptamers and peptides that are useful in methods for treatment of cancers, and treatment and prevention of metastasis, inhibiting infiltration of the cancer cells into bone marrow, reducing or inhibiting adhesion of the cancer cells to endothelial cells including cells in bone marrow, and inhibiting thrombus formation.
US09108995B2
The present invention relates to a spirobenzylamine-phosphine, preparation method therefor and use thereof. The compound has a structure represented by formula (I), wherein n=0 to 3; R1, R2, R3, R4, R5, R6, R7, R8 and R9 having a value as defined in claim 1. Starting from the substituted 7-trifluoromesyloxy-7′-diarylphosphino-1,1′-spiro-dihydroindene, the compound is synthesized in a two-step or three-step reactions. The new spirobenzylamine-phosphine is complexed with an iridium precursor and is subjected to ion exchange, to give an Iridium/spirobenzylamine-phosphine complex comprising various anions. The spiro benzyl amine-phosphine/Iridium complex according to the present invention may be used for catalyzing asymmetry hydrogenation of a variety of alpha-substituted acrylic acids, has high activity and enantio-selectivity, and has a good prospect of industrialization.
US09108993B2
The present invention relates to pyrazole derivatives, processes for preparing them, pharmaceutical compositions containing them and their use as pharmaceuticals as modulators of sphingosine-1-phosphate receptors.
US09108992B2
The invention relates to a composition of a carboxyl-functionalized silicon-containing precursor compound of at least two different organic acids, said composition having two, three, or four carboxyl groups functionalized with various hydrocarbon groups according to formula I and/or II. Said carboxyl groups can be released as carboxylic acids and can be used as silane hydrolysis catalysts and/or silane condensation catalysts. The invention further relates to methods for producing the composition, to the use of the composition for cross-linking polymers, and to a formulation of the composition in the form of a masterbatch.
US09108971B2
The invention relates to the 6-cycloamino-3-(pyridazin-4-yl)imidazo[1,2-b]pyridazine derivatives corresponding to general formula (I): Wherein R2, R7, R8, A, L and B are as defined herein. Also disclosed are the preparative methods and therapeutic use thereof.
US09108969B2
The present invention relates to certain substituted tricyclic acid derivatives of Formula (I) and pharmaceutically acceptable salts thereof, which exhibit useful pharmacological properties, for example, as agonists of the S1P1 receptor. Also provided by the present invention are pharmaceutical compositions containing compounds of the invention, and methods of using the compounds and compositions of the invention in the treatment of S1P1 -associated disorders, for example, psoriasis, rheumatoid arthritis, Crohn's disease, transplant rejection, multiple sclerosis, systemic lupus erythematosus, ulcerative colitis, type I diabetes, acne, myocardial ischemia-reperfusion injury, hypertensive nephropathy, glomerulosclerosis, gastritis, polymyositis, thyroiditis, vitiligo, hepatitis, biliary cirrhosis, microbial infections and associated diseases, viral infections and associated diseases, diseases and disorders mediated by lymphocytes, auto immune diseases, inflammatory diseases, and cancer.
US09108967B2
The present application is directed to an efficient conversion of C-14 hydroxylated morphine alkaloids to various morphine analogs, such as naltrexone, naloxone and nalbuphone. One feature of this process is an intramolecular functional group transfer from the C-14 hydroxyl to the N-17 nitrogen atom following a palladium-catalyzed N-demethylation.
US09108966B2
Aryl substituted diazabicyclooctanes (DBO) compounds that inhibit β-lactamases of class A, class C or class D and potentiate β-lactam antibiotics are disclosed. In particular, this disclosure provides DBO compounds that, when used in the disclosed Synergy MIC Assay with a β-lactam antibiotic at a fixed concentration have an MIC of 8 μg/mL or less against one or more isogenic β-lactamase expressing bacterial strains.
US09108960B2
The present invention provides nitrofurfuryl substituted phenyl linked piperidino-oxadiazolone compounds of general formula (A) as anti-tubercular agents; wherein G=formula (B); X═H, F; R═H, CH3, C2H5, Benzyl.
US09108952B2
The invention disclosed in this document is related to the field of processes to produce certain 2-(pyridine-3-yl)thiazoles as intermediates for the synthesis of pesticidal thiazole amides.
US09108939B2
The present invention relates to (1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)phenyl derivatives having the general formula (I) to pharmaceutical compositions comprising the same and to the use of these (1,1,1,3,3,3-hexafluoro-2-hydroxy-propan-2-yl)phenyl derivatives in the treatment of atherosclerosis.
US09108937B2
The present invention is directed to 5-substituted 1,3-dihydro-2,1,3-benzothiadiazole 2,2-dioxide and 1,3-dihydro[1,2,5]thiadiazolo[3,4-b]pyridine 2,2,-dioxide derivatives which are potentiators of metabotropic glutamate receptors, particularly the mGluR2 receptor, and which are useful in the treatment or prevention of neurological and psychiatric disorders associated with glutamate dysfunction and diseases in which metabotropic glutamate receptors are involved. The invention is also directed to pharmaceutical compositions comprising these compounds and the use of these compounds and compositions in the prevention or treatment of such diseases in which metabotropic glutamate receptors are involved.
US09108930B2
The present invention provides inhibitors of a wide variety of serine hydrolase enzymes. The inhibitors of the present invention are N1- and N2-carbamoyl-1,2,3-triazole compounds such as those of Formula (I): in which N1, N2, and N3 are the nitrogen atoms at positions 1, 2, and 3, respectively, of the triazole ring, and R4, R5, R6 and R7 in Formula (I) are as described herein. Methods of inhibiting serine hydrolase enzymes and methods of preparing carbamoyl-1,2,3-triazole compounds also are described.
US09108924B2
The present invention relates to an improved process for the synthesis of bendamustine, in particular, bendamustine hydrochloride of the formula (VI) and its intermediate 1-methyl-5-[bis(2-chloroethyl)amino]-1H-benzimidazol-2-yl]lithium butanoate of formula (V), both having a purity of ≧99%, which is simple, convenient, economical, does not use hazardous chemicals and is industrially viable.
US09108921B2
Compounds of general formula I: and compositions comprising compounds of general formula I that modulate pyruvate kinase are described herein. Also described herein are methods of using the compounds that modulate pyruvate kinase in the treatment of diseases.
US09108916B2
Compounds of the general structural formula (I) and (II) and use of the compounds and salts and hydrates thereof, as therapeutic agents are disclosed. Treatable diseases and conditions include cancers, inflammatory diseases and conditions, and immunodeficiency diseases. (I), (II).
US09108900B2
The invention relates to a medicament containing (S)-2-N-propylamino-5-hydroxytetralin, the salts or prodrugs thereof. As a D3 agonist, (S)-2-N-propylamino-5-hydroxytetralin is suitable particularly for the treatment of dopa-sensitive movement disorders.
