US11592029B2
The present application discloses an impeller for a centrifugal fan and a centrifugal fan. The impeller comprises a support member and several vanes. The support member has an inner wall that defines a hollow portion. The several vanes are arranged inside the hollow portion, each of the several vanes is connected with the inner wall and extends along the axial direction of the support member, and the several vanes are arranged along the circumferential direction of the support member. Each of the several vanes is bent and comprises a front edge, a tail edge, a convex suction surface, and a concave pressure surface, the suction surface and the pressure surface are arranged to oppose each other, and the front edge and the tail edge are arranged to oppose each other, wherein the tail edge is connected with the inner wall of the support member, and wherein several protrusions are provided on the suction surface, and the several protrusions are arranged to be close to the front edge. The protrusions can regulate the flow of a fluid immediately when the fluid contacts the vanes. During the flow regulation process, a large vortex in the fluid can be divided into several small vortices. Such small vortices have smaller friction resistance, and the kinetic energy dissipated from the motion of the small vortices themselves can be partially cancelled out, thereby reducing the noise of the impeller and improving the performance of the centrifugal fan.
US11592028B2
The invention relates to a fluid pump comprising at least one impeller blade (1, 1′, 1″) which is rotatable about an axis of rotation (3) and conveys a fluid in operation and comprising a support device (4, 6, 7, 8, 9, 10, 12, 12′, 13, 13′, 14, 14′, 15, 17) which supports the at least one impeller blade (1, 1′, 1″) in at least one support region, wherein the support device is change-able between a first state in which the rotor is radially compressed and a second state in which the rotor is radially expanded; and wherein at least one impeller blade extends at least partly radially inwardly with respect to the axis of rotation (3) from the support region/support regions in the radially expanded state of the rotor.
US11592022B2
A scroll compressor includes a hermetic container, a fixed scroll, a swing scroll, a frame, an electric motor, and a shaft. A first groove and a second groove are provided outside a fixed wrap in a radial direction at an end plate surface of the fixed scroll. An oil supply hole for guiding lubricant oil from a through-hole opens at an end plate surface of the swing scroll. A single opening of the oil supply hole alternately communicates with the first groove and the second groove along with swing of the swing scroll.
US11592018B2
Systems to drive a downhole pump include an enclosure body with a magnetically transparent wall. A magnetic driver or a stationary member with coil windings in slots is disposed outside the enclosure body. A magnetic follower or a movable member with one or more permanent magnets is disposed inside the enclosure body such that the magnetic follower or movable member is exposed to a different environment compared to the magnetic driver or stationary member. The magnetic driver and magnetic follower, or the stationary member and movable member, are separated by a gap containing at least a portion of the magnetically transparent wall. A prime mover is operatively coupled to the magnetic driver. A rod couples the magnetic follower or the movable member to the downhole pump. Movement of the rod with the magnetic follower or the movable member operates the pump.
US11592007B2
A wind turbine rotor blade has a spar cap including conductive material, and a lightning conductor extending over the spar cap. There is a non-conductive layer between the lightning conductor and the spar cap. An equipotential bonding element electrically bonds the lightning conductor to the spar cap. The non-conductive layer is discontinuous to define a gap, and the equipotential bonding element extends through the gap.
US11592004B2
Provided is a vertical axis wind power generation device including a wind turbine of a vertical axis type including a support column, a main shaft disposed on an upper portion of the support column so as to be rotatable, a plurality of blades coupled to the main shaft through arms; a power generator; and a container having a standard dimension for freight transport. The wind turbine is accommodatable in a folded or disassembled state in the container together with the power generator. The container is provided with a support-column fixing part configured to fix the support column of the wind turbine to the container. The container may include an inclining mount inside the container, the inclining mount being configured to accommodate a folded body of the wind turbine.
US11592002B1
Disclosed embodiments provide a renewable power generation apparatus. In embodiments, the renewable power generation apparatus is driven by wind. In other embodiments, the renewable power generation apparatus is driven by water. Disclosed embodiments utilize two cylindrical turbines placed adjacent to each other. A diverter directs wind towards both turbines, causing them to rotate about their respective longitudinal axis. The turbines are coupled to a driveshaft that drives a generator to generate power. Embodiments utilize an airfoil adjacent to each turbine. The airfoil causes air to move faster over the airfoil surface to create low pressure which increases the performance of the turbines. The renewable power generation apparatus of disclosed embodiments is relatively compact compared to a traditional wind turbine. This allows disclosed embodiments to have more flexibility in where they are installed, facilitating local power generation, off-grid applications, and other important environmental applications.
US11592001B2
This invention relates to a method of manufacturing a wind turbine blade and a wind turbine blade thereof. A central core element and a plurality of side core elements are sandwiched between first layers and second layers of a first fibre material. The central core element is spaced apart from the side core elements to form a first and a second recess. This sandwich structure is then impregnated with a first resin and cured in a first step. Layers of a second fibre material of a first and a second main laminate are laid up in the first and second recesses. The first and second main laminates are then impregnated with a second resin and cured in a second step.
US11591999B2
The present invention relates to the utilization of wave energy and its conversion into operating motion of an electrical energy generating system. The system for generation of electrical energy through the conversion of aquatic wave motion includes floating bodies and a constant rotation mechanism, which converts the two-way linear motion of an inflexible transmission shaft or a flexible transmission shafts into one-way rotation of an output shaft of the constant rotation mechanism. This mechanism allows utilization of wave energy in two directions caused by the rise and fall of waves. The output shaft of the constant rotation mechanism is coupled to a force multiplier that is further coupled to a generator which generates electrical energy. Constant rotation mechanism can be driven by inflexible transmission shaft pivotally coupled to the floating bodies at one end, and the other end to an input gear of the constant rotation mechanism. Depending on the height of the wave and the wavelength, various constructions of floating bodies are used. Certain floating bodies are designed for the waves of a smaller amplitude and smaller wavelength, while other floating bodies are designed for bigger amplitude and bigger wavelength.
US11591996B2
An improved method and apparatus for powering an electric motor for starting an internal combustion engine in which the electric motor is in a 6 volt to 48 volt operating system, in which an auxiliary battery pack has a battery pack housing; at least one lithium-based rechargeable cell within the housing; associated means for receiving a radio transmitted signal; associated means for turning the rechargeable cell ON or OFF; and battery connections for connecting the auxiliary battery pack to a battery in a 6 volt to 48 volt operating system.
US11591987B2
An aircraft turbomachine, including a fan that is able to rotate inside a casing, and an electric machine including a rotor secured to the fan and a stator secured to the casing, wherein the rotor of the electric machine includes a ring that is able to rotate inside the stator, which is linked by arms to a cone mounted upstream from the fan.
US11591985B2
There are described a system and method for operating a thrust reverser of an aircraft engine, the thrust reverser having a deployed state and a stowed state. The method comprises placing the thrust reverser in the stowed state when the thrust reverser is in the deployed state, a thrust lever associated with the engine is in a forward position, and the engine is rotating at a speed below an idle speed, wherein hydraulic pressure for stowing the thrust reverser is provided by a pump driven by the engine rotating at the speed below the idle speed.
US11591983B2
An engine system is provided, including a controller which controls devices of an engine at a given engine speed so that, when a demanded engine load is a first load, a mass ratio (G/F) of intake air inside a cylinder (containing fresh air and burnt gas) to fuel is a first G/F and mixture gas inside the cylinder combusts by flame-propagation, when the demanded load is a second load (
US11591977B2
A standby generator includes an internal combustion engine, an alternator, and a controller. The internal combustion engine includes an engine housing, an engine block, and a crankshaft. The engine housing at least partially covers the engine block. The engine block includes a cylinder. The crankshaft is configured to rotate about a vertical crankshaft axis in response to movement by the cylinder. The alternator includes a stator, as well as a rotor that is configured to rotate with the rotation of the crankshaft to produce electrical power. The controller includes an inverter that is configured to receive electrical power from the alternator and output alternating current electrical power. The controller extends at least partially above the engine housing.
US11591972B2
A mechanical gearbox for an aircraft turbomachine includes a sun gear having an axis (X) of rotation, a ring gear around the sun gear, and planet gears meshed with the sun gear and the ring gear. Each planet gear has a first toothing meshed with the sun gear and a second loathing meshed with the ring gear. The first toothing includes a series of upstream teeth and a series of downstream teeth located on either side of a plane (H) perpendicular to the axis (X) of rotation of the sun gear. The second toothing includes a series of upstream teeth and a series of downstream teeth located on either side of the plane (H) and separated from one another by the first toothing, these teeth being parallel to one another and to the axis (Y) of rotation of the planet gear.
US11591971B2
A gearbox assembly for a gas turbine engine includes a planetary gear set comprising a sun gear, a planet gear, and a ring gear, the sun gear configured for connection to a first drive shaft of the gas turbine engine and the ring gear configured for connection to a second drive shaft of the gas turbine engine, and an electric machine assembly comprising an input and an electric machine. The electric machine comprising a rotor coupled to the input and a stator fixedly positioned within the gearbox assembly, the input of the electric machine assembly coupled to one of the sun gear, the ring gear, or the planet gear of the planetary gear set.
US11591952B2
Use of the hydraulically driven device in a series configuration with a minimally restrictive turbocharger is defined which will allow a very responsive and powerful boosting system to reach boost levels of 4-5 pressure ratio (PR) to support and enable OEM engine downsizing trends. An electric supercharger is also considered. A hydraulic drive assists to increase the acceleration rate of a turbocharger impeller/turbine shaft assembly and provide a secondary means of driving the compressor impeller at lower engine speeds where exhaust gases alone does not generate adequate shaft speeds to create significant induction boost. The hydraulic circuit includes a dual displacement motor, which provides high torque for acceleration yet converts to a single motor for high-speed operation. When the exhaust driven turbine function allows compressor speeds, beyond which the hydraulic system can contribute, a slip clutch allows disengagement of the hydraulic drive. In an alternative embodiment, the hydraulic drive provides means of forced induction air alone.
US11591943B2
A vehicle exhaust system component, according to an exemplary aspect of the present disclosure includes, among other things, a housing defining an internal cavity to receive exhaust gases, at least one first catalyst received within the internal cavity, at least one filter positioned within the internal cavity downstream of the at least one first catalyst, and at least one second catalyst received within the internal cavity downstream of the at least one filter. A mixer has an inlet that receives exhaust gases exiting the at least one filter and an outlet that directs exhaust gases into the at least one second catalyst. One or more of the at least one first catalyst, the at least one second catalyst, and the at least one filter are serviceable.
US11591939B2
A compression release mechanism including a camshaft, a cam provided on the camshaft and protruding outward in a radial direction of the camshaft, a lever, of which a portion is disposed in the camshaft, a support shaft supporting the lever such that the lever is swingable between a first position and a second position relative to the camshaft, and a spring attached to the camshaft, to urge the lever toward the first position. The lever includes a cam portion configured to protrude out from the camshaft with the lever at the first position, a centrifugal weight for moving the lever toward the second position in accordance with rotation of the camshaft, and an abutment portion configured to be in abutment with an inner peripheral surface of the camshaft with the lever at the first position, and be located away from the inner peripheral surface with the lever at the second position.
US11591937B2
The present disclosure provides a remote mount for an idler gear assembly, comprising: a gear mounting plate including a plurality of bores configured to receive a corresponding plurality of fasteners to mount a gear assembly to the gear mounting plate; and an attachment bracket including a plurality of mounting openings configured to receive a corresponding plurality of bolts to mount the remote mount to a cylinder head. The gear mounting plate supports the gear assembly such that a gear of the gear assembly rotates about an axis that is parallel to an axis of a crankshaft of an engine and the attachment bracket mounts to an upper surface of the cylinder head.
US11591932B2
A casing for a bearing of a gas turbine engine includes a shaft extending along an axial direction. The casing includes an attachment feature at a radially outermost portion of the casing. The attachment feature is configured to be coupled to a static frame of the gas turbine engine. The casing further includes a plurality of support arms extend from the attachment feature to a radially innermost portion of the casing. At least one support arm of the plurality of support arms defines an internal cavity. Further, the radially innermost portion of the casing is configured to be coupled to an outer race of the bearing. The casing additionally includes a reinforcing member housed at least partially within the internal cavity of at least one support arm. Moreover, the reinforcing member includes a shape memory alloy material.
US11591922B2
A ring segment having improved cooling efficiency is provided. The ring segment may include a shield plate mounted to a casing which accommodates a turbine and configured to face an inner wall of the casing, a pair of hooks configured to protrude from the shield plate toward the casing to be coupled to the casing, a cavity defined between the shield plate and the pair of hooks, a plurality of first cooling passages configured to connect the cavity and first side surfaces facing each other of the shield plate, and a plurality of second cooling passages configured to connect the cavity and second side surfaces facing each other of the shield plate, wherein the first cooling passages extend in a longitudinal direction of a central axis of the turbine, and the second cooling passages extend in a circumferential direction of the turbine.
US11591920B2
A vane arc segment includes an airfoil piece that defines first and second platforms and a airfoil section that extends between the first and second platforms. The airfoil section has a trailing edge, a leading edge, a pressure side, and a suction side. The platforms each define first and second circumferential mate faces, forward and aft sides, a gaspath side, a non-gaspath side, and a radial flange that projects from the non-gaspath side. Each radial flange extends continuously and includes a first leg portion that extends adjacent the trailing edge, a second leg portion that extends from the first leg portion and curves around the suction side, and a third leg portion that extends from the second leg portion toward the forward side.