US09108887B2
Provided is a process for producing a ceramic for a heat-radiating member. The process includes providing as a raw material an alumina powder having an alumina (Al2O3) content of at least 99.5 mass % and an average particle size of from 0.2 to 1 μm, and granulating the powder into a granular form ranging from 50 to 100 μm, pressing the raw material which has been obtained in the granulation step and which includes granular alumina, and heating a green compact in an air atmosphere at a firing temperature of from 1,480 to 1,600° C. to obtain a sintered body. Also provided is a process for producing a ceramic for a heat-radiating member, the ceramic being a sintered alumina body which has high thermal conductivity, efficient heat dissipation, excellent mechanical strength and thermal shock resistance and which is usable for cooling applications at heat generating areas of electronic devices and equipment.
US09108882B2
The invention relates to a transparent glass substrate including at least one glass sheet provided with a thin-film multilayer coating acting on solar radiation, having a light transmission of greater than 10% and an emissivity of less than 50% after a heat treatment, such as a bending or toughening treatment, characterized in that said multilayer coating includes: a niobium Nb functional layer with a thickness of between about 5 nm and about 35 nm; and at least one layer of another material, chosen from the group formed by Ti, Mo, B, Al or an alloy comprising at least one of these elements, which is placed relative to the glass substrate above the functional layer, said layer having a thickness of between about 1 nm and about 5 nm. The invention also relates to monolithic glazing or double glazing incorporating such a substrate.
US09108878B2
Provided is the plate glass having high annealing temperature, high strength, excellent flatness and low viscosity, and manufacturing process thereof, which can be used for display and photovoltaic solar device. The plate glass contains (in mass %) boron oxide 0-3.9%, sodium oxide 0.01-14%, iron oxide 0.01-5%, fluorine oxide 0%, magnesia 7-22.2%, alumina 0.01-39%, wherein the content of silica is 1.9-4.1 times that of calcium oxide, the content of calcium oxide is 1.0-1.8 times that of magnesia.
US09108877B2
Provided is a glass base material elongation method for elongating a glass base material with a large diameter to manufacture a glass rod with a smaller diameter, the method comprising, when elongating a glass base material that has a transparent glass tapered portion at one end of a trunk portion and a glass tapered portion including a non-transparent glass portion at the other end of the trunk portion, prior to the elongation, fusing a hanging dummy to an end of the transparent glass tapered portion, setting the hanging dummy in communication with a feeding mechanism, inserting the glass base material into a heating furnace beginning with the other end, and performing elongation.
US09108874B2
A process for making inorganic, metal oxide spheres that includes exposing solidified, molded microparticles that include a glass precursor composition to a temperature sufficient to transform the molded microparticles into molten glass and cooling the molten glass to form inorganic, metal oxide spheres.
US09108873B2
A glass-substrate manufacturing method according to an aspect of the invention is a method for manufacturing glass substrates by employing a down-draw process. In down-draw processing, a molten glass is made to overflow from a forming member and formed into a sheet glass and the sheet glass is then cooled while being drawn in a downward-flow direction. In this glass-substrate manufacturing method, after the sheet glass has separated from the forming member and when the temperature of the sheet glass is within a temperature region ranging from a temperature higher than the softening point to a temperature near the annealing point, the sheet glass is cooled by maintaining the viscosity of side sections of the sheet glass within a range of 109.0-1014.5 poise while applying a tension toward the side sections.
US09108869B2
A gasification system includes a water source, a downstream system configured to receive a first stream having water from the water source, and a carbon a carbon dioxide injector configured to adjust a pH of the water using a second stream having carbon dioxide to form pH-adjusted water.
US09108857B2
A process for ammonia saturation of a solid material capable of absorbing and desorbing ammonia, the solid material being composed of solid particles and includes placing the solid material in contact with a cooled surface, with the solid material being disposed against the cooled surface in a thin layer having a thickness of less than 100 mm. The process further includes injecting a stream of gaseous ammonia to be in contact with the solid material, while the solid material is in contact with the cooled surface.
US09108852B1
A method for producing an amorphous activated carbon material includes heating a carbon precursor to a temperature effective to form a partially-dense amorphous carbon, and activating the partially-dense amorphous carbon to produce an amorphous activated carbon. To facilitate efficient activation of the amorphous carbon, the carbonization is controlled to produce an amorphous carbon material that, prior to activation, has a density of from 85% to 99% of a maximum density for the amorphous carbon.
US09108836B2
A method for filling containers with a filling material under pressure using a filling system comprising a filling element, which has a liquid channel having a liquid valve in a filling element housing, wherein the liquid channel is connected to a liquid chamber of a filling material vessel, which is partially filled with filling material and under pre-stress or filling pressure, upstream of the liquid valve in the flow direction of the filling material and forms at least one discharge opening downstream of the liquid valve in the flow direction of the filling material, at which discharge opening the particular container is arranged with a container opening in a sealed position at least during the filling process, and wherein a probe is arranged in a return gas pipe.
US09108828B2
A lift mechanism is provided. The lift mechanism includes a frame having a base, a spine extending from the base and a table, adjustment units configured to permit table adjustments, an attachment mechanism by which the table is attachable to a rack frame and a driving unit configured to drive a load relative to the rack frame.
US09108825B2
A method of controlling a crane and a manipulator including determining the relative motion between a first platform including the crane and a second platform, determining the current position of the manipulator, and repositioning the manipulator to compensate for the relative motion between the first platform and the second platform and in accordance with operator commands.
US09108819B2
A folding apparatus for a combined body of a continuous sheet includes a standing guide member disposed at a predetermined position in a conveying direction, and standing an one end section of the combined body in a width direction by bending a predetermined section of the combined body in the width direction and forming a bent section; a folding guide member corresponding to the stood one end section in the conveying direction for folding the stood one end section by laying the one end section towards a section located closer to another side than the one end section in the combined body; and a shift-regulating guide member for regulating shifting of the combined body towards the one side in the width direction by coming into contact, from the one side, with the combined body when laying the one end section towards the section located closer to the other side.
US09108817B1
A web-guiding system for guiding a web of media travelling from upstream to downstream along a transport path in an in-track direction. A web-guiding structure includes an exterior surface having a pattern of alternating ridges and recesses formed into the exterior surface. The web of media travels past the web-guiding structure with the first side of the web of media contacting at least some of the ridges on the exterior surface of the web-guiding structure. The ridges and recesses are formed into the exterior surface of the web-guiding structure such that the exterior surface has a continuous and smooth surface profile in the cross-track direction having a specified maximum slope magnitude and a specified minimum radius of curvature magnitude.
US09108813B2
An image forming apparatus includes an image forming section that forms an image, a transport path section along which a recording material that is yet to undergo or has undergone image formation performed by the image forming section is transported, a transport unit that is provided in the transport path section and transports the recording material while nipping the recording material, an operated portion that is operated by a user and activates the transport unit such that the recording material is removed from the transport unit, and a notification unit that notifies a completion of the operation of the operated portion on the basis of a position of the recording material that is removed from the transport unit by the user's operation of the operated portion.
US09108812B2
A sheet feeder cassette that can be fitted in and drawn from in a direction perpendicular to a sheet feeding direction, the sheet feeder cassette having: a bottom for receiving a stack of sheets thereon; a pair of side stopper plates provided on the bottom in such a manner to be movable in a sheet-widthwise direction so as to determine a widthwise position of the stack of sheets; and at least one displacement preventive device that is located on the bottom, at a position according to a widthwise position of a loadable maximum size sheet, and that is capable of coming into contact with one of the side stopper plates, wherein when the one of the side stopper plates receives force from a stack of the maximum size sheets placed on the bottom, the displacement preventive device pushes back and supports the side stopper plate due to reaction.
US09108799B2
The purpose of the present invention is to provide a conveyor chain conveying a conveyance object such as a bucket while the conveyance object is mounted thereon, wherein the conveyance object can be conveyed to a predetermined position while both the conveyance object and the receiving member are not damaged by “biting” or “hooking” at upstream or downstream end in a conveying direction. An upstream tapered surface and a downstream tapered surface, which reduce the thickness of the receiving member gradually along the extended direction, are formed respectively at sides in the extended direction of a mounting surface of the receiving member. A locus of the mounting surface in a case in which the conveyor chain is meshed with and wound onto a sprocket is within a circle which is coaxial to the sprocket and whose tangent is a straight locus of the mounting surface in a case of conveying a bucket (conveyance object).
US09108793B2
Embodiments of the present invention provide cartons that they are designed and shaped to hold product, such as ice cream, that are made from a single, one-piece blank. The one-piece blank can be folded by the food product manufacturer on-site to create a container or carton, without having to be shipped in a pre-glued configuration. The cartons generally do not require polyethylene in order to maintain their shape. Some embodiments are designed so as to have a slight outward taper of the left and right side walls and the back wall, which provides a pleasing shape to consumers, potentially increasing marketing opportunities and sales.
US09108790B2
A system (and method) for use with a cooler having a plurality of interior, opposed vertical channels comprises a cutting board and a cutting board holding assembly. The cutting board holding assembly comprises a first vertical side wall coupled to and positioned opposite a second vertical side wall, the first and second side walls defining a receptacle configured to receive the cutting board. Further, the first and second side walls are configured to slidingly engage two opposed vertical channels of a cooler.
US09108789B2
A method for adhering a shaped fusible material (6) to a portion of a metallic container wall (2) comprising applying the shaped material to said wall portion in a contacting relationship, heating said wall portion with an induction heater to melt the contacting surface of the shaped fusible material, and cooling the assembly to re-solidify the melted surface of the fusible material; and products of the foregoing method.
US09108788B2
The invention relates to an apparatus for boiling an egg, comprising a device for providing microwave radiation in a confined space, comprising a holder with at least one cavity adapted to the shape of an egg with an eggshell, said cavity provided with a first layer surrounding the eggshell, said first layer: —is in heat exchanging contact with the shell of the egg; —has a dielectric constant with an imaginary part, ∈″, between 20-500 at a temperature between 0° C.-100° C. and at a microwave frequency of 2.45 GHz, and —having a layer thickness d of 1-6 millimeter and varying less than 30% over the egg, or said holder for holding at least one egg assembly adapted for cooking an egg using microwave radiation.
US09108786B2
A device for the transportation of vehicles, at a prescribed maximum height of the system, transports an increased possible number of vehicles on a given surface area. The device is suitable for transportation by air, sea, and land. In this context, the vehicles are not unloaded from the device, even in the case of combined land, sea, or air transportation. The device consists of a lower pallet and an upper pallet. The upper pallet is supported on booms which, in turn, rest on the lower pallet. The booms are individually height-adjustable so that the upper pallet can be tilted relative to the lower pallet in the longitudinal direction. At the second end, there is a support element on which the device can be moved in the lengthwise direction, at least if it has been slightly lifted at the opposite first end.
US09108780B2
The cardboard container has a base wall (10), a first lateral wall (11) and a second lateral wall (12), at two opposite longitudinal sides of the base wall (10), and which are foldable. A first series of tabs (2) each exhibit a first portion (21) exhibiting a through-hole (210) for inserting a bottle (F) and which is connected with the first lateral wall (11). A second series of tabs (3) each exhibit a first portion (31) exhibiting a through-hole (310) for insertion of a bottle (F) and which is connected in a single body with the second lateral wall (12) and with a second portion (33) fixed to the base wall (10). All the tabs are foldable, together with the first lateral wall (11) and the second lateral wall (12), such as to enable the container to take on a flattened configuration (I) and an opened-out volume (O).
US09108770B2
A re-sealable package and method which includes roll stock, a pressure sensitive label and a release member. The re-sealable package includes an outer layer laminated to an inner sealant layer. The pressure sensitive label has a first preselected shape and includes a pressure sensitive adhesive on one side. The side having the pressure sensitive layer is adhered to the inner sealant layer of the roll stock. The release member is formed in the outer layer, the release member having a second preselected shape which is smaller than the first preselected shape of the pressure sensitive label. As the release member is lifted from the pressure sensitive label, an area of the pressure sensitive adhesive is exposed to allow portions of the package to be removably adhered to the area of pressure sensitive adhesive.
US09108767B2
A device for the individual transport of fruit, comprising a single integral part, which comprises a central base (13) which is the starting point for a series of concentric sections (4) all of which are arranged in a single circumferential direction, and end in short end portions (6-6′) which connect to two handle structures (7) which comprise a hooking device in order to stabilize the position for use of the integral part in which is defined a shell space which houses the fruit, such as a watermelon (1), the surface of which closely matches the various elements of the integral part. Thus, in the operative position for use, the device according to the invention has a basket-type structure which closely matches the outer surface of the fruit.
US09108759B2
An interlocking crating batten system may include a middle section that has a top portion, a top edge, a bottom portion, a first end portion and a second end portion. The first end portion has a concave area and the second end portion has a convex area. The first end portion has a least one tab extended out from the bottom portion of the middle section. A base section may have a least one slot along a primary end. The base section may lay between the middle section and a crate, with at least one slot removably engaged with at least one tab. An attachment device may connect the middle section and the base section to the crate.
US09108755B2
A package includes a support member and a second support member coupled to a base member. The support members may be configurable between a heating position and a storage position. When in the heating position a recess is positioned below the support members. The package may be part of an assembly further including a flexible container. The flexible container may include a first portion with a food product and a second portion configured to receive liquid byproducts given off by the food product. The second portion of the flexible container may be received in the recess when the assembly is in the heating position.
US09108754B2
A horizontal plastic stretch wrapping apparatus includes a main frame, a plurality of control components, an electrical enclosure, a plurality of control buttons, a slip ring, a wrapping arm, and a wrap dispenser. The electrical enclosure and the plurality of control components are positioned within the main frame, and the plurality of control buttons is positioned on the main frame. The plurality of control buttons controls the plurality of control components and the electrical enclosure. The wrap dispenser is connected to the wrapping arm, and the wrapping arm is connected to the main frame. The slip ring is positioned in between the main frame and the wrapping arm and provides electrical power from the electrical enclosure to the wrap dispenser. Once the horizontal plastic stretch wrapping apparatus is powered, a skid can be horizontally wrapped with a wrapping material by the rotating wrapping arm.