US11591917B2
A blade outer air seal segment including a radially outward surface, a radially inward surface oriented away from the radially outward surface, and a cooling channel located between the radially outward surface and the radially inward surface. The blade outer air seal segment also including a stress-relief boss extending into the cooling channel and an inlet orifice fluidly coupled to the cooling channel through the stress-relief boss. The blade outer air seal segment further including a stress-relief recess. The stress-relief boss being located within the stress relief recess.
US11591913B2
A variable-pitch bladed disc including a plurality of blades, each at a variable pitch in relation to a rotation axis of the blade and each having a root, the plurality of blades including at least one first blade and at least one second blade, a plurality of rotor connecting shafts, each having a root and a tip, each root being mounted at the tip of a corresponding rotor connecting shaft by way of a pivot so as to allow each blade to rotate about the blade rotation axis, the first blade having a first blade inclination, such that the first blade is inclined in a fixed manner with respect to the blade rotation axis of the first blade, and the second blade having a second blade inclination different from the first blade inclination.
US11591912B2
An internal core profile for a turbine nozzle airfoil of a gas turbine is provided. The turbine nozzle may include an airfoil core having an uncoated nominal profile substantially in accordance with Cartesian coordinate values of X, Y, and Z set forth in Table 1, wherein the X, Y, and Z coordinates are distances in inches measured in a Cartesian coordinate system, the corresponding X and Y coordinates, when connected by a smooth continuous arc, define one of a plurality of airfoil core profile sections at each Z distance, and the plurality of airfoil core profile sections, when joined together by smooth continuous arcs, define an airfoil core shape.
US11591902B2
Fiber optic sensors are described for detecting the operational position of a downhole moveable device. In one example, an electric or magnetic field is emitted into the wellbore and interacts with the moveable assembly, thereby producing a secondary electric or magnetic field. The secondary field is detected by a fiber optic sensor which produces a corresponding response signal. The response signal is then processed in a variety of ways to determine the operational position of the moveable device. In another example, the operational position is determined using fiber optic temperature or acoustic sensors. A temperature or acoustic vibration reading is acquired before and after actuation of the moveable device. The two readings are then compared to determine the operation position of the moveable device.
US11591891B2
Pumping of wellbore fluid to a surface may have a detrimental effect on the pump performance due to high gas concentrations in the fluid. A pump system that utilizes a helix gas separator provides greater pump efficiency by effectively removing the gas phase of the fluid. The wellbore fluid received at a pump system is directed from an intake to a gas separator that utilizes a stationary auger. The stationary auger induces rotational motion of the wellbore fluid causing the wellbore fluid to separate into a gas phase and a liquid phase. The stationary auger utilizes a tapered diameter and an opening between one or more helixes or vanes to separate a gas phase more efficiently from a liquid phase of a fluid.
US11591883B2
A tubing drain with a reusable body and a replaceable sacrificial burst element, the tubing drain comprising an annular body with a window and first and second connector ends, each connector end connectable to an end of tubing sections in a tubing string. The tubing drain also has an inner body insertable into the annular body, the inner body providing the replaceable sacrificial burst element. A burst profile in the inner body aligns with the window in the annular body and provides a burst element which may be configured to burst when a target pressure differential occurs across the burst profile, thereby draining fluids from the tubing string into the casing string.
US11591873B2
A sealing tool, system and method for sealing a wellbore achieves increased expansion with the use of a seal seat extender. In one example, a seal seat (e.g., a ball seat) defines an axial flow bore in fluid communication with the wellbore to be sealed, a sealing profile for receiving a loose sealing element (e.g., a ball or dart) to close the axial flow bore, and a tapered outer profile. The seal seat extender is initially disposed against the seal seat and is expandable against the seal seat in response to an axial setting force, such as by sliding up the tapered outer profile of the seal seat and/or buckling outwardly, in response to a setting force. A compliant annular packing element disposed against the seal seat extender is deformable outwardly into sealing engagement with the wellbore in response to the axial setting force.
US11591870B1
A reentry guide tool includes an overshot defining a lower end and comprises a bowl and grapple. The bowl defines an interior space of the overshot, and the grapple is disposed in the bowl and is operable to engage a tubular. A tubular guide nipple has a downhole and an uphole end, the downhole end complementary to the overshot and the uphole end complementary to the reentry guide. The guide nipple is operable to connect and provide a transition between the overshot and reentry guide. The reentry guide is a tubular piece having an uphole end with a bevel. A deployment mechanism is defined on the overshot, reentry guide, or guide nipple, and is operable to connect the reentry guide to a running tool for deployment. A method of providing a transition from a first to a second tubular in a wellbore is also provided.
US11591856B2
A large diameter injection water well is drilled using a drilling derrick and rotary drilling techniques. After snubbing in and drilling a short distance with drilling mud, a temporary drilling header is installed below the blowout preventers. Extending downward from the temporary drilling header is a drop pipe with a valve on the lower end thereof. Drilling pipe with attachments on the lower end thereof, are lowered into the drop pipe with the valve closed. After sealing to the drilling pipe, the valve is opened and the drilling pipe and attachments are lowered to the bottom of the well for the normal drilling operation. Thereafter, the drilling pipe and attachments are removed reversing the process of retracting into the drop pipe and closing the valve before removing the seal from the drilling pipe. The repeated insertion of the drilling pipe with various attachments on the end thereof in the drilling procedure occurs without having to kill or suppress the well until the final step when removing the drop pipe. Large diameter drillable centering guides insures pilot holes are being drilled in the bottom center of the large diameter injection water well.
US11591850B2
A motorized shade for covering an architectural opening that can be actuated by touching its shade material. The motorized shade comprises a shade material extending between an upper end and a lower end and a motor drive unit operably connected to the upper end of the shade material and comprising a motor and a motor control module adapted to control the motor to raise or lower the shade material. The shade material comprises at least partially comprises electrically conductive material. The motor control module comprises a capacitive touch sensor that is electrically connected to the upper end of the shade material via at least one electrical contact. The motor control module is adapted to detect a touch of the shade material via the capacitive touch sensor and in response control the motor to raise or lower the shade material.
US11591849B2
A brake arrangement, for a retractable screen arrangement in which the a screen roller applies a retraction force to the screen and brake arrangement, includes a brake arrangement, for providing a braking force between the brake arrangement and a track which guides the brake arrangement, to resist retraction. The brake arrangement provides a brake member with a friction surface for contacting the bearing surface; a brake member support for supporting the brake member; and a forcing arrangement for forcing the friction surface against the bearing surface. The forcing arrangement includes a biasing arrangement for biasing the friction surface onto the bearing surface, and a force-increasing arrangement for increasing the force with which the friction surface engages the bearing surface. The force increasing arrangement converts a frictional force between the friction surface and the track into additional contact pressure force of the friction surface onto the guide track.
US11591847B2
A position sensing system and method for detecting the displacement of a door from a reference position, such as, for example, from a closed position. The system includes a magnetometer that may be operably connected to the door, and which measures positional location relative to a reference magnetic field, such as, for example, a magnetic field provided by a magnet of a lock device. The system may also include an accelerometer that detects acceleration of the door, and thereby provides an indication of when location is to be measured by the magnetometer. Measurement information from the magnetometer is used to derive a position indicator that is compared to a reference indicator, the reference indicator being associated with the reference position. Differences between the position and reference indicators may provide an indication that the door has been moved from the reference position.
US11591839B2
The invention relates to a linear motor structure for a sliding door, comprising a rotor assembly, wherein the rotor assembly includes a fixed part and a movable part, the fixed part is provided with a permanent magnet, a slot hole is formed in a bottom part of the permanent magnet, the movable part is provided with a telescopic rod that is slidably inserted into the slot hole from one end of the slot hole, and a motion transmission part capable of transmitting a motion of the rotor assembly, and the movable part and the fixed part are fixed by a fastener. The linear motor structure is novel in design, reasonable in structure and favorable in adaptability due to the capability of flexibly adjustment of the rotor assembly according to a width of a door frame.
US11591833B2
A lock assembly comprising a throw bolt, a bolt holder and a bolt keeper. The bolt comprises a cutting barrier and a bolt casing, the bolt casing being more corrosion-resistant than the cutting barrier, and the cutting barrier being more abrasion-resistant that the bolt casing. When assembled, the cutting barrier will be enclosed within the bolt casing.
US11591824B2
The invention relates to a door lock with a locking element (1) for locking the door (3) in a closed state and a fastening element (2) for fastening the locking element (1) to the door (3), wherein that the fastening element (2) has an adjustable adjustment device (4) to compensate for different door thicknesses.
US11591819B2
Collapsible structures are disclosed. In one embodiment, the collapsible structure includes a plurality of hinges and a plurality of panels. The plurality of panels are swingably connected by the plurality of hinges so as to form at least one arch when the collapsible structure is in an erected state and so as to become at least one stack of the plurality of panels in a collapsed state. The panels allow for the collapsible structure to maintain its structural integrity when erected but to have a compact and transportable configuration when collapsed.
US11591813B2
A concrete form includes a first sidewall and a second sidewall positioned in parallel and spaced relation to each other and a cross tie having opposed first and second ends, where at least the first sidewall is a removable sidewall removably secured to the first end of the cross tie. The second sidewall is removably secured to the second end of the cross tie and may be a removable sidewall or a non-removable sidewall. The concrete form also includes a spacer positioned between the first sidewall and the first end of the cross tie. The spacer may be removable along with the first sidewall. Concrete forming assemblies and methods may incorporate concrete forms as described herein.
US11591802B1
A modular crossover system includes one or more platforms, one or more platform guardrails attached to the platform, a plurality of towers supporting the one or more platforms, a plurality of stile assemblies attached to the platforms, or a combination of towers and stile assemblies. An optional fixed ladder may be attached to one of the platforms.
US11591793B2
The disclosure presents a composite conduit formwork structure which includes a cylindrical outer casing adapted to bond with a cylindrical inner casing which are maintained at a fixed distance apart by a plurality of radial stanchions. The inner casing and outer casing form an interior void which is filled with concrete during manufacture. The outer casing and inner casing remain in place to protect the structure once completed. A novel method of assembly is also provided whereby radial stanchions are rotated between the outer casing and inner casing. All of the components in a preferred embodiment are formed of a fiberglass material.
US11591791B2
A masonry block system that includes a stretcher block and a half block, each block having connector means for interlocking with an adjacent block, the blocks being constructed in a such a manner as to enable quick and easy assembly of a building structure.
US11591784B2
A sanitary washing device includes a nozzle, a valve unit, a controller, and a casing. The nozzle is configured to discharge water toward an ano-genital region of a human body. The valve unit is provided on a pipe line between a water supply source and the nozzle. The valve unit includes an electromagnetic valve. The controller is configured to control operation of the nozzle and the valve unit. The casing stores the nozzle, the valve unit, and the controller. The valve unit is disposed further frontward than the controller.
US11591781B2
A flush toilet includes a toilet main body made of ceramics and a control unit. The toilet main body includes a skirt, and a rear storage that can store at least a part of the control unit, the rear storage includes a supporting wall that divides a storage region into upper and lower regions and that supports the control unit, the skirt forms a double wall including an outer wall and an inner wall, the double wall has at least a part that forms an internal space between the outer wall and the inner wall, and the skirt includes a single wall in which the internal space of the double wall is removed in an upper end above a joining portion between the double wall and the supporting wall.
US11591766B2
Various examples are provided related to mobile segmental rail foundation systems, and their assembly, deployment and use. In one example, among others, a mobile rail foundation system includes a segmental rail foundation including a plurality of anchor assemblies and at least one sectional spacer rail assembly configured to detachably attach adjacent anchor assemblies to form the segmental rail foundation. The anchor assemblies can be coupled to soil anchor assemblies and/or hold down assemblies to secure the segmental rail foundation in position. The soil anchor assemblies can include helical pile soil anchor assemblies and the hold down assemblies can include forked hold down plate or brackets secured by anchor bolts.
US11591760B2
In the above embodiment, the second leg distal end may be shaped to directly enter the slot, the distal end being aligned in a direction parallel and offset relative to the longitudinal cable axis. Also in the above embodiment, the first leg distal end may be shaped as an inverted U-shaped hook, the U-shaped hook being perpendicular and offset relative to the longitudinal cable axis and at least part of the post wall beneath the slot fits within the U-shaped hook once the hanger reaches the final seated position. The end shapes noted above are provided by way of example only and should not be seen as limiting.
US11591752B2
Toilet tissue having a dynamic surface comprising a surface material that overlays a textured web material such that the toilet tissue exhibits one or more novel properties and method for making same are provided.
US11591750B2
A two-layer multi-strand cord (60) has a modulus EC such that 50 GPa≤EC≤160 GPa. The cord comprises: (a) an internal layer (CI) of the cord made up of J>1 internal strands (TI) wound in a helix having a modulus EI, each internal strand (TI) comprising: an internal layer (C1) made up of Q≥1 internal threads (F1), and an external layer (C2) made up of N>1 external threads (F2) wound around the internal layer (C1), and (b) an external layer (CE) of the cord made up of L>1 external strands (TE) wound around the internal layer (CI) of the cord, each external strand (TE) comprising: an internal layer (C1′) made up of Q′≥1 internal threads (F1′), and an external layer (C2′) made up of N′>1 external threads (F2′) wound around the internal layer (C1′).