US09108750B2
The invention related to a device comprising at least three insulation modules distributed around vibration equipment. Each module comprises at least two rigid parts, at least one of said parts being an outer part fixed to the carrier structure and at least one of said parts being an inner part fixed to the equipment or the stand (3) thereof. At least one elastomer insulating plug connects an inner part and an outer part and at least one of said parts carries two longitudinal flexible abutments and two tangential flexible abutments which each have a free end facing another respectively outer or inner rigid part, said free end being at a distance from the inner part in an idle position. The invention can be applied to satellite equipment.
US09108742B2
An example ram air turbine stow abort assembly includes a release pin movable between an engaged position that prevents rotation of a drive shaft and a released position that allows rotation of the drive shaft. A release lever is rotatable about an axis in response to the release pin being in the engaged position or the released position. A pawl has a link to the release lever. The link causes the pawl to move toward the axis from a locking position to a clearance position. The pawl is positioned to engage a lock when in the locking position to prevent movement of the ram air turbine assembly to a stowed position when the turbine blades are misaligned.
US09108739B2
According to an embodiment, a method provides information regarding the vicinity of a vehicle. The method includes, in the vehicle, providing a sensor signal representative of an environmental condition in a vicinity of the vehicle, transmitting the sensor signal over a power line in the vehicle, receiving the sensor signal transmitted over the power line and transmitting a corresponding wireless sensor signal in the vehicle, receiving the wireless sensor signal and recovering the sensor signal, and presenting the recovered sensor signal in a human-perceivable form.
US09108738B1
An apparatus comprises a refueling system for a number of fuel tanks, a primary valve, and a secondary valve. The refueling system has branches capable of distributing fuel into the number of fuel tanks. The primary valve is associated with a primary branch in the branches. The primary valve and the secondary valve are independently controlled to change a distribution of the fuel through the branches into the number of fuel tanks.
US09108729B2
A control module for an unmanned aerial vehicle is provided. In one example, the control module includes a plurality of control modes, wherein each control mode represents a different autonomy setting, a command generator configured to generate a command causing a selection of a first of the plurality of control modes for the unmanned aerial vehicle, and an intelligence synthesizer that automatically switches the unmanned aerial vehicle between the selected first of the plurality of control modes and a second of the plurality of control mode upon detection of a trigger event.
US09108716B2
An aircraft cabin has been reconfigured with a rear fuselage galley and a modified aft pressure bulkhead that enables the galley to be moved rearwardly to provide additional floor space in the aircraft cabin.
US09108713B2
A system comprising an aerial vehicle or an unmanned aerial vehicle (UAV) (100, 400, 1000, 1500) configured to control pitch, roll, and/or yaw via airfoils (141, 142, 1345, 1346) having resiliently mounted trailing edges opposed by fuselage-house deflecting actuator horns (621, 622). Embodiments include one or more rudder elements (1045, 1046, 1145, 1146, 1245, 1345, 1346, 1445, 1446, 1545, 1546) which may be rotatably attached and actuated by an effector member (1049, 1149, 1249, 1349) disposed within the fuselage housing (1001) and extendible in part to engage the one or more rudder elements.
US09108712B2
The invention relates to an airship comprising a flexible envelope having at least one adjustment region provided with two longitudinal adjustment elements mounted in opposition and mobile in relation to each other between a maximum distancing position and a minimum distancing position, the two longitudinal adjustment elements being connected to each other by a group comprising a plurality of cables crossing the inner space of the envelope, each of the cables cooperating with a plurality or tightening points provided along each longitudinal element. The cables are connected to at least one tightening module that can exert a tightening or loosening action on the cables and thereby bring the longitudinal adjustment elements closer together or move them further away.
US09108710B1
A pontoon boat has left and right pontoons extending longitudinally, a tunnel therebetween, and a deck supported thereon. Bow and stern ends, and a boat length therebetween, are defined by at least one of the pontoons and the deck. An opening of the deck communicating with a tunnel thereunder has an outboard engine mounted therein and a hatch disposed thereover. A longitudinal center plane is vertical and equidistant from the bow and stern ends. A drive unit of the engine has a driveshaft, a propeller shaft operatively connected thereto, and a propeller connected to the propeller shaft. A mounting bracket connects the drive unit to the deck. The engine is disposed forward of the stern end by a distance at least equal to one-fourth of the boat length. The engine is aligned with or rearward of a longitudinal center plane. A method of operating the pontoon boat is also disclosed.
US09108708B1
The invention relates to a small vessel marina which includes a stocks framework, which contains sliding elements at a distance from each other and joining beams between them, a boat trailer for a boat, which boat trailer is installed on top of the sliding elements and arranged movable along them, and in front of the boat trailer is connected a pier with steps with a connecting rail, which pier is movable along the boat trailer on top of the sliding elements.
US09108694B2
A bicycle fitting method for producing a bicycle is provided. The method includes the steps of receiving a bicycle riding information and a body measurement corresponding to a cyclist. According to the bicycle riding information, a bicycle model is provided. According to the body measurement and the selected bicycle model, a bicycle frame size and a set of bicycle geometric adjustment parameters are provided. According to the bicycle model, the bicycle frame size, and the set of bicycle geometric adjustment parameters, a bicycle which fits the cyclist is produced.
US09108692B2
There is described a manufacturing method of motor vehicles which achieves the object of reducing the costs deriving from the manufacturing of vehicles belonging to different segments and the costs deriving from the traditional assembly of vehicles which starts from the external shell onto which the elements forming the interiors and the mechanical members are assembled, by suggesting the arrangement of a single self-supporting structural element formed by composite material, already provided with many interior elements, to which a new other interior elements, bodywork elements and mechanical elements can be connected in any assembly order.
US09108686B2
An air guide assembly for a vehicle includes an air guide depending from an underside of the vehicle and an air guide extension contiguously disposed at one lateral end of the air guide. The air guide extension includes a tab received through a tab aperture defined in the air guide. The tab includes a tab feature facilitating sliding movement of the tab relative to the tab aperture due to an external force being applied to one of the air guide and the air guide extension.
US09108684B2
A load transmission performance of transmitting load efficiently in a vehicle longitudinal direction of a rocker is improved. At a load input portion of a rocker, a sectional surface area, that is orthogonal to the vehicle longitudinal direction, of a rocker outer panel is greater than a sectional surface area, that is orthogonal to the vehicle longitudinal direction, of a rocker inner panel. Accordingly, load is sufficiently distributed and inputted to the rocker outer panel. Accordingly, a bending moment, that bends toward a vehicle transverse direction inner side at the rocker inner panel, is suppressed.