US11591749B2
Provided is a steel cord for rubber article reinforcement, which has both the tensile strength in the cord axial direction and the strength in the shear direction at higher levels. A steel cord (10) for rubber article reinforcement includes: a single core strand (11) having a layer-twisted structure; and plural sheath strands (12) each having a layer-twisted structure, and the sheath strands (12) are twisted around the core strand (11). In the sheath strands (12), a ratio between the diameter of a core filament (12a) and the diameter of a sheath filament (12b) is 0.75 to 0.85, and a ratio between the strength of the core filament (12a) and the strength of the sheath filament (12b) is 0.55 to 0.7.
US11591745B2
Disclosed herein are drying system and method for restoring clothes shrunk after washing and drying of the clothes. The clothes drying system includes: an air injection part for injecting air into the drying system; a drying tube of which the volume is expandable by the air injected through the air injection part; a jig put on the outer surface of the drying tube; and a fixing part attached to the clothes and fixing the clothes and jig so that the clothes put on the outer surface of the jig is not shrunk while being dried.
US11591742B2
A structural arrangement introduced in a liquid dispensing set-up of a household appliance includes at least one feed pipe, at least one movable lid cooperating with a fixed body, and at least one liquid flow driver. The liquid flow driver is disposed adjacent a lower face of the movable lid. The liquid flow driver is associated with the feed pipe through a fluid connector. The fluid connector defines a hinge axis of the movable lid. The liquid flowing through the liquid flow driver is directed inside of at least one washing environment defined in an inside of the household appliance.
US11591717B2
A vapor phase epitaxial growth device comprises a reactor vessel and a wafer holder arranged within the reactor vessel. The wafer holder includes a wafer holding surface configured to hold a wafer with a wafer surface oriented substantially vertically downward. The device comprises a first material gas supply pipe configured to supply a first material gas and arranged below the wafer holding surface. The device comprises a second material gas supply pipe configured to supply a second material gas and arranged below the wafer holding surface. The device comprises a gas exhaust pipe configured to exhaust gases and arranged below the wafer holding surface. A distance between the gas exhaust pipe and an axis line passing through a center of the wafer holding surface is greater than distances between the axis line and each of the first material gas supply pipe and the second material gas supply pipe.
US11591711B2
A silicon carbide ingot producing method is provided. The method produces a silicon carbide ingot in which an internal space of a reactor is depressurized and heated to create a predetermined difference in temperature between upper and lower portions of the internal space. The method produces a silicon carbide ingot in which a plane of a seed crystal corresponding to the rear surface of the silicon carbide ingot is lost minimally. Additionally, the method produces a silicon carbide ingot with few defects and good crystal quality.
US11591708B2
A method for preparing an entropy-stabilized ceramic thin film coating includes preparing a first layer formed by raw materials with a plurality of metal elements, and subjecting the first layer to reaction with anion thereby transforming at least a portion of the first layer to a second layer. The present invention also discloses an entropy-stabilized ceramic thin film coating and a component coated with an entropy-stabilized ceramic thin film coating.
US11591702B2
An article is provided that includes a substrate, a silicon containing layer on the substrate, and a layer including metallic Pt on the silicon containing layer. The silicon containing layer is a diamond-like glass layer. Optionally, the substrate is a porous membrane. In some cases, the silicon containing layer is a continuous layer.
US11591692B2
Organoamino-polysiloxanes, which have at least three silicon atoms, oxygen atoms, as well as an organoamino group, and methods for making the organoamino-polysiloxanes are disclosed. Methods for depositing silicon and oxygen containing films using the organoamino-polysiloxanes are also disclosed.
US11591681B2
An iron-based sintered body includes a metal matrix and complex oxide particles contained in the metal matrix. When a main viewing field having an area of 176 μm×226 μm is taken on a cross section of the iron-based sintered body and divided into a 5×5 array of 25 viewing fields each having an area of 35.2 μm×45.2 μm, the complex oxide particles have an average equivalent circle diameter of from 0.3 μm to 2.5 μm inclusive, and a value obtained by dividing the total area of the 25 viewing fields by the total number of complex oxide particles present in the 25 viewing fields is from 10 μm2/particle to 1,000 μm2/particle inclusive. The number of viewing fields in which no complex oxide particle is present is 4 or less out of the 25 viewing fields.
US11591680B2
Steel material whose constituent grains comprise a matrix in which precipitates are incorporated, the precipitates comprising at least one metallic element selected from a metallic element M, a metallic element M′, a metallic element M″ or mixtures thereof; the microstructure of the steel being such that the grains are equiaxed and the average grain size being such that the average of their largest dimension “Dmax” and/or the average of their smallest dimension “Dmin” is comprised between 10 μm and 50 μm. The steel material has optimized, stable and isotropic mechanical properties, in particular so that the steel material can best withstand mechanical and/or thermal stresses.
US11591678B2
The invention relates to a stainless steel. The stainless steel consists of in weight % (wt. %): C 0.32-0.50 Si 0.1-1.0 Mn 0.1-0.8 Cr11-14 Mo 1.8-2.6 V 0.35-0.70 N 0.05-0.19 optional elements, balance Fe and impurities.
US11591669B2
The invention relates to a process for recovering metals from aqueous solutions or solid feedstocks such as ores and waste. In particular, the invention relates to a method of recovering a target metals using a microorganism.
US11591668B2
Grain-oriented electrical steel sheet excellent in magnetic properties and excellent in adhesion of a primary coating to the steel sheet is provided. The grain-oriented electrical steel sheet is provided with a base steel sheet having a chemical composition containing C: 0.005% or less, Si: 2.5 to 4.5%, Mn: 0.050 to 1.000%, a total of S and Se: 0.005% or less, sol. Al: 0.005% or less, and N: 0.005% or less and having a balance of Fe and impurities and a primary coating having Mg2 SiO4 as a main constituent formed on a surface of the base steel sheet. A peak position of Al emission intensity obtained when conducting elemental analysis by glow discharge spectrometry from a surface of the primary coating in a thickness direction is present in a range of 2.0 to 12.0 μm from a surface of the primary coating to the thickness direction. A sum of perimeters of the Al oxides at the peak position of Al emission intensity is 0.20 to 1.00 μm/μm2, and a number density of Al oxides is 0.02 to 0.20/μm2.
US11591667B2
Provided is a high-strength steel sheet having high impact resistance. The steel sheet includes: by weight %, carbon (C): 0.05% to 0.14%, silicon (Si): 0.01% to 1.0%, manganese (Mn): 1.5% to 2.5%, aluminum (Al): 0.01% to 0.1%, chromium (Cr): 0.005% to 1.0%, phosphorus (P): 0.001% to 0.05%, sulfur (S): 0.001% to 0.01%, nitrogen (N): 0.001% to 0.01%, niobium (Nb): 0.005% to 0.06%, titanium (Ti): 0.005% to 0.11%, and the balance of iron (Fe) and inevitable impurities. The steel sheet has a microstructure comprising ferrite and bainite in a total area fraction of 90% or more. The steel sheet has a value of 0.05 to 1.0 as a shear texture ({110}<112>, {112}<111>) area ratio of a center region (ranging deeper than 1/10t to ½t in a thickness direction, t refers to thickness (mm)) and a surface region (ranging from a surface to 1/10t in the thickness direction).
US11591666B2
A hot-rolled coated steel sheet including: in wt %, C: 0.05-0.14%, Si: 0.1-1.0%, Mn: 1.0-2.0%, P: 0.001-0.05%, S: 0.001-0.01%, AI: 0.01-0.1%, Cr: 0.005-1.0%, Ti: 0.005-0.13%, Nb: 0.005-0.03%, N: 0.001-0.01%, Fe residues, and other inevitable impurities; a mixed structure of ferrite and bainite as a main phase; and as a remaining structure, one or more selected from the group consisting of martensite, austenite, and phase martensite (MA), wherein a fraction of the ferrite and bainite is 95-99 area % and Equation 1 is satisfied. [Equation 1] FCO{110}<112>+FCO{112}<111>≥10 where, FCO{110}<112> and FCO{112}<111>, each representing an area fraction occupied by a structure having ac crystal orientation of {110}<112> and {112}<111>.
US11591659B2
Methods for the rapid detection of the presence or absence of Mycoplasma genitalium (MG) in a biological or non-biological sample are described. The methods can include performing an amplifying step, a hybridizing step, and a detecting step. Furthermore, primers, probes targeting the target MG gene, along with kits are provided that are designed for the detection of MG.
US11591652B2
Methods and systems are provided for massively parallel genetic analysis of single cells in emulsion droplets or reaction containers. Genetic loci of interest are targeted in a single cell using a set of probes, and a fusion complex is formed by molecular linkage and amplification techniques. Methods are provided for high-throughput, massively parallel analysis of the fusion complex in a single cell in a population of at least 10,000 cells. Also provided are methods for tracing genetic information back to a cell using barcode sequences.
US11591651B2
Provided are methods for biological sample processing and analysis. A method can comprise providing a substrate configured to rotate. The substrate can comprise an array having immobilized thereto a biological analyte. A solution comprising a plurality of probes may be directed, via centrifugal force, across the substrate during rotation of the substrate, to couple at least one of the plurality of probes with the biological analyte. A detector can be configured to detect a signal from the at least one probe coupled to the biological analyte, thereby analyzing the biological analyte.
US11591646B2
The present invention may provide a small RNA detection sensor comprising: at one end thereof, a first sensing region comprising nucleotides having a sequence complementary to target small RNA; and a PCR-capable region that is coupled to the first sensing region, the small RNA detection sensor to synthesize a replication region complementary to the PCR-capable region by a DNA polymerase by using the target small RNA as a primer, and amplify the PCR-capable region and the replication region.
US11591634B1
The present disclosure provides a novel integrated entropy-based method that combines genome-wide profiling and network analyses for diagnostic and prognostic applications. The present disclosure further provides the integration of multiomics datasets, network analyses and machine learning that enable predictions on diagnosing infectious diseases and predicting the probability that they will escape treatment/the host immune system and/or become antibiotic resistant. The present disclosure provides a primary gateway towards the development of highly accurate infectious disease prognostics.
US11591630B2
The present invention relates to a novel peptide or a partial sequence thereof for enhancing expression efficiency of a target protein, and a fusion protein comprising the same. The novel peptide according to the present invention can enhance expression efficiency of a target protein, and furthermore, the peptide can also be applied to a solubility-enhancing fusion protein in order to enhance solubility of the target protein, so that solubility as well as expression efficiency of the target protein is enhanced, which allows such a peptide to be usefully used for production of a recombinant target protein.
US11591628B2
The present disclosure relates to synthesis of heparin, which may be bioequivalent to porcine USP Heparin Sodium. The synthesis may involve three intermediates starting from heparosan.
US11591624B2
The invention relates to a method and an apparatus for treating plant based raw material with an enzymatic hydrolysis, in which the plant based raw material (1) is treated to form lignocellulosic material (3a,3b) and the lignocellulosic material (3a,3b) or its fraction (10) is conducted into the enzymatic hydrolysis (4), wherein the method comprises at least one treatment stage (2a,2b,2c) in which the plant based raw material (1) is treated so that the lignocellulosic material (3a,3b) contains over 80% fine solid particles which are fiber-like or indefinable particles smaller than 0.2 mm, defined by an optical measurement device, the lignocellulosic material (3a,3b) or at least one fraction (10) of the lignocellulosic material is supplied into the enzymatic hydrolysis (4) for forming a lignin based material (5), and at least one solid-liquid separation stage (6) after the enzymatic hydrolysis (4) in which a lignin fraction (7) and a soluble carbohydrate containing fraction (8) are separated. Further, the invention relates to the soluble carbohydrate containing fraction, the lignin fraction, the lignin based material, the liquid fraction and the solid fraction, and their uses.
US11591617B2
The present invention relates to a method for transducing a target cell, the method comprising the step of contacting a target cell with a retroviral vector and a poloxamer having a molecular weight of 12.8 kDa to about 15 kDa. Further, the invention relates to the use of a poloxamer as defined herein, optionally in combination with a polycationic substance as defined herein, for transducing a target cell with a retroviral vector and a kit comprising a retroviral vector, a poloxamer as defined herein and, optionally, instructions for use.
US11591610B2
Provided are (i) a tobacco plant which is suitable for cultivation for harvesting leaf tobaccos, (ii) a method of obtaining the tobacco plant, (iii) a harvest from the tobacco plant, and (iv) a processed product of the harvest. The present invention encompasses (i) a tobacco plant into which a mutation for suppressing the development of primary axillary buds is introduced, (ii) a method of obtaining the tobacco plant, (iii) a harvest from the tobacco plant, and (iv) a processed product of the harvest.
US11591607B2
This invention relates to CRISPR-Cas nucleases codon optimized for expression in plants and nucleic acid constructs encoding base editors comprising a CRISPR-Cas nuclease and a deaminase domain, wherein the nucleic acid constructs are optimized for expression in a plant. The invention further relates to methods of modifying nucleic acids using the nucleic acid constructs.
US11591604B2
Provided herein, in some aspects, are tools (e.g., methods, compositions and nucleic acids) for building genetic circuits in Bacteroides and Parabacteroides bacteria, as well as the bacteria containing the genetic circuits.
US11591601B2
The application relates to methods for compositions for identifying lncRNA loci associated with target genotypes or phenotypes, including desirable plant genotypes or phenotype. The application also relates to regulatory regions and genes associated with drug resistance, such as resistance to BRAF-inhibitors. Such regulatory regions and genes form the basis for methods for identifying resistance to BRAF-inhibitors, which is useful for improving disease prognosis, treatment, and likely outcomes. The regulatory regions and genes are also suitable targets for therapy in melanoma that is resistant to BRAF-inhibitors.
US11591600B2
The present technology relates, in part, to long double-stranded RNA (dsRNA) (e.g., 30 or more base pairs) that inhibits gene expression.
US11591594B2
Recent advancements in LNA oligonucleotides include the use of amine linkers to link an LNA antisense oligonucleotide to a conjugate group. For example please see WO2014/I18267. The present invention originates from the identification of a problem when de-protecting LNA oligonucleotides which comprise an aliphatic amine group and DMF protected LNA G nucleoside, which results in the production of a +28 Da impurity. This problem is solved by using acyl protection groups on the exocyclic nitrogen of the LNA-G residue, rather than the standard DMF protection group.
US11591589B2
Engineered CRISPR from Prevotella and Francisella 1 (Cpf1) nucleases with improved targeting range and enhanced on-target activity, and their use in genomic engineering, epigenomic engineering, base editing, genome targeting, genome editing, and in vitro diagnostics.
US11591586B2
The present invention relates to novel subtilase variants exhibiting increased stability and preferably on par or improved wash performance. The variants of the invention are suitable for use in e.g. cleaning or detergent compositions, such as laundry detergent compositions and dish wash compositions, including automatic dish wash compositions. The present invention also relates to isolated DNA sequences encoding the variants, expression vectors, host cells, and methods for producing and using the variants of the invention.
US11591583B2
Recombinant human alpha glucosidase (rhGAA) composition derived from CHO cells that contains a more optimized glycan composition consisting of a higher amount of rhGAA containing N-glycans carrying mannose-6-phosphate (M6P) or bis-M6P than conventional rhGAAs, along with low amount of non-phosphorylated high mannose glycans, and low amount of terminal galactose on complex oligosaccharides. Compositions containing the rhGAA, and methods of use are described.
US11591582B2
The present disclosure provides improved genome editing compositions and methods for editing a TCRα gene.
US11591581B2
The invention provides for delivery, engineering and optimization of systems, methods, and compositions for manipulation of sequences and/or activities of target sequences. Provided are delivery systems and tissues or organ which are targeted as sites for delivery. Also provided are vectors and vector systems some of which encode one or more components of a SIN CRISPR complex, as well as methods for the design and use of such vectors. Also provided are methods of directing SIN CRISPR complex formation in eukaryotic cells to ensure enhanced specificity for target recognition and avoidance of toxicity and to edit or modify a target site in a genomic locus of interest to alter or improve the status of a disease or a condition.
US11591568B2
The present invention relates to myeloid-derived suppressor cells (MDSC) and exosomes derived therefrom (MDSC exo) and application thereof.
US11591565B2
The present application discloses a cell culture media for growth, maintenance and induction of reversion to a less mature state of a cell comprising a MUC1* activating ligand.
US11591559B2
The disclosure relates to bioreactors, for example for biological treatment and, more specifically to bioreactor insert apparatus including biofilms and related methods. The bioreactor insert apparatus provides a means for circulation of reaction medium within the bioreactor, a biofilm support, and biological treatment of an inlet feed to the reactor/insert apparatus. The bioreactor insert apparatus has a high relative surface area for biofilm attachment and is capable of generating complex flow patterns and increasing treatment efficiency/biological conversion activity in a biologically-active reactor. The high surface area structure incorporates multiple biofilm support structures such as meshes at inlet and outlet portions of the structure. The biofilm support structures and biofilms thereon can increase overall reaction rate of the bioreactor and/or perform some solid/liquid separation in the treatment of the wastewater or other influent.
US11591555B2
The present invention relates to a method for cultivating cells, in particular tissues, comprising a carrier plate unit, which has at least one access opening, at least one cultivation chamber, and at least one channel connecting the access opening to the cultivation chamber.
US11591542B2
A fragrance composition for use with a sanitary or incontinence article in the treatment of malodour caused by or associated with human body fluids, wherein said composition has an odour that is reminiscent of the odour of the article, as such, or the odour of the packaging material for said article, as such.
US11591540B2
A method for extracting naturally occurring oil bodies (oleosomes) from a material containing naturally occurring oil bodies (oleosomes) includes the steps of dispersing the material containing oleosomes in an aqueous composition to thereby obtain an aqueous dispersion of material containing oleosomes, extracting oleosomes from the aqueous dispersion of material containing oleosomes to thereby obtain a crude oleosome extract and isolating crude oleosomes from the extract by drying the crude oleosome extract. The dried oleosome powder may be used with a personal care product, a pharmaceutical product or a food product.
US11591539B2
The present invention provides a lubricant composition comprising: (i) a base oil (ii) an organophilic clay-based thickener; and (iii) a solid lubricant, wherein said solid lubricant does not comprise any heavy metals. The present invention also provides the use of a lubricant composition comprising: a base oil; an organophilic clay-based thickener; and a solid lubricant, wherein said solid lubricant does not comprise any heavy metals, as a pipe dope.
US11591537B2
The invention relates to lubricating greases based on alkali metal soaps and/or earth-alkali metal soaps and metal complex soaps based on (R)-10-hydroxyoctadecanoic acid and to the use thereof.
US11591536B2
The present invention relates to a novel process for the synthesis of (per)fluoropolyether polymers, to certain novel (per)fluoropolyether polymers. The present invention also relates to the use of the (per)fluoropolyether polymers thus obtained as intermediate compounds for the manufacture of further polymers suitable for use as lubricants, notably for magnetic recording media (MRM).
US11591532B2
An unleaded gasoline composition comprises, based on the total volume of the unleaded gasoline composition, 50 to 96 vol. % of an unleaded gasoline; 2 to 20 vol. % of a mixed butanol; and 2 to 30 vol. % of a distillate oil fraction comprising a paraffin, an olefin, a naphthene, and an aromatic at an initial boiling point cut of 180° C., wherein the unleaded gasoline, the mixed butanol, and the distillate oil fraction are selected to provide the unleaded gasoline composition with a Research Octane Number of 90 to 101, determined in accordance with ASTM D 2699; and a Motor Octane Number of 81.4 to 90, determined in accordance with ASTM D 2700.
US11591530B2
The furnace of a delayed coking unit which is utilized for heating residue feeds to high temperatures can suffer from decrease in run length and fouling caused by caustic carryover from the upstream desalter unit. An antifoulant additive for preventing caustic induced fouling of thermal cracker furnace tubes is disclosed. The described antifoulant additive acts by converting the inorganic caustic compound such as NaOH to naphthenate salt of the metal as well as by reducing the fouling tendency of the whole feedstock, thereby making it ineffective in causing coking reaction. The additive finds application in thermal residue upgradation furnaces such as delayed coking unit, visbreaker, etc.
US11591525B2
Disclosed is a method for anaerobically cracking a power battery, which includes the following steps: disassembling a waste power battery to obtain a battery cell; taking out a diaphragm from the battery cell for later use, and pyrolyzing the battery cell to obtain electrode powder; extracting nickel, cobalt and manganese elements from the electrode powder with an extraction buffer, filtering, taking the filtrate, then adjusting the filtrate with a nickel solution, a cobalt solution and a manganese solution to obtain a solution A, adding the solution A dropwise into ammonium hydroxide under stirring, and then adding an alkali solution under stirring to obtain a solution B; subjecting the solution B to a hydrothermal reaction, filtering, and roasting to obtain a catalyst, such that a chemical formula of the catalyst is Ni2+1-x-yCo2+xMn2+yO, where 0.25≤x<0.45, 0.25≤y<0.45.
US11591521B2
Disclosed herein is a hermetically sealed flow-through reactor for non-oxidative thermal degradation of a rubber containing waste into a char product, the reactor having an internal cylindrical surface, and the reactor including: an inlet and an outlet; one or more thermal reaction zones arranged between the inlet and the outlet, wherein each thermal reaction zone is provided with: one or more heating elements controllable to heat the thermal reaction zone to an operating temperature for mediating the non-oxidative thermal degradation of rubber in the rubber containing waste, and one or more gas outlets for withdrawing gas or gases evolved during the non-oxidative thermal degradation of the rubber; and a screw auger located within the reactor, the screw augur configured to rotate in both the forward and reverse directions to agitate and transport the rubber containing waste through the one or more thermal reaction zones in both the forward and reverse directions and to the outlet, wherein flighting on the screw auger tracks the internal cylindrical surface of the reactor in close relationship to minimise or prevent the transport of material through a clearance space between outer edges of the flighting and the internal cylindrical surface of the reactor.
US11591520B2
The present invention provides alumina hydrate particles, a flame retardant and a resin composition that are each for an electric wire/cable covering material improvable in flame retardancy and mechanical properties while the covering material keeps acid resistance; such an electric wire/cable; and producing methods thereof. The alumina hydrate particles of the present invention for electric wire/cable covering material have an average particle size of 0.5 to 2.5 μm, and having a primary particle variation R of 24% or less, the variation R being represented by the following expression: primary particle variation R (%)=“standard deviationσ(μm) of major axis diameters of the primary particles”/“average value(μm) of the major axis diameters of the primary particles”×100.
US11591519B2
A polymerizable liquid crystal composition containing two polymerizable liquid crystal compounds (A) and (B) is provided. A polymer of compound (A) exhibits a reverse wavelength dispersion property and the phase difference value [R(A,3000,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 3000 mJ/cm2 varies in a positive sense relative to the phase difference value [R(A,500,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 500 mJ/cm2. A polymer of compound (B) exhibits a reverse wavelength dispersion property and the phase difference value [R(B,3000,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 3000 mJ/cm2 varies in a negative sense relative to the phase difference value [R(B,500,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 500 mJ/cm2.
US11591510B1
A method may include: providing a cleanout fluid comprising a single anionic surfactant, a single nonionic surfactant, and a solvent; preparing a cleanout pill by mixing the cleanout fluid with a brine; and displacing a fluid in a wellbore using the cleanout pill.
US11591507B2
In accordance with one or more embodiments of the present disclosure, a drilling fluid may include a base fluid, one or more formaldehyde-based resins, and one or more water-soluble acid catalysts. The base fluid may include an aqueous or non-aqueous solution. The one or more water-soluble acid catalysts may be present in an amount sufficient to reduce the pH of the drilling fluid to less than or equal to 6. The present disclosure also describes sealed subterranean petroleum formations that include such drilling fluids and methods for sealing subterranean wellbores by utilizing such drilling fluids.
US11591480B2
A method of manufacturing a solid electrolytic capacitor, including: a step (A) of providing a conjugated conductive polymer-containing dispersion by polymerizing, in a dispersion medium containing seed particles turned into protective colloid by a polyanion or in a dispersion medium containing the polyanion, a monomer for obtaining a conjugated conductive polymer; a step (B) of preparing a dispersion containing a morpholine compound and the conjugated conductive polymer by adding the morpholine compound to the conjugated conductive polymer-containing dispersion; a step (C) of causing the dispersion to adhere to a porous anode body formed of a valve metal having a dielectric film on a surface thereof; and a step (D) of forming a solid electrolyte layer by removing the dispersion medium from the dispersion containing the morpholine compound and the conjugated conductive polymer, the dispersion adhering to the porous anode body.
US11591479B2
The present disclosure relates to a primer coating material composition, obtainable by combining at least two components (A) and (B) of a coating material system, which are different from one another and present separately from one another, with component (B) being nonaqueous and including at least one polyisocyanate having more than two free isocyanate groups, at least one organic solvent, and, further, at least one Si-containing compound which contains at least one hydrolyzable radical and at least one non-hydrolyzable organic radical, for at least partial application to at least one optionally pretreated surface of a plastics substrate, to a method for producing a corresponding coating on such a substrate, and to a method for at least partially coating at least one surface of a plastics substrate with a multicoat paint system.
US11591459B2
A thermoplastic elastomer composition contains component (A-2), component (B), and component (C). The content of component (A-2) is 5 parts by weight or more and 95 parts by weight or less with respect to 100 parts by weight of the total amounts of components (A-2) and (B), and the content of component (C) is 0.005% by weight or more and 3% by weight or less with respect to 100% by weight of the whole amount of the thermoplastic elastomer composition. Component (A-2) is a crosslinked product of component (A-1), which is an ethylene copolymer containing a monomer unit derived from propylene and/or α-olefins having 4 to 10 carbon atoms, and a monomer unit derived from ethylene, and having a Mooney viscosity (ML1+4, 125° C.) of 50 or more. Component (B) is a propylene polymer and component (C) is an antifungal agent.