US09108682B2
A vehicle underbody structure includes a floor panel that is provided to extend in a longitudinal direction of a vehicle body; a pair of rockers that are respectively provided along both side portions of the floor panel in the vehicle body to extend in the longitudinal direction of the vehicle body; and a cross member that is mounted in a bridging manner between the pair of rockers to be apart from a floor surface of the floor panel, and that has strength greater than that of the rocker.
US09108668B2
A steering apparatus is provided with: a specifying device which is configured to specify an environment of a road on which a vehicle travels, on the basis of a manipulated amount of the steering wheel manipulated by a driver and a change of the manipulated amount in a predetermined period.
US09108667B2
A motor vehicle steering system includes a knob for rotationally manipulating a steering member and a knob reaction force actuator for giving a reaction force in response to the rotation of the knob. The knob has a knob center and is supported by the steering member in a manner rotatable about the knob center. Holding the knob and manipulating the steering member causes the knob to rotate (spin) about the knob center as the steering member rotates. The knob reaction force actuator then gives an appropriate reaction force in response to the rotation (spinning) of the knob.
US09108659B2
A stroller may include a frame and at least two adapters. An infant seat may be selectively engaged with the stroller. The frame may have a first side and a second side that generally oppose one another. The adapters may each be configured to selectively engage with the infant seat. One of the adapters may be positioned on the first side of the frame, and a remaining adapter may be positioned on the second side of the frame. The adapters may be rotatable between a first position and a second position. The adapters may be visible and positioned to engage with the infant seat in the first position, and may be substantially hidden from view in the second position.
US09108653B2
A wheeled carrier for manual movement of material includes a base frame with a pair of frame rails. The frame rails are turned down at the front end with a first bracket connecting the rails and providing a mounting point for at least one wheel and a receiver between the frame rails. The wheel is positioned so that it does not extend above either of the frame rails. A second bracket extends between the frame rails and includes a release mechanism positioned between the frame rails. An attachment including a yoke may be releasably mounted to the base frame. The yoke extends between the receiver of the first bracket and the release mechanism of the second bracket and engages the receiver and the release mechanism. The attachment further including a load carrying arrangement configured to rest on the frame rails above the at least one wheel without engaging the wheel.
US09108652B2
Systems and methods for synchronizing two or more vehicles operating on an electric transportation line to optimize energy consumption. A controller is provided having a computer memory component storing a set of computer-executable instructions, a list of braking intervals, and a list of acceleration intervals for the vehicles. The controller also has a processing component configured to execute the set of computer-executable instructions to operate on the list of braking intervals and the list of acceleration intervals to minimize an energy consumption of the electric transportation line over a determined period of time by shifting acceleration intervals to synchronize with braking intervals. A dedicated heuristic greedy algorithm and an energy model are implemented in the controller as part of the computer-executable instructions to achieve the improved energy consumption.
US09108644B2
A coupling system for a train consist is disclosed. The coupling system may include a first conduit associated with a locomotive of the train consist, a second conduit associated with a tender car of the train consist, and a fluid coupling connecting the first and second conduits. The coupling system may also include a first mechanical coupler associated with the locomotive and a second mechanical coupler associated with the tender car and configured to engage and lock with the first mechanical coupler. The coupling system may further include a locking device driven by fluid passing through the fluid coupling that is configured to inhibit disengagement of the first mechanical coupler and the second mechanical coupler.
US09108640B2
Systems and methods for monitoring vehicle sensors to determine and report road quality using a communication device are disclosed. The communication device determines the vehicle's location on a road, such as by use of a GPS-enabled head unit or similar device and appropriate mapping software. Monitoring road quality may be achieved by adding a sensor to the shocks, by use of a vertical displacement sensor present on the head unit, and the like. Various combinations of sensors may be employed. A horizontal displacement sensor may be used. The signals from the sensors are monitored by the head unit and analyzed to judge the quality of the road by the amount of vertical vibration that is encountered. This data, together with the vehicle's location, may be transmitted through a mobile network to a central server for distribution in road quality reports and to improve driving directions in mapping software.
US09108637B2
A hybrid drivetrain and method for controlling a friction clutch of a hybrid drivetrain of a motor vehicle having a combustion engine which is coupled by means of a freewheel to a transmission input shaft of a transmission to transmit the engine torque, and having an electric machine which starts the combustion engine and/or propels the motor vehicle, which friction clutch transmits to the combustion engine a summed torque formed of a starting torque for starting the combustion engine by means of the electric machine and a drag torque which acts on the combustion engine when the drivetrain is in drag mode. To be able to operate the friction clutch reliably and to avoid over-dimensioning of the friction clutch as a result of high summed torques, a torque present at the friction clutch is limited to a predefined transmission torque which can be transmitted via the friction clutch.
US09108636B2
In a transmission control device for a hybrid vehicle, when an engine torque is equal to or less than a predetermined value during a constant speed traveling, a learning engine rotational speed is set to a rotational speed being higher by +α than the present engine rotational speed. Then, a learning engine torque is calculated that corresponds to the learning engine rotational speed, a learning clutch actuator operation amount is obtained that corresponds to the learning clutch torque, and a clutch actuator is operated based on the learning clutch actuator operation amount. Thereafter, when the engine rotational speed and the engine torque are in stable states, a clutch torque value corresponding to the learning clutch actuator operation amount is compensated by a stable engine torque value.
US09108631B2
A hybrid vehicle and method of control include an internal combustion engine and at least one traction motor operated in an automatic mode such that the combined wheel torque is a function of accelerator pedal position and vehicle speed. In a select shift mode, wheel torque is also a function of a virtual gear number. The virtual gear number varies in response to driver activation of shift selectors or automatically in response to changes in vehicle speed. The vehicle transitions into select shift mode in response to driver activation of a downshift selector. When the transition occurs, an initial virtual gear number is selected to ensure that wheel torque increases.
US09108627B2
A method for improving starting of an engine that may be repeatedly stopped and started is presented. In one example, the method adjusts application of vehicle brakes to reduce the possibility of impact between gear teeth after engine starting.
US09108623B2
The present disclosure provides a system and a method of controlling motor vehicle operation. The method may include: setting a creep torque as a minimum torque; setting a maximum torque as a sum of a maximum torque of an engine and a maximum torque of a motor; monitoring an acceleration pedal position sensor (APS) value; calculating a demand torque according to the APS value; setting a filter coefficient for filtering the demand torque according to an operating condition of the vehicle; and filtering the demand torque by means of the filter coefficient.
US09108622B2
A drive control apparatus for a vehicle includes an engine, an electric motor, a clutch mechanism, an engine rotation sensor, a motor rotation sensor, an acceleration and deceleration intention detecting portion, and a controller. The controller controls a rotation speed of the engine to be an acceleration intention target value greater than a rotation speed of the motor and thereafter brings the clutch mechanism into the engagement state in a case where the acceleration and deceleration intention detecting portion detects that the vehicle is in an acceleration intention mode, and controls the rotation speed of the engine to be a deceleration intention target value smaller than the rotation speed of the motor and thereafter brings the clutch mechanism into the engagement state in a case where the acceleration and deceleration intention detecting portion detects that the vehicle is in a deceleration intention mode.