US11591457B1
A composite material includes a combination including a thermoplastic resin mixed with a polypropylene-graft-maleic anhydride (PPgMA), and a plurality of carbon particles mixed in the combination. The plurality of carbon particles may include a first region having a relatively low concentration of carbon particles, and a second region having a relatively high concentration of carbon particles, at least some of the plurality of carbon particles having exposed carbon surfaces with carbon atoms bonded to molecular sites on adjacent PPgMA molecules and oxidized with one or more oxygen-containing groups. In some aspects, composite material further includes between 80 wt. % and 90 wt. % of the thermoplastic resin, between 0.5 wt. % and 15 wt. % of the PPgMA, and between 0.1 wt. % to 7 wt. % of carbon particles. The composite material may also include a plurality of pores, formed in the combination, and configured to be infiltrated by the PPgMA.
US11591455B2
The present invention relates to a cable jacket composition comprising a multimodal olefin copolymer, wherein said olefin copolymer has a density of 0.935-0.960 g/cm3 and MFR2 of 1.5-10.0 g/10 min and comprises a bimodal polymer mixture of a low molecular weight homo- or copolymer and a high molecular weight copolymer wherein the composition has ESCR of at least 2000 hours and wherein the numerical values of cable wear index and composition MFR2 (g/10 min) follow the correlation: Wear index<15.500+0.900*composition MFR2. The invention further relates to the process for preparing said composition and its use as outer jacket layer for a cable, preferably a communication cable, most preferably a fiber optic cable.
US11591449B2
Disclosed herein are method and design rules for making polyelemental systems with specific heterostructures, including tetra-phase nanopartides with as many as six junctions. In accordance with an embodiment, a method of making a tetra-phase polyelemental nanoparticle using tri-phase nanoparticle architectures can include selecting two or more triphase nanoparticle architectures, wherein the two or more tri-phase nanoparticle architectures are one or more striped tri-phase architectures, one or more pie-shaped tri-phase architectures, or combinations thereof; identifying from the selected two or more tri-phase nanoparticle architectures groups of metals for generating each of the two or more tri-phase nanoparticle architectures; contacting a tip coated with an ink to a substrate to form a nanoreactor, the ink comprising block copolymer and the metals from the groups of metals identified for generating each of the two or more tri-phase nanoparticle architectures; and annealing the nanoreactors under conditions sufficient to synthesize a tetra-phase polyelemental nanoparticle.
US11591448B2
The method for the physical reutilization of sheet-like siliconized structures comprises treating the sheet-like siliconized structure in a liquid digestion system comprising acetic anhydride and/or an acetoxysiloxane, and at least one Brønsted acid, optionally solvent, preferably with addition of acetic acid, and removing the desiliconized sheet-like structure from the liquid phase.
US11591447B2
A reinforcing sheet including one or more layers of a reinforcing material, and a thermosetting adhesive associated with the reinforcing material, wherein the thermosetting adhesive includes a curing agent, and an epoxy-modified dimerized fatty acid combined with an epoxy terminated polyurethane interpenetrating network.
US11591438B2
The invention relates to a process of processing a radiation-curable composition with an additive-manufacturing technique comprising a radiation-curing step, the radiation-curable composition comprising mercapto-functional Component A comprising at least three mercapto moieties, crosslinker Component B with at least three vinyl or allyl moieties, photo-initiator(s) Component C for initiating a curing reaction between Component A and Component B, wherein the radiation-curable composition does not comprise urethane (meth)acrylate oligomers in an amount of more than 4 wt. % with respect to the whole composition. 3-dim articles which can be produced are typically transparent and have adequate mechanical properties. The radiation-curable composition is in particular useful for producing clear-tray aligners for dental and orthodontic purposes.
US11591434B2
Metal oxide having a surface onto which a multitude of individual polymers are grafted, each polymer comprising an addition polymer having a first and a second end, and a first moiety comprising a terminal phosphonate group, which first moiety is bonded to the first end, which phosphonate group attaches to the metal oxide surface in such a way that the multitude of the grafted polymers comprises at least one group of adjacent polymers that have a stretched chain conformation wherein the adjacent stretched chains have a substantially parallel orientation, such that the polymers within said group together form a brush structure. Method of grafting a multitude of individual polymers onto a surface of a metal oxide.
US11591433B2
The present disclosure is to provide a photopolymer composition including a polymer matrix or a precursor thereof including a reaction product of a reactive isocyanate compound having a hydrogen bonding functional group capable of forming multiple hydrogen bonds and at least one isocyanate group, and a polyol having at least two hydroxyl groups; a photoreactive monomer; and a photoinitiator, a hologram recording medium produced from the photopolymer composition, an optical element including the photopolymer composition and a holographic recording method using the photopolymer composition.
US11591422B2
A method can be used for manufacturing an ethylene-propylene-diene terpolymer for a fuel cell. A polymerization step includes subjecting an organic chelate compound forming a coordinate bond, a vanadium-based Ziegler-Natta catalyst, an organoaluminum compound, and ethylene, propylene, and diene monomers, together with a solvent, to polymerization in a reactor. A separation step includes recovering residual catalysts and unreacted monomers from the stream discharged from the reactor. An acquisition step includes recovering the solvent from the stream deprived of the residual catalysts and unreacted monomers to acquire the ethylene-propylene-diene terpolymer.
US11591418B2
The present invention particularly relates to synthesizing photo-initiators having poly-oligo-silsesquioxane (POSS) structure and realizing photo-polymerization by using these photo-initiators and simultaneous and in-situ synthesis of Ag nano-particles in polymer matrix comprising POSS structure and obtaining wrinkled surfaces as a result of self-arranging thereof.
US11591416B2
The present invention refers to exopolysaccharide molecules, conditioned media or compositions comprising said molecules or media. Moreover, the present invention refers to use of said exopolysaccharide molecules, conditioned media or compositions as prebiotic, preferably to boost immune system.
US11591411B2
The present application discloses regioselectively substituted cellulose esters, films made from the regioselectively substituted cellulose esters and methods for making the same. The regioselectively substituted cellulose esters are synthesized using trifluoroacetic anhydride and cellulose with various acyl donors or acyl donor precursors.
US11591410B2
A cellulose derivative having a long-chain organic group having 5 or more carbon atoms and a short-chain organic group having 4 or less carbon atoms which are introduced by use of hydroxy groups of a cellulose, and including a crystal structure derived from a cellulose derivative portion to which the short-chain organic group is linked, wherein an average number of hydroxy groups per glucose unit is of 1.0 or less.
US11591400B2
The present invention is directed to novel B7-H3-binding molecules capable of binding to human and non-human B7-H3, and in particular to such molecules that are cross-reactive with B7-H3 of a non-human primate (e.g., a cynomolgus monkey). The invention additionally pertains to B7-H3-binding molecules that comprise Variable Light Chain and/or Variable Heavy Chain (VH) Domains that have been humanized and/or deimmunized so as to exhibit a reduced immunogenicity upon administration to recipient subjects. The invention particularly pertains to bispecific, trispecific or multispecific B7-H3-binding molecules, including bispecific diabodies, BiTEs, bispecific antibodies, trivalent binding molecules, etc. that comprise: (i) such B7-H3-binding Variable Domains and (ii) a domain capable of binding to an epitope of a molecule present on the surface of an effector cell. The invention is also directed to pharmaceutical compositions that contain any of such B7-H3-binding molecules, and to methods involving the use of any of such B7-H3-binding molecules in the treatment of cancer and other diseases and conditions. The invention also particularly pertains to a molecule that comprises the human B7-H3 binding domain of a humanized anti-human B7-H3 antibody conjugated to at least one drug moiety (a “B7-H3-ADC”). The invention is also directed to pharmaceutical compositions that contain such B7-H3-ADCs, and to methods involving the use of any of such B7-H3-ADCs in the treatment of cancer and other diseases and conditions.
US11591399B2
The present invention relates to anti-human PD-L2 antibodies, or the antigen binding parts thereof, which specifically bind human PD-L2 such that PD-L2 binding to PD-1 is blocked, wherein preferably said antibodies or antigen binding parts do not bind to mouse PD-L2 and human PD-L1 but bind to cyno PD-L2, preferably as determined by FACS analysis. The present invention also relates to nucleotide sequences encoding the anti-human PD-L2 antibodies, vectors and cells containing the nucleotide sequences. The antibodies and/or compositions of the invention are useful in human therapy, e.g., cancer therapy, and/or in cell-line based bioassays for determining T cell signalling.
US11591398B2
The invention relates to PD-1 binding agents that block the interaction of PD-1 with its ligands, and the use of such binding agents in the treatment, prevention and detection of disease.
US11591397B2
The present invention generally relates to antibodies that bind to CD3, including multi specific antibodies e.g. for activating T cells. In addition, the present invention relates to polynucleotides encoding such antibodies, and vectors and host cells comprising such polynucleotides. The invention further relates to methods for producing the antibodies, and to methods of using them in the treatment of disease.
US11591396B2
The present invention relates to a bispecific antibody construct comprising a first binding domain which binds to human DLL3 on the surface of a target cell and a second binding domain which binds to human CD3 on the surface of a T cell. Moreover, the invention provides a polynucleotide encoding the antibody construct, a vector comprising the polynucleotide and a host cell transformed or transfected with the polynucleotide or vector. Furthermore, the invention provides a process for the production of the antibody construct of the invention, a medical use of the antibody construct and a kit comprising the antibody construct.
US11591393B2
Blockade of immune checkpoints such as cytotoxic T-lymphocyte antigen-4 (CTLA-4) and programmed death-1 (PD-1) shows promise in patients with cancer. Inhibitory antibodies directed at these receptors have been shown to break immune tolerance and promote anti-tumor immunity. These agents work particularly well in patients with a certain category of tumor. Such tumors may be particularly susceptible to treatment because of the multitude of neoantigens which they produce.
US11591387B2
The present invention provides compounds and methods targeting human interleukin-19, including therapeutic antibodies, pharmaceutical compositions and diagnostic applications useful in the field of immune-mediated diseases including psoriasis, atopic dermatitis, psoriatic arthritis, bronchial asthma and diabetic nephropathy.
US11591383B2
Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).
US11591382B2
The present invention provides compositions comprising a Fc-containing protein wherein substantially all the Fc domains have a C-terminal lysine. Further provided are host cell for producing said compositions, methods of making said host cells and compositions, and method of use thereof.
US11591374B2
The present disclosure discloses recombinant Escherichia coli and application thereof in screening erythritol-producing strains, and belongs to the technical field of microorganisms. The recombinant Escherichia coli used in a method for screening an erythritol-producing strain disclosed by the present disclosure can well perform positive correlation induction on erythritol with different concentrations, so that the method for screening the erythritol-producing strain has the advantage of high sensitivity. High-concentration glucose is usually adopted as a fermentation substrate when erythritol is produced in a fermentation mode in the industry, but the method for screening the erythritol-producing strain disclosed by the present disclosure can overcome the interference of the high-concentration glucose, and under the interference of the high-concentration glucose, the recombinant Escherichia coli used in the method for screening the erythritol-producing strain can still well perform positive correlation induction on erythritol with different concentrations, and the correlation is higher than that without the interference of the glucose. Therefore, the method for screening the erythritol-producing strain has the advantage of strong anti-interference capability.
US11591371B2
Disclosed are peptides comprising a monomeric Fc fragment of an immunoglobulin recognized by a neonatal receptor (FcRn); an influenza HA protein; and a trimerization domain. Disclosed are compositions comprising one or more of the peptides described herein. Disclosed are nucleic acid sequences capable of encoding any one of the peptides described herein. Disclosed are methods for eliciting a protective immune response against influenza comprising administering to a subject an effective amount of a composition comprising a monomeric Fc fragment of an immunoglobulin recognized by a FcRn; an influenza HA protein; and a trimerization domain, wherein the administering is to a mucosal epithelium. Disclosed are methods of treating a subject exposed to influenza or at risk of being exposed to influenza comprising administering to the subject an effective amount of a composition comprising a monomeric Fc fragment of an immunoglobulin recognized by a FcRn; an influenza HA protein; and a trimerization domain, wherein the administering is to a mucosal epithelium.
US11591369B2
The present invention provides peptides and peptide-conjugates that bind to αvβ6 integrin. The peptide-conjugates can be used for a variety of imaging and therapeutic applications. Methods of use and peptide optimization are also provided herein.
US11591365B2
Disclosed here are polypeptides derived from the HD2 domain of human B-cell CLL/lymphoma 9 (BCL9) protein and variants thereof, as well as their use in the diagnosis, prevention, and/or treatment of a disease or disorder. Also disclosed are methods of generating such polypeptides and variants thereof.
US11591359B2
It is an object of the present invention to provide a fluorescence imaging probe capable of selectively visualizing target cells such as cells expressing β-galactosidase (lacZ expressing cells) at a single-cell level in a red fluorescence region, and of performing co-staining together with GFP. An intracellularly-retainable red fluorescent probe comprising a compound represented by the following formula (I) or a salt thereof: wherein: A represents a monovalent group cleaved by an enzyme; R1 represents a hydrogen atom, or one to four of the same or different substituents bonded to a benzene ring; R3, R4, R5, and R6 each independently represent —CFR10R11, —CF2R12, a hydrogen atom, a hydroxyl group, an alkyl group, or a halogen atom, wherein at least one of R3, R4, R5, and R6 is —CFR10R11 or —CF2R12; R2 and R7 each independently represent a hydrogen atom, a hydroxyl group, an alkyl group, or a halogen atom; R8 and R9 each independently represent a hydrogen atom or an alkyl group; R10, R11, and R12 each independently represent a hydrogen atom, an alkyl group, or an alkenyl group; X represents Si(Ra) (Rb), wherein Ra and Rb each independently represent a hydrogen atom or an alkyl group; and Y is —C(═O)— or —RcC(═O)—, wherein Rc is an alkylene group having 1-3 carbon atoms.