US09108617B2
A method for controlling a clutch which pertains to a vehicle and which is operated by means of a vehicle control system. The vehicle is provided with an engine, and a driver of the vehicle requests propulsive force from the engine. A first propulsive force requested by the driver and transmitted via a clutch involves determining whether the clutch slips while transmitting the first propulsive force. When the clutch slips during transmission of the first propulsive force, the propulsive force transmitted by the clutch increases. The invention relates also to a system and a vehicle.
US09108613B2
A method and a system for improving operation of a hybrid vehicle are presented. In one example, a disconnect clutch is operated in response to an engine stop request to adjust an engine stopping position during an engine shutdown. The approach may reduce engine starting time after the engine stop.
US09108606B2
The disclosure relates to a fluidically controlled pressure switching valve for a vehicle brake system including a valve chamber, which is arranged in a valve interior and into which an inlet opening and an outlet opening open, and a valve closing body, which is movable in the valve interior and which comprises a piston, defining a first piston surface and a second piston surface, and including a closing element. The valve closing body is movable in accordance with a pressure difference between a pressure acting on the first piston surface and a pressure acting on the second piston surface, against the force of a setting spring arranged in the valve interior, between a closed position, in which a fluid connection between the inlet opening and the outlet opening is interrupted, and an open position, in which the fluid connection between the inlet opening and the outlet opening is open.
US09108580B2
An apron for a vehicle front end comprises a unitary plastic component having a front structure and a rear structure joined by an offset portion. The front and rear structures extend at rearward downward angles and in generally parallel directions, and the offset portion extends at a rearward upward angle. The apron has a relatively constant vertical dimension, such that the angled structures define a wave-shaped envelope. Preferably, a horizontal plane extending from the tip of the front structure stays within the wave-shaped envelope, so that impact forces stay within the boundary in a manner providing improved impact strength and greater energy absorption during an impact. At the same time, the front structure provides a homogeneous structure that distributes local impact stresses uniformly and more widely into the rear structure, thus providing a more uniform impact resistance less sensitive to impact location.
US09108579B2
A system and method are described herein for managing personalization information used to configure settings for a registered vehicle user in a vehicle including a telematics unit. In particular, the method performed by the system includes establishing, for the registered vehicle user, a personalization information dataset within a networked vehicle user database. The system is further configured to submit a request to download the personalization information dataset from the networked vehicle user database, the request identifying the registered vehicle user and the vehicle. The system is also configured to download in accordance with the request to download, via a mobile wireless link to the telematics unit, values from the personalization information dataset to the telematics unit of the vehicle.
US09108571B2
Systems, methods, computer programs, and user interfaces are provided to project, by a projection device, a pattern of invisible light onto a surface; position a vehicle at an image capture position on the surface, the vehicle including an image capture device oriented to capture an image of a view at the image capture position; capture, by an invisible light sensor connected to the vehicle, a pattern image at the image capture position, the pattern image including at least a portion of the pattern of invisible light projected onto the surface; and send the pattern image to an application server, the application server determining the image capture position relative to the projection device based on the portion of the pattern of invisible light.
US09108560B2
The seat belt failure warning apparatus is disposed with a buckle switch that detects wearing of a webbing, a rotation sensor that detects a drawing-out amount of the webbing, and a liquid crystal display that switchingly displays a plurality of alarm information. A controller is disposed with a failure determination unit that determines whether the seat belt device has had a failure or not, and a control unit that controls display of the liquid crystal display. When the buckle switch is OFF and drawing-out of the webbing is detected by the rotation sensor after the failure determination unit has determined the seat belt device has had a failure, failure information of the seat belt which indicates that the seat belt device has had a failure as a determination result by the failure determination unit is displayed on the liquid crystal display regardless of a display priority of alarm information.
US09108556B2
The present disclosure relates to a vertical hydraulic cylinder axle arrangement that can receive flexible power lines through the cylinder. In particular, a hollow piston rod having a longitudinally extending passage through which hydraulic hoses and electrical lines can pass is incorporated into a heavy-load transporter. A portion of the piston rod defines a splined shaft to mechanically engage a rotating slew gear drive to permit omnidirectional steering. The piston rod extends downward to form a trunnion mount on which drive wheels can articulate laterally to conform to irregularities in various surfaces and other inclinations.
US09108550B2
A headrest apparatus for an MPV includes a headrest that can be automatically completely housed in a storage space in such a way as to slide without requiring a user to perform an additional operation of pushing the headrest downwards, thus being more convenient for the user. The headrest apparatus has a simple structure and a reduced size, thus reducing the weight of the vehicle. The headrest apparatus includes a headrest sliding unit, a sinking seat folding unit, and a seat support frame supporting a sinking seat on a floor of the MPV, wherein, when the sinking seat is housed in a seat storage space formed in the floor of the MPV, the upper surface of the sinking seat that is in a housed state is level with the upper surface of the floor of the MPV.
US09108549B2
An auto-adjustable armrest mechanism for reclining seats is disclosed. The armrest mechanism causes the armrests to follow a more natural movement of an occupant's arms when adjusting the seatback to different angles. The armrest mechanism utilizes a cam that rotates in response to movement of the seatback relative to the seat base. A rod connected to the rotatable armrest is in communication with and, in turn, responsive to the rotation of the cam for defining an auto-adjustable angle between the seatback and the armrest.
US09108548B2
A vehicle seat comprises: left and right base frames (side portions 52, 53 of pipe frame 5) which extend in an upward-and-downward direction and constitute left and right portions of a seat back frame (2); a pressure-receiving member (10) disposed between the left and right base frames, and configured to move rearward upon receipt of a rearward load of a predetermined magnitude or greater from an occupant; a force-receiving member (bracket 7) disposed adjacent to a left or right outer side of one base frame (side portion 53), and configured to receive a load from outside in a lateral direction; and a load transmission part (lower portion 51 of pipe frame 5) disposed under the pressure-receiving member (10), connected to a lower end of the one base frame, and configured to transmit the load from the force-receiving member to a side laterally opposite to that on which the force-receiving member is provided. The force-receiving member is provided such that the lower end of the one base frame (53) is located within a width in the upward-and-downward direction of the force-receiving member.
US09108547B2
A vehicle seat comprises: left and right side frames (4) which constitute left and right portions of a seat back frame (2); a reinforcing frame (pipe frame 5) disposed adjacent to one side frame (4) in a lateral direction, and configured to reinforce the side frame (4); and a force-receiving member (bracket 7) disposed adjacent to the one side frame (4), provided discretely from the reinforcing frame, and configured to receive a load from another member. The force-receiving member is disposed opposite to the reinforcing frame with the side frame 4 disposed therebetween, and directly fixed to the reinforcing frame.