US11591346B2
The present invention generally relates to novel pharmaceutical formulations containing 2-[3,5-Bis(trifluoromethyl)phenyl]-N-{4-(4-fluoro-2-methylphenyl)-6-[(7S,9aS)-7-(hydroxymethyl)hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl]-3-pyridinyl}-N,2-dimethylpropanamide, methods of preparation thereof and their use in medical therapy.
US11591342B2
Disclosed in the present invention are a heterocyclic compound, an application thereof and a pharmaceutical composition comprising the same. Provided by the present invention are a heterocyclic compound represented by formula I or a pharmaceutically acceptable salt thereof. The compound has a novel structure and a good inhibitory activity against autotaxin (ATX).
US11591337B2
Disclosed are triazole, imidazole and pyrrole condensed piperazine derivatives and their use as allosteric modulators of mGlus receptor activity, pharmaceutical compositions comprising such compounds, and methods of treatment therewith. Compounds of the invention can be used for the treatment and/or prevention of neurological and psychiatric disorders associated with glutamate dysfunction such as schizophrenia or cognitive decline, dementia or cognitive impairment, or other pathologies that can be related either directly or indirectly to glutamate dysfunction, i.e., disorders treatable by positive allosteric modulation (PAM) or by negative allosteric modulation (NAM) of mGluR5.
US11591336B2
The present disclosure relates to compounds of formula (I) and pharmaceutical compositions thereof and methods for inhibiting the activity of SHP2 phosphatase with the compounds and compositions of the disclosure. The present disclosure further relates to, but is not limited to, methods for treating disorders associated with SHP2 deregulation with the compounds and compositions of the disclosure.
US11591335B2
The present invention relates to compounds of formula I, wherein the variables are defined as given in the description and claims. The invention further relates to uses, processes and composition for compounds I.
US11591323B2
Novel Gi/o-biased muscarinic agonists selectively activate only one specific signaling pathway and are novel pharmacophores for development of new painkillers (analgesics). Methods of making and using these agonists are also described. The muscarinic agonists are of the formula: or an analog, derivative or pharmaceutically acceptable salt thereof, wherein: R1=H or Me; R2=H, Me, Et, OMe, OEt, F, Cl, Br, I, or NO2; and R3=H, Me, Et, OMe, or CO2Me (R3 may be bonded to any carbon of the rings).
US11591317B2
The invention relates to an organic molecule, in particular for use in organic optoelectronic devices. According to the invention, the organic molecule has a structure of Formula I wherein Q is at each occurrence N or CRIII; W is at each occurrence N or CRIV; Z is at selected from the group consisting of a direct bond, CR3R4, C═CR3R4, C═O, C═NR3, NR3, O, SiR3R4, S, S(O) and S(O)2; RA is selected from the group consisting of CN and CF3; and wherein exactly one Q and exactly one W is N.
US11591310B2
The present disclosure discloses a method for preparing lenalidomide. The present disclosure provides a method for preparing lenalidomide I, which comprises the following steps: in a solvent, the lenalidomide intermediate II is reduced with a metal in the presence of an organic acid to obtain the lenalidomide I, wherein the metal is one or more selected from zinc, iron, aluminum and manganese. The preparation method of the disclosure has simple and safe operation, simple post-processing steps, environmental friendliness, high total yield. Moreover, the product obtained in the method has a purity of more than 99.90%, maximum single impurity of less than 0.10%, total heavy metal residue of less than 10 ppm and meet the heavy metal residue standard and API standard. Furthermore, the method has a low production cost and is suitable for industrial production.
US11591292B2
Compositions that include cationic surfactants and methods of synthesizing compositions that include cationic surfactants. The surfactants include a quaternary amine and a saturated or unsaturated alkyl chain with 4 to 28 carbons. The surfactants can be generated by reacting a fatty acid modified with an amino alkyl group and an epihalohydrin in the presence of a base. The cationic surfactants can be generated by reacting a fatty acid modified with an amino alkyl group, an epihalohydrin, and a carboxylic acid. The cationic surfactants can be generated by reacting a carboxylic acid, an epihalohydrin, and a catalyst to afford a halo-substituted alkyl ester, followed by reacting the halo-substituted alky ester with a fatty acid modified with an amino alkyl group.
US11591290B2
This invention provides novel 3-amino propanamide selective androgen receptor degrader (SARD) compounds, pharmaceutical compositions and uses thereof in treating prostate cancer, advanced prostate cancer, castration resistant prostate cancer, androgenic alopecia or other 5 hyperandrogenic dermal diseases, Kennedy's disease, amyotrophic lateral sclerosis (ALS), and uterine fibroids, and to methods for reducing the levels of androgen receptor-full length (AR-FL) including pathogenic or resistance mutations, AR-splice variants (AR-SV), and pathogenic polyglutamine (polyQ) polymorphisms of AR in a subject.
US11591282B2
A process for process for preparing 6-isopropenyl-3-methyl-9-decenyl acetate of the following formula (3), wherein Ac represents an acetyl group, the process comprising steps of: preparing a nucleophilic reagent, 5-isopropenyl-2-methyl-8-nonenyl compound, of the following general formula (1): wherein M1 represents Li, MgZ1, ZnZ1, Cu, CuZ1, or CuLiZ1, wherein Z1 represents a halogen atom or a 5-isopropenyl-2-methyl-8-nonenyl group, from a 5-isopropenyl-2-methyl-8-nonenyl halide compound of the following general formula (4): wherein X1 represents a halogen atom; subjecting the nucleophilic reagent (1), 5-isopropenyl-2-methyl-8-nonenyl compound, to an addition reaction with at least one electrophilic reagent selected from the group consisting of formaldehyde, paraformaldehyde, and 1,3,5-trioxane, followed by a hydrolysis reaction to form 6-isopropenyl-3-methyl-9-decenol of the following formula (2); and acetylating 6-isopropenyl-3-methyl-9-decenol (2) to form 6-isopropenyl-3-methyl-9-decenyl acetate (3).
US11591277B2
Provided herein are photochemical separations. The methods herein can include exposing a first metal complex and a second metal complex to light to facilitate an irreversible chemical reaction to form a modified first metal complex. The modified first metal complex then may be separated from the second metal complex. Compositions also are provided.
US11591276B2
A system and method are provided for manufacturing the polymer-coated fertilizers with a controlled release in a single pass. The system has a feeding mechanism connected to a first chill roll to supply the articles to the first cavities provided on the first roll to store and hold the articles. A first machine produces and applies a first polymer film on the articles held in the first chill roll to coat the articles partially with the first polymer film. The partially coated articles are transferred to a second chill roll placed at a side or on a top of the first chill roll. A second machine produces and applies the second polymer film on the partially coated articles in the second chill roll so that the articles are encapsulated by the first and second polymer films. A collector mechanism receives the encapsulated articles from the second chill roll.
US11591273B2
An agricultural spray may be produced by admixing citric acid and glutamic acid with a metal salt and a pesticide or other agricultural chemical containing components capable of precipitating with the metal salt in the admixture. The citric acid and the glutamic acid chelate with the metal salt to provide a stability and compatibility-enhancing composition, thereby preventing the metal salt from forming an insoluble solid within the admixture. Such a composition may be produced by admixing citric acid and glutamic acid at a molar ratio of about 6.8:0.5 to about 1:0.29. The composition may include a metal sat, citric acid and glutamic acid in a molar ratio of about 1:6.8:0.5 to about 1:1:0.29 and a pesticide.
US11591270B2
A method for forming ceramic matrix composite (CMC) component includes forming a fiber preform, positioning the fiber preform into a chemical vapor infiltration reactor chamber, and densifying the fiber preform. Densification includes infiltrating the fiber preform with a first gas comprising precursors of silicon carbide and infiltrating the fiber preform with a second gas comprising a first rare earth element, wherein the steps of infiltrating the fiber preform with the first gas and infiltrating the fiber preform with the second gas are conducted simultaneously to produce a first rare earth-doped silicon carbide matrix in a first region of the component.
US11591264B2
Described are a composition comprising furfuryl silicates and furfuryl alcohol, especially for use as acid-curable binder, and processes for producing such a composition.
US11591260B2
A large-size synthetic quartz glass substrate has a diagonal length of at least 1,000 mm. Provided that an effective range is defined on the substrate surface, and the effective range is partitioned into a plurality of evaluation regions such that the evaluation regions partly overlap each other, a flatness in each evaluation region is up to 3 μm. From the quartz glass substrate having a high flatness and a minimal local gradient within the substrate surface, a large-size photomask is prepared.
US11591253B2
A glass composition is provided. The glass composition includes: 25-40 wt % SiO2; 2.5-10 wt % B2O3; 0-10 wt % Al2O3; 0-15 wt % Li2O; 0-16 wt % of Li2O, Na2O, and K2O in total; 10-25 wt % CaO; 0-15 wt % BaO; 0-5 wt % MgO; 0-5 wt % SrO; 10-30 wt % CaO, BaO, MgO, and SrO in total; 0-7 wt % ZnO; 2-10 wt % ZrO; 2-15 wt % TiO2; 5-25 wt % Nb2O5; 0-5 wt % Ta2O5; 5-25 La2O3; and 0-5 wt % Y2O3. The glass composition has a refractive index from about 1.74 to about 1.80, a density from about 3.5 g/cm3 to about 4.0 g/cm3, a critical cooling rate from about 1° C./min to about 50° C./min, and a liquidus viscosity greater than 25 Poises.
US11591250B2
A furnace for relieving glass products of stress is provided. The furnace has a furnace interior and a thermal element that measures temperatures in the furnace interior. The thermal element is enclosed by an enveloping tube composed of an inorganic material.
US11591233B2
The invention relates to a process and its relating plant for thermal conversion of aluminum chloride hydrate into aluminum oxide and gaseous hydrogen chloride. In a first step, aluminum chloride hydrate is fed into a decomposition reactor where it is heated to a temperature between 120 and 400° C. Afterwards, the partially decomposed aluminum chloride hydrate is finally calcined to aluminum oxide at a temperature between 850 and 1200° C. in a second reactor. The aluminum chloride hydrate is admixed with aluminum oxide in an intensive mixer with a mass ratio between 1:1 and 10:1 aluminum chloride hydrate to aluminum oxide for using a fluidized bed reactor as a decomposition reactor.
US11591228B2
A compound strontium fluoroborate, nonlinear optical crystal of strontium fluoroborate, preparation method thereof; the chemical formula of the compound is SrB5O7F3, its molecular weight is 310.67, and it is prepared by solid-state reaction; the chemical formula of the crystal is SrB5O7F3, its molecular weight is 310.67, the crystal is of the orthorhombic series, the space group is Ccm21, and the crystal cell parameters are=10.016(6) Å, b=8.654(6)(4) Å, c=8.103(5) Å, Z=4, and V=702.4(8) Å3. A SrB5O7F3 nonlinear optical crystal has uses in the preparation of a harmonic light output when doubling, tripling, quadrupling, quintupling, or sextupling the frequency of a 1064-nm fundamental-frequency light outputted by a Nd:YAG laser, or the generation of a deep-ultraviolet frequency doubling light output lower than 200 nm, or in the preparation of a frequency multiplier, upper or lower frequency converter, or an optical parametric oscillator.
US11591224B2
Disclosed are apparatus and method for preparing carbon black, in which the carbon black may be continuously formed and activated. In one embodiment, carbon black powders formed in a combustion reactor are converted into a slurry which in turn is refluxed to the combustion reactor in a repeated manner, thereby to allow successive activation treatments. In this way, a sufficient residence time for the activation of the carbon black may be secured.
US11591214B2
A process for producing synthesis gas, the process including the steps of: a) in a reforming reactor, reacting a hydrocarbon feed stream together with an oxidant gas stream, thereby producing a first synthesis gas stream; b) providing a heated CO2 rich gas stream to an adiabatic post converter including a second catalyst active for catalyzing steam methane reforming, methanation and reverse water gas shift reactions; and c) in the adiabatic reforming post converter, letting at least a part of the first synthesis gas stream and the heated CO2 rich gas stream undergo steam methane reforming, methanation and reverse water gas shift reactions to thereby provide a product gas stream, the product gas stream being a synthesis gas stream. Also, a system for producing synthesis gas.
US11591212B2
Systems and methods for molten media pyrolysis for the conversion of methane into hydrogen and carbon-containing particles are disclosed. The systems and methods include the introduction of seed particles into the molten media to facilitate the growth of larger, more manageable carbon-containing particles. Additionally or alternatively, the systems and methods can include increasing the residence time of carbon-containing particles within the molten media to facilitate the growth of larger carbon-containing particles.