US09108541B2
For a recliner system for a vehicle seat, in particular a motor vehicle seat, comprising at least one recliner, which has a first recliner part and a second recliner part, which can be locked to each other and can be rotated relative to each other about an axis, a transfer rod, the rotation of which unlocks the recliner, and a hand lever, the operation of which rotates the transfer rod in order to unlock the recliner, a stop module is provided, which is operatively connected to the hand lever and to the transfer rod and which stops the hand lever and one of the recliner parts relative to each other in at least one rotational direction.
US09108539B2
A safety apparatus of a seat for a vehicle with a height adjustment device may include a height link that has one end rotatably connected to a seat rail bracket and the other end fixed to a rear hinge pipe, a restriction link that may be disposed at a side of the height link and has one end pivotally coupled to the seat rail bracket, wherein the restriction link may be elastically biased away from the height link, a first anti-rotation mechanism that may be disposed at the height link and the restriction link to restrict rotation of the height link when a front of the height link rotates upward in a front collision, and a second anti-rotation mechanism that may be disposed at the height link and the restriction link to restrict rotation of the height link when a rear of the height link rotates upward in a rear collision.
US09108534B2
A vehicle seat slidable in a front-rear direction comprises a lower rail (5) fixed on a floor of a vehicle, and configured to have a shape elongated in the front-rear direction and having a groove (55) provided in a laterally central position, an upper rail (4) configured to be engageable with the groove (55) and slidable in the front-rear direction relative to the lower rail (5), and a seat bottom frame (3) fixed to the upper rail (4). The seat bottom frame (3) is fixed to a left or right side surface of the upper rail (4), the lower rail (5) has a pair of left and right top portions (53A, 53B) between which the groove (55) is disposed and of which the to inner top portion (53A) fixed to the seat bottom frame (3) is formed in a position lower than that of the outer top portion (53B) that is on a side opposite to the inner top portion (53A). A lower end (62C) of a rear link (62) that is an end of a seat bottom frame (3) facing to the inner top portion (53A) is in a position lower than that of the outer top portion (53B).
US09108526B2
A hybrid vehicle includes a power storage device, an engine, a power generation apparatus, an input apparatus, and an ECU. The power generation apparatus is configured to generate charging power of the power storage device by using output of the engine. The input apparatus is configured to request, by a user input, an increase in a power storage amount of the power storage device. The ECU is configured to: (a) control charging of the power storage device by the power generation apparatus and accelerate the charging of the power storage device, when the increase in the power storage amount is requested, and (b) suppress charging of the power storage device at the time when a travel load is small in comparison with charging of the power storage device at the time when the travel load is large, when the increase in the power storage amount is requested.
US09108519B2
An electric vehicle includes a main battery, a motor generating drive power of the vehicle by supply of electric power from the main battery, an output control circuit for the motor, a charging connector for supplying electric power from an external to the main battery, and a meter display device. The meter display device includes a display section including at least a vehicle speed displaying portion and a charging connector condition displaying portion displaying information related to the condition of the charging connector. The charging connector condition displaying portion displays information on maintenance of the charging connector and is disposed adjacent the vehicle speed displaying portion. A main battery residual displaying portion and a sub battery residual displaying portion are disposed around the vehicle speed displaying portion.
US09108514B2
A control device for a braking system equipped with an electric drive device and/or generator device includes: a first receiving device with the aid of which a specified value regarding a brake pressure in at least one wheel brake cylinder of at least one brake circuit is receivable, a second receiving device with the aid of which an actual value regarding a pressure in the at least one brake circuit and/or the brake pressure in the at least one wheel brake cylinder is/are receivable, and a control unit with the aid of which a setpoint mode of the electric drive device and/or generator device is specifiable taking the received specified value and the received actual value into account.
US09108513B2
In a method for the operator control of a motor vehicle having a display for displaying variable information and having a microphone, the viewing direction of an operator of the motor vehicle is ascertained, it is checked whether the viewing direction of the operator is aimed toward the display, and information assigned to an acoustic command is shown on the display when a corresponding acoustic command is given while the viewing direction of the operator is aimed toward the display.
US09108511B2
A transfer case includes a planetary differential including an input, a first output and a second output, a sprocket journalled on the second output, and a sleeve driveably connected to the second output, for (i) releaseably connecting the first output to the sleeve, (ii) releaseably connecting the sprocket to the sleeve, (iii) releaseably connecting the first output and the sprocket to the sleeve, and (iv) disconnecting the sprocket and first output from the sleeve.
US09108506B2
An improved fuel tank and method of forming a fuel tank utilize reinforced porous metal composite materials. In one embodiment, the composite material includes a fully dense, fluid-impermeable skin combined with a porous metal baffle. The skin and baffle may be formed as a single monolithic system via electrodeposition of a nanolaminate material into at least a portion of open, accessible void space within a porous preform (e.g., a metal foam preform) and on the exterior surface of the preform to form the fluid-impermeable skin.
US09108505B2
A powertrain includes a planetary gearset including an input connected to a shaft driveably connected to an engine, a second input driveably connected to an electric machine, and an output driveably connected to a countershaft, a clutch for releaseably connecting the countershaft and the input shaft through a first pair of meshing gears, and a brake for releaseably holding the input shaft and the input against rotation.
US09108504B2
A split-axis transmission hybrid system may include two planetary gear sets to provide two parallel torque paths from an input axis to an output axis. A secondary power source may be coupled to either the input axis or the output axis to provide torque to the system. Thus, the split-axis transmission hybrid system may provide the ratio preselection capability and the low power losses of a dual-clutch transmission and the ratio-changing control and smoothness of a traditional powershift automatic transmission, while also providing the improved efficiency and enhanced drivability of a hybrid power source arrangement.
US09108502B2
A cable routing structure includes a drive train within which an electric motor is housed; a power control unit configured to supply alternating current to the electric motor, the power control unit being fixed to an upper portion of the drive train, and on-board components being arranged on both sides of the power control unit in a lateral direction of a vehicle; an electrical component being arranged on a side of a plane that the power control unit is on; and a first end of a first cable being connected to a side surface of the power control unit that faces toward a front or a rear of the vehicle, a second end of the first cable being connected to the electrical component, and the first cable being routed through a space defined by the power control unit and the drive train.
US09108490B2
The present disclosure relates to an air supply duct for a vehicle, the air supply duct comprising a housing, the housing having an inlet adapted to receive air from outside of the vehicle and an outlet adapted to convey the air to a vehicle climate control system, and a cowl arranged inside the housing, the cowl being adapted to direct the air along an air path, such that the air path changes direction within the housing. The cowl has a curved form adapted to form an inner curve of the air path. Further, the cowl comprises a precipitation collection means arranged to collect precipitation borne by the air from the outside of the vehicle and to remove the precipitation from the air. The disclosure also relates to a vehicle comprising such an air supply duct.
US09108482B2
A torsion bar spring arrangement for a wheel suspension of a motor vehicle includes an actuator arranged on a vehicle body or on a subframe and constructed to variably pre-tension the torsion bar spring arrangement, a coaxial first torsion bar spring having an output side that is connected by way of an output lever to a wheel suspension element of the wheel suspension, and a housing of the actuator supported on the vehicle body in at least one bearing location for movement in a circumferential direction and resiliently yieldingly supported on the vehicle body in the direction of torsional moments acting on the torsion bar spring by way of at least one spring element.
US09108480B2
Modular suspension systems for customizing a stock automobile are presented including in any combination: a pair of asymmetrical control arm components having a control arm connection geometry sized to replace a pair of stock control arm components, where the pair of asymmetrical control arm components include at least additional control arm customization, and where the pair of asymmetrical control arm components are compatible with all other stock components of the stock automobile without modification of the stock components; a pair of spindle components having a spindle connection geometry sized to replace a pair of stock spindle components, where the pair of spindle components include at least additional spindle customization, and where the pair of spindle components are compatible with all other stock components of the stock automobile without modification of the stock components.
US09108477B2
Coupling devices for different landing gears of aircraft are disclosed. In one embodiment, a coupling device for coupling to a landing gear of an aircraft may include a first landing gear adapter that is designed for coupling to a landing gear of an aircraft of a first type. A second landing gear adapter that is designed for coupling to a landing gear of an aircraft of a second type is provided. The second type is different from the first type. A change device is coupled to the first and second landing gear adapters and designed such that optionally the first or the second landing gear adapter can be positioned in an operating position, or location of the coupling device, suitable for coupling to the landing gear. A plurality of second landing gear adapters may be provided and may one at a time be moved into the operating position in a pivoting manner.
US09108464B2
The present invention relates to a rubber composition based on at least an epoxidized natural rubber (ENR), a reinforcing filler and, as plasticizing agent, an alpha-methylstyrene polymer resin. The invention also relates to the use of such a composition for the manufacture of a tire tread exhibiting an improved compromise of properties with respect to grip on wet ground and rolling resistance.
US09108463B2
A wheel dolly for lifting and transporting a flat tire attached to an aircraft is comprised of a frame assembly having first and second laterally spaced frame members and a telescopic frame structure interposed between the laterally spaced frame members. A pair of tire scoops are pivotally coupled the frame assembly. An actuator is coupled between the tire scoops to pivot the tire scoops relative to the frame assembly in order to raise the tire scoops. A plurality of castors is coupled to the frame assembly to allow the frame assembly to roll in any direction.
US09108429B2
A method of controlling a printer includes measuring a first voltage value of a power supply of the printer before energizing heat generating elements of a print head of the printer. The method also includes calculating, by a controller of the printer, the number of heat generating elements that are simultaneously energizable based on the measured first voltage value of the power supply, an end voltage value of the power supply, an internal resistance value of the power supply, a resistance value of each of the heat generating elements, and a current value of an electric current flowing through a motor of the printer for conveying recording paper. The method further includes performing printing on the recording paper by the print head using the heat generating elements of the calculated number.
US09108425B2
A recording apparatus including an ink tank and a recording head having a flow path forming portion that has an ejection orifice plate having plural ink ejection orifices and a liquid chamber provided for each orifice to supply ink to the orifices, and an energy generating element for ejecting ink in the chamber. A surface layer of the flow path forming portion opposes to the outside of the plate. An opening is provided opposing to the orifices in the surface layer. An ink reservoir is provided between the plate and the opening. A circulation flow path communicating with the ink reservoir is provided. The area of the opening is larger than that of the orifice. Both ends of the circulation flow path are respectively connected to inlet and outlet portions connected to the circulation flow path. The inlet and outlet portions and liquid chamber are connected to the ink tank.
US09108422B2
An apparatus useful in the assembly of printer cartridges includes a plurality of accumulator bags removeably secured to a carrier sheet. Each accumulator bag includes a first polymer film panel and a second polymer film panel welded together to form a pressurizable chamber with an aperture formed in the bag to provide access to the pressurizable chamber. An annular adhesive element is secured to each bag such that an aperture of the annular adhesive element is generally concentric with the aperture of the accumulator bag. The carrier sheet includes an upper adhesive stripe, a lower adhesive stripe, and a silicone stripe. The plurality of accumulator bags is removeably secured to the carrier sheet by adhering an upper portion of each bag to the upper adhesive stripe, adhering a lower portion of each bag to the lower adhesive stripe, and positioning the annular adhesive element in contact with the silicone stripe.
US09108417B2
A cartridge is adapted to be used in a printing apparatus having a mounting section provided with a lever and a terminal group. The cartridge includes a front surface, a rear surface, an upper surface, a lower surface, a circuit board, and a first convex section. The upper surface includes a concave section configured and arranged to allow a regulating section of the lever to be inserted in the concave section. The circuit board is electrically connected with the terminal group. The first convex section is configured and arranged to be guided in a groove provided in the mounting section. The circuit board, the first convex section, and the concave section are disposed in the upper surface in a plan view of the upper surface.
US09108413B2
In a liquid droplet discharge head, a liquid repellent layer is continuously formed from a liquid droplet discharge surface to a middle position in a thickness direction of an end surface of a nozzle plate.
US09108406B2
A device substrate includes a substrate body having an energy generating device provided thereon, where the energy generating device generates energy for ejecting liquid, an ejection port forming member disposed on the substrate body, where the ejection port forming member has a pressure chamber that surrounds the energy generating device and an ejection port that communicates with the pressure chamber, and a supply port configured to supply the liquid to the pressure chamber. The ejection port forming member has a first surface that is in contact with the substrate body and a second surface other than the first surface, and the supply port is formed in the second surface.
US09108404B2
An ink jet recording method includes discharging a first ink composition onto a recording medium using a recording head, in which the first ink composition includes a coloring material, an alkane diol with 4 or more to 8 or fewer carbon atoms, a water-soluble solvent, and water; the recording head discharges the first ink composition using a piezoelectric element, and has a resolution per unit length of 200 dpi or more, and the recording medium has an absorbing layer on the surface thereof, in which a nonpolar component of a surface free energy of the absorbing layer is 20 mN/m or lower.
US09108403B2
A printing apparatus including a print head including nozzle groups each having nozzles, each of the nozzle groups applying ink having a plurality of volumes from the nozzles to form dots including dots differing in size, including: an arrangement determination unit to determine an arrangement of dots to be formed by each of the nozzle groups; a size determination unit to determine sizes of ink ejected to print the dots determined by the arrangement determination unit, according to respective ejection characteristics of the nozzle groups, such that a print characteristic of an image based on the dot arrangement determined by the arrangement determination unit is within a predetermined range; and an ejection control unit to control the print head to eject ink having the plurality of sizes determined by the size determination unit in positions of a print medium based on the arrangement determined by the arrangement determination unit.
US09108400B1
A method for printing an image on a substrate, the method including providing a plurality of rollers for moving a substrate on which the images are printed; depositing a plurality of different colored inks on a print side of the substrate which forms the image; depositing a clear liquid on the print side of the substrate in a linear, spaced apart pattern adjacent an edge of the image for forming clear liquid ribs; wherein the clear liquid ribs extend away from the image, and the clear liquid is devoid in at least at a plurality of portions between the clear liquid ribs.