US11591211B2
A method of manufacturing a semiconductive structure includes receiving a first substrate; disposing an interconnection layer on the first substrate; forming a plurality of conductors over the interconnection layer; filing gaps between the plurality of conductors with a film; forming a barrier layer over the film; removing the barrier layer; and partially removing the film to expose a portion of the interconnection and leave a portion of the interconnection layer covered by the film.
US11591204B2
Systems and methods of the invention relate to cleaning a portion of a beverage line of a beverage distribution system based upon a signal received from a remote source. An administrative (also referred to as “admin”) system can manage a cleaning system from a remote location in which a remote signal can drive a cleaning system and at least one or more electric valves within the beverage distribution system. A controller component (local to the beverage distribution system) can receive the remote signal from the admin system, wherein a cleaning system (e.g., via a cleaning line) or a dispensing system (e.g., via a hose) can be selected to enable a cleaning mode or a dispensing mode.
US11591194B2
The system can include: a container 110, a set of sensors 120, and a controller 130. The system can optionally include a robot 140. However, the system 100 can additionally or alternatively include any other suitable set of components. The system functions to monitor and/or maintain a fullness level of a container. The system can additionally or alternatively function to enable robotic picking out of the container (e.g., in a pick-and-place setting). The system can additionally function to maintain candidate objects within reach of the robot's end effector to increase robot uptime while minimizing the extent of the robot's required motion (e.g., in the z-axis).
US11591192B2
According to an aspect of some embodiments of the present invention there is provided a piston mounted on and fixedly fastened to a ball screw nut, the nut threaded onto a ball screw. By mechanically rotating the piston and preventing the ball screw from rotating, the balls screw nut rotates, thereby raising or lowering the ball screw, thereby raising or lowering the piston, thereby raising or lowering a casing, for example a bollard, mounted on the piston. The casing may be raised or lowered by attaching a handle to the piston and rotating the handle.
US11591184B2
An elevator assembly (1) comprises an elevator car (2), a counterweight (4), and a safety device (8) located on a roof (9) of the elevator car (2). A locking handle (10) is positioned within the elevator shaft (6), and connected to a first end (12a) of a tension member (12). A blocking stop (14) is connected to a second end (12b) of the tension member (12). The blocking stop (14) is moveable between an inactive state, in which the tension member (12) holds the blocking stop (14) in a position in which it does not limit downwards movement of the counterweight (4), and an active state, in which tension in the tension member (12) is reduced to allow the blocking stop (14) to move to a position in which it limits downwards movement of the counterweight (4).
US11591176B2
A convertible printed product collecting assembly (10) includes a collecting fabric (11) rolled on a rotatable fabric bearing rod. Supporting legs (13) have a lower end tiltably connected to a printer (18) and are tillable in the collecting fabric's longitudinal direction. A tensioning and locking mechanism (15, 16) is arranged to release or to lock the fabric bearing rod to rotate. Stabilizing brackets (14) secure the supporting legs (13) in at least one tilting angle. The tensioning and locking mechanism (15, 16) is operable to tension and to hold the collecting fabric (11) in a flat, tensioned shape when in the locking state so as to provide a receiving desk for the printed product. Further, the collecting fabric (11) forms a collecting bag when unreeled from the fabric bearing rod.
US11591160B2
A container-handling vehicle for picking up storage containers from a three-dimensional grid of an underlying storage system includes a first set of wheels arranged at opposite sides of a vehicle body, for moving the vehicle along a first direction on the grid; a second set of wheels arranged at opposite sides of the vehicle body, for moving the vehicle along a second direction on the grid, the second direction being perpendicular to the first direction; and the first set of wheels displaceable in a vertical direction between a first position, wherein the first set of wheels allow movement of the vehicle along the first direction, and a second position, wherein the second set of wheels allow movement of the vehicle along the second direction. The vehicle body surrounds a cavity within which at least a first lifting device and a second lifting device are positioned adjacent to each other, each lifting device is arranged to lift a storage container from the grid and into the cavity, such that a bottom of the storage container is at a level above the lowest level of the second set of wheels.
US11591144B2
A closure capsule for closing a container, comprising: —a cap (2) that can be associated with a container and comprising a frangible mouth (20); —a cutter (3) comprising a cutting edge (30) designed to open said frangible mouth (20) which assumes a first configuration in which it is intact and a second configuration in which it is open; —a covering (4) of the cap (2) and the cutter (3); in the first configuration at least the cap (2) and the cutter (3) define a tank (8) for containing a product destined to be dropped into the container in said second configuration; —transmission means (5) for transmitting a rotary component from the covering (4) to the cutter (3); —moisture absorbing means (10) which surmount at least one portion of said cutter (3).
US11591142B2
The container with a lid attached to a threaded closure mechanism includes a receptacle having a mouth surrounded by a thread, a lid, a sealing ring and a closure mechanism formed by a disc with a hollow interior and a perimetral tubular skirt provided with an engagement configuration complementary to the thread of the receptacle. The closure mechanism surrounds the lid and holds it against the mouth of the receptacle by means of a threaded attachment between the engagement configuration of the closure mechanism and the thread of the receptacle, assuring proper hermetic closure of the lid with the receptacle in cooperation with the sealing ring and a retainer element connected to the closure mechanism to constrict an insertion passage thereof thereby retaining the lid into the closure mechanism.
US11591135B1
A canister including a lid and storage canister. The lid incorporates a gasket that is overmolded onto the lid during its manufacture. The gasket is exposed on both the upper and lower surfaces of the lid in order to provide a non-slip surface at the top portion of the lid and a sealing surface at the bottom of the lid for sealing a storage canister.
US11591128B2
A fin sealer and method to seal a radially outwardly directed fin of a tubular web structure by directing the fin through a nip between a first and a second fin sealing rollers while communicating heat to the fin through at least one of the fin sealing rollers is provided. The fin sealer is configured to maintain a nominal face-to-face relation between an outer annulus of the first fin sealing roller and an outer annulus of the second fin sealing roller with a flexible connection between a hub element of the second fin sealing roller with the outer annulus of the second fin sealing roller.
US11591126B2
A method for joining at least two plastic parts (1, 5) along a predeterminable common joining point using infrared radiation (IR), is characterized in that each of the plastic parts (1, 5) to be joined is heated using infrared radiation at least along the joint by radiation sources without touching the respective plastic parts (1, 5). One radiation source is operated independently and spatially separated from the other radiation source. The radiation sources emit their respective infrared radiation to the respective plastic parts (1, 5) without contact and following the contour of the joint. The degree of heating by the respective infrared radiation is selected such that the joint is formed when the plastic parts (1, 5) are brought together.
US11591125B2
A foldable container and method of storing adhesive in which a single strip of adhesive material is attached to a single release liner featured on a side surface or a flap of the foldable container. The strips of adhesive material can be peeled off a surface of the container and applied to and used to seal the top and bottom surfaces of the container as needed. The container features one or more release liner(s) each with a single strip of adhesive material attached only to the release liner and not a surface of the container itself.
US11591122B2
The invention relates to a consumable-material handling device for transporting and/or handling at least one consumable material (12a; 12b), in particular packaging material, comprising at least one at least partially autonomous handling unit (14a; 14b), which is at least provided for handling the consumable material (12a; 12b). According to the invention, the machine tool comprises at least one, in particular at least partially autonomous, mobility unit (16a; 16b), on which the handling unit (14a; 14b) is arranged and which is at least provided for enabling locomotion, in particular at least partially autonomous locomotion, of the handling unit (14a; 14b).
US11591121B2
A machine for packaging multiple containers wherein a flexible carrier stock is fed across a jaw drum. A plurality of containers are moved through the machine whereby the carrier is subsequently positioned over the plurality of containers so that flexible carrier stock engages with two or more of the containers to form a package. The jaw drum and other operative components of the machine are preferably vertically adjustable to accommodate a range of container sizes and carrier configurations.
US11591114B2
An aircraft loader comprises a chassis, a cab, a loading floor and a load lifting apparatus. The load lifting apparatus includes a frame, a first horizontal platform and a second horizontal platform. The frame includes a pair of vertical columns. Each column has a front slider and a rear slider configured to be displaced vertically along the columns. The first platform is displaceable through movement of the rear sliders between a loading floor height and an aircraft loading height. The second platform is displaceable through movement of the front sliders and the first platform between an intermediate height and the aircraft loading height. When the first platform is raised from the loading floor height and reaches the intermediate height, the first and second platforms engage to so as to travel in unison, thus defining a loading deck which is displaceable between the intermediate height and the aircraft loading height.
US11591109B2
Provided is an abnormality detection device for a rotary wing unit. The rotary wing unit includes a plurality of rotary wings that is coaxially disposed. The abnormality detection device includes a controller configured to acquire at least one of a correlation at the time of normal operation between operation parameters related to the rotary wings and a correlation at the time of abnormal operation between the operation parameters and detect abnormality of the rotary wing unit, based on a correlation at the time of actual operation between the operation parameters and at least one of the correlation at the time of normal operation and the correlation at the time of abnormal operation.
US11591108B2
An in-flight safety enhancing system including: a combined automatic dependent surveillance broadcast (ADS-B) and carbon monoxide (CO) detecting device configured to receive an ADS-B transmission and obtain a CO reading; and a flight application executing on an aircraft crew computing device separate from the combined ADS-B and CO detecting device, and configured to: receive the ADS-B transmission and the CO reading; augment the flight application with information extracted from the ADS-B transmission; and provide a CO status notification when the CO reading exceeds a CO threshold value.
US11591104B2
A referencing system to assist a receiver aircraft in relative positioning during in-flight refueling operation that includes an array of references congregated on a spot of the tanker aircraft, wherein the array of references provide a distinguishable visual indicator depending on the sector where the receiver aircraft positions.
US11591103B2
Tunable multi-layer thermoplastic polymer sealants and tunable two-layer conductive thermoplastic polymer sealants, and substrates and assemblies comprising the tunable multi-layer sealants; and edge seals and fillet seals produced comprising such sealants; and substrates, components and objects comprising the tunable edge seals and fillet seals, and methods for making and applying such edge seals and fillet seals are disclosed.
US11591100B2
A robot including a hybrid fan-based and fluid-based propulsion system to provide thrust, such as deceleration during fall to create a smooth landing or to provide a quick reduction in velocity, and to provide actuation/controlled motion, such as to hover after quick deceleration and to control orientation or pose. The hybrid propulsion system uses discharging of pressurized fluid and exhausted gas (or fluid in some cases) from ducted fans (or propellers, impellers, and the like) to provide controlled thrust and/or lift forces. The hybrid propulsion system uses of pressurized fluid for generating larger or primary thrust and quick changes in velocity. The hybrid propulsion system includes a fan-based propulsion assembly with ducted fans that use environmental air (or fluids) to provide lower or secondary thrust. Both types of propulsion can be integrated into a robot or robotic figure to move the robot during flight (e.g., during falling or hovering).
US11591092B2
In some examples, a cabin pressure control and monitoring system includes an outflow valve, a first motor configured to operate the outflow valve to release fluid from a cabin, and a second motor configured to operate the outflow valve to release fluid from the cabin. The cabin pressure control and monitoring system also includes a first microcontroller configured to automatically control the first motor based on a pressure of the fluid in the cabin. The cabin pressure control and monitoring system further includes a second microcontroller configured to control the second motor based on user input and monitor the pressure of the fluid in the cabin. In some examples, a type of the first microcontroller is different than a type of the second microcontroller.
US11591089B2
An aircraft cabin includes an upper deck, and a cargo area. The cargo area is configured to accommodate at least one passenger and is situated at a different level than the upper deck. An accessway provides access between the upper deck and the cargo area. The upper deck has, at least locally, a raised floor in the vicinity of the accessway so that at least one part of the cargo area has a ceiling height higher than the ceiling height of the rest of the area cargo.
US11591071B2
According to a first aspect of the invention, there is provided a method for operating a multicopter experiencing a failure during flight, the multicopter comprising a body, and at least four effectors attached to the body, each operable to produce both a torque and a thrust force which can cause the multicopter to fly when not experiencing said failure. The method may comprise the step of identifying a failure wherein the failure affects the torque and/or thrust force produced by an effector, and in response to identifying a failure carrying out the following steps, (1) computing an estimate of the orientation of a primary axis of said body with respect to a predefined reference frame, wherein said primary axis is an axis about which said multicopter rotates when flying, (2) computing an estimate of the angular velocity of said multicopter, (3) controlling one or more of said at least four effectors based on said estimate of the orientation of the primary axis of said body with respect to said predefined reference frame and said estimate of the angular velocity of the multicopter. The step of controlling one or more of said at least four effectors may be performed such that (a) said one or more effectors collectively produce a torque along said primary axis and a torque perpendicular to said primary axis, wherein (i) the torque along said primary axis causes said multicopter to rotate about said primary axis, and (ii) the torque perpendicular to said primary axis causes said multicopter to move such that the orientation of said primary axis converges to a target orientation with respect to said predefined reference frame, and (b) such that said one or more effectors individually produce a thrust force along said primary axis.
US11591067B2
A flap support mechanism includes a track rotatably connected to an aft fitting of a wing. A forward roller and an aft roller extend laterally from a flap structure, the forward roller and aft roller constrained in a slot in the track. The slot has a profile configured to induce both translation and rotation in the flap, in concert with rotation of the track about the aft fitting, thereby passively mirroring motion of the flap induced by an actuator driven primary main flap support.
US11591065B2
A noise attenuation element can be arranged for connection to an air directing structure such as a wing flap. The element has a non-uniform lattice density across at least a portion of the body of the element.
US11591064B2
A modular quadcopter is provided for vertical flight. The quadcopter includes a housing, a quadrilateral set of extensions, and a quadrilateral set of arms. The housing contains flight control and sensor equipment, and has a relative vertical orientation. The housing is configurable for either stowage or deployment. The extensions are disposed on each corner of the housing. Each extension has a hinge that pitches outward and upward. Each arm is disposed on the hinge and contains an electric motor and a speed controller. The configurable below the housing for the stowage and extends radially from respective the extension in relation to the orientation for the deployment.
US11591056B2
A marine vessel capable of improving propulsion efficiency for the entire operation of the marine vessel. In the marine vessel, which includes a hull and a propeller provided on a stern side of the hull, n2D/√(Bd) is 4 or more and 35 or less, in a case where n is the number of the propeller, D is a diameter of the propeller, B is a water line breadth of the hull, and d is a draft of the hull.
US11591054B1
A floatation attachment system may include a floatation attachment device configured to be attached to an object. The floatation attachment device may include a floatation material configured to provide buoyancy to the object it attaches and an attachment surface configured to directly attach the object. The floatation material may include a material that expands or generates gas upon contact with water. The system may include a dispenser such as a sheet of pre-cut floatation attachment devices or for manual cutting for customized shapes and sizes. In one instance, the system includes a tape roll dispenser for dispensing floatation attachment devices from a roll.
US11591041B2
A motorized self-balancing vehicle is provided. The vehicle may include at least two wheels. The vehicle may include a self-balancing mechanism. The vehicle may include a manual-drive mechanism. The self-balancing mechanism may constantly update the self-balancing vehicle in order to maintain the balance of a rider of the vehicle, while the rider is engaged in human motion on the manual-drive mechanism. The human motion may include pedaling and/or stepping. The vehicle may include an electric motor. The vehicle may include only an electric motor. The vehicle may include only a manual-drive mechanism. The vehicle may include both the manual-drive mechanism and the electric motor. In the embodiment including the manual-drive mechanism and the electric motor, the power generated by the electronic motor may be combined with power generated by the manual-drive mechanism in order to move the vehicle.
US11591033B2
An apparatus including a focused light beam receptor apparatus configured to be positioned proximate a first end of a vehicle, a focused light beam generator; and wherein the focused light beam receptor apparatus includes a focused light beam receiving surface for receiving a focused light beam from the focused light beam generator to provide alignment of the focused light beam receptor relative to a centerline of the vehicle. A method of aligning a focused light beam receptor, focused light beam generator and a movable alignment stand relative to a centerline of a vehicle is also provided.
US11591030B2
An endgate assembly includes a body and a quick-release receptacle. The body includes a first side and a second side opposing each other. The first side of the body defines a compartment accessible from the first side and spaced from the second side. The quick-release receptacle includes a platform. The quick-release receptacle is movable between a stowed position in which the quick-release receptacle is attached to the body within the compartment such that the platform and the first side cooperate to close the compartment, and a detached position in which the quick-release receptacle is released from the body to remove the quick-release receptacle from the compartment. A vehicle includes a cargo area and the endgate assembly as discussed above. The cargo area includes a floor, a first sidewall disposed transverse to the floor, and a second sidewall disposed transverse to the floor. The endgate assembly is coupled to the floor.
US11591028B2
A front end module assembly has a front end module structure of a vehicle, a heat exchanger support and a first heat exchanger unit. The heat exchanger support is supported to the vehicle front end module structure. The heat exchanger support has an opening. The first heat exchanger unit is accommodated in the opening of the heat exchanger support so that the transmission cooler is supported to the vehicle front end module structure via the heat exchanger support.
US11591022B2
A parking assistance device includes an imager that captures an image of a surrounding of a vehicle, and a display that displays a guidance image for guiding the vehicle from a parking start position to a target parking position and displays a moving area in which the vehicle can move during a parking operation. An area and dimension of the moving area displayed on the display changes based on a change in a steering angle of the vehicle.
US11591019B2
In response to a request for a three-point turn, a forward turning path from a current location and heading direction of the ADV is generated. In generating the forward turning path, a forward curvature is determined based on the maximum forward turning angle of the ADV by applying a full steering command. The forward turning path is determined based on the forward curvature from the current location of the ADV. A forward speed profile is calculated for the forward turning path based on perception information that perceives a driving environment surrounding the vehicle at the point in time. In addition, a backward turning path is generated from an end point of the forward turning path based on a maximum backward turning angle associated with the ADV. The three-point turn path is then generated based on the forward turning path and the backward turning path to drive the vehicle to make the three-point turn.
US11591004B2
A bracket includes a first plate that faces a steering column, a second plate that faces a column cover covering the steering column, and a third plate that connects the first plate and the second plate, and a fourth plate that intersects with the first plate and the third plate.
US11590994B2
A foldable beach wagon with steerable front wheels is disclosed. The wagon has a frame having a first end assembly, an opposing second end assembly and a floor assembly connected between the first end assembly and the second end assembly. A steering link is pivotally connected to the wagon frame adjacent the first end assembly, and a handle is pivotally connected to the steering link. When the steering link is pivoted by the handle a tie rod moves laterally to pivot the front wheels for turning the wagon. A hanger assembly is connected to the wagon frame adjacent the second end assembly. The hangar assembly is adapted to receive one or more chairs. Fenders are provided over the rear wheels to block engagement of the chairs with the rear wheels of the wagon.
US11590992B2
A deployable measurement system for analyzing a rail of a railroad track includes a housing, a reflecting assembly coupled to the housing, a movement assembly coupled to the housing, and an optical measurement system disposed within the housing. Both the housing and the reflecting assembly are moveable between a stored position and a deployed position. The movement assembly includes a deployment assembly that moves the reflecting assembly from the stored position to the deployed position, and a retraction assembly that moves the reflecting assembly from the deployed position to the stored position. The optical measurement system emits and receives light. The reflecting assembly reflects the emitted light toward the rail. The reflecting assembly reflects light reflected off of the rail toward the optical measurement system. The light received by the optical measurement system is used to measure parameters related to the rail.
US11590990B2
A station for a cable transportation system comprising a plurality of transporting units supported and driven outside the station by at least one cable, the station comprising an inlet and an outlet for the transporting units; a guiding device for guiding the transporting units uncoupled from the cable inside the station; an advancing auxiliary device for moving the transporting units along the guiding device; a control unit configured for controlling the advancing auxiliary device so that the advancing auxiliary device can switch, with no service interruption, from a first configuration, wherein the transporting units are individually arranged equidistant from each other and the boarding and landing occur inside the station without stopping the advancing movement, to a second configuration, wherein the transporting units are arranged in equidistant compact groups of at least two units and the boarding and landing occur inside the station by temporarily stopping the transporting units, and vice versa.
US11590989B2
According to an aspect of an embodiment, operations may comprise receiving a plurality of frame sets generated while navigating a local environment, receiving an occupancy map (OMap) representation of the local environment, for each of the plurality of frame sets, generating, using the OMap representation, one or more instances each comprising a spatial cluster of neighborhood 3D points generated from a 3D sensor scan of the local environment, and classifying each of the instances as dynamic or static, tracking instances classified as dynamic across the plurality of frame sets using a tracking algorithm, assigning a single instance ID to tracked instances classified as dynamic across the plurality of frame sets, estimating a bounding box for each of the instances in each of the plurality of frame sets, and employing the instances as ground truth data in a training of one or more deep learning classifiers.
US11590979B2
A vehicle control device that controls traveling of a vehicle, the vehicle control device comprises: an acquisition unit configured to acquire information of a periphery of the vehicle; and a control unit configured to, based on the information that the acquisition unit acquired, determine whether or not another vehicle, which travels in one of a plurality of traffic lanes of a merging path that merges into a traffic lane that the vehicle is traveling in, will merge into the traffic lane, and based on the determination, control travel of the vehicle.
US11590977B2
Systems and methods are provided herein for operating a vehicle in a K-turn mode. The K-turn mode is engaged in response to determining that an amount that at least one of the front wheels of the vehicle is turned exceeds a turn threshold. While operating in the K-turn mode, forward torque is provided to the front wheels of the vehicle. Further, backward torque is provided to the rear wheels of the vehicle. Yet further, the rear wheels of the vehicle remain substantially in static contact with a ground while the front wheels slip in relation to the ground.
US11590973B2
A driver assistance system for motor vehicles, including a locating system for locating preceding vehicles and a longitudinal guidance module for controlling the longitudinal movement of the host vehicle as a function of location data of located objects. The longitudinal guidance module includes a driving path module, for defining a driving path ahead of the host vehicle, and an adaptive cruise control function, which adjusts a time gap between the host vehicle and a target object located within the driving path to a setpoint value. The longitudinal guidance module includes a dynamic function which, under certain conditions indicating that the target object will leave the driving path, modifies the longitudinal guidance function within the context of a more rapidly commencing acceleration in response to a command of the driver.
US11590970B2
According to one embodiment, a deadlock detection device includes a combining calculator and a deadlock determiner. The combining calculator performs selecting a mobile vehicle or combined mobile vehicles from among mobile vehicles, based on a traveling path configuration graph and first state information, going forward the selected mobile vehicle to go forward on traveling path configuration graph and combining the selected mobile vehicle to another mobile vehicle or another combined mobile vehicles at a back of the other mobile vehicle or the other combined mobile vehicles, iterating a process of the selecting, the going and combining. The deadlock determiner determines that a deadlock occurs if not all the mobile vehicles have been combined by the combining calculator, and determines that no deadlock occurs if all the mobile vehicles have been combined.
US11590969B1
Techniques and methods for training and/or using a machine learned model that identifies unsafe events. For instance, computing device(s) may receive input data, such as vehicle data generated by one or more vehicles and/or simulation data representing a simulated environment. The computing device(s) may then analyze features represented by the input data using one or more criteria in order to identify potential unsafe events represented by the input data. Additionally, the computing device(s) may receive ground truth data classifying the identified events as unsafe events or safe events. The computing device(s) may then train the machine learned model using at least the input data representing the unsafe events and the classifications. Next, when the computing device(s) and/or vehicles receive input data, the computing device(s) and/or vehicles may use the machine learned model to determine if the input data represents unsafe events.
US11590952B2
A method for controlling an ESC integrated braking system including: checking, by a control unit, whether a brake is in an on state or a standby state as the braking system is activated; checking, by the control unit, whether a current temperature value is in a low temperature state lower than specified reference temperature; and controlling, by the control unit, a current duty for driving a hydraulic control valve and a current component of a motor for driving a master cylinder according to the state of the brake and whether the current temperature value is in the low temperature state.
US11590941B2
The present disclosure relates to an apparatus for assisting driving of a host vehicle including: a camera mounted to the host vehicle and having a field of view outside of the host vehicle, the camera configured to obtain front image data; and a controller configured to process the front image data, obtain collision time with a surrounding vehicle and weather information based on the image data, and control a braking device provided in the vehicle to start braking at a first braking time point based on the collision time and weather information.
US11590935B2
A wiper device includes a wiper arm and a drive section. The wiper arm has a base end portion supported by a support section provided at a vehicle, and is configured such that a wiping surface of the vehicle is wiped back and forth by a wiper blade coupled to a leading end portion of the wiper arm. The drive section is configured to displace at least a leading end portion side of the wiper arm in an up-and-down direction with respect to the wiping surface during back and forth movement of the wiper arm, irrespective of force the wiper blade receives from the wiping surface.
US11590927B2
Provided are an apparatus for protecting a pedestrian and a control method thereof. The apparatus for protecting a pedestrian includes a front object detection unit configured to detect an object in front of a vehicle; a collision detection unit configured to detect a collision of a vehicle; a protection module driving unit configured to drive a protection module for protecting a pedestrian when the pedestrian collides with the vehicle; and a control unit configured to determine the front object as a hood lift target on the basis of a detection result of the front object detection unit, to determine the collision as a hood lift target collision on the basis of a detection result of the collision detection unit, and to operate the protection module driving unit in case of the hood lift target collision of the hood lift target.
US11590926B2
A drive arrangement for adjusting a front hood of a motor vehicle including a first drivetrain for producing a first drive movement between a flap-side drive connection and a body-side drive connection and when the first drivetrain is in a normal state the first drive movement opens the flap from a closed position to an open position. A second drivetrain for producing a second drive movement between a flap-side drive connection and a body-side drive connection to open the flap from the closed position to a collision position so that by means of the second drive movement of the second drive the first drivetrain changes from a normal state to a bypass state, in which a first strand component of the first drivetrain moves relative to a second strand component of the first drivetrain.
US11590919B1
An airbag module for helping to protect an occupant of a vehicle includes a curtain airbag and a mounting bracket. The curtain airbag includes a mounting tab configured to receive a fastener for connecting the curtain airbag to the vehicle. The mounting bracket is configured to cooperate with the mounting tab to facilitate the connection of the curtain airbag to the vehicle via the fastener. The mounting bracket includes a generally planar body portion and a fastening structure that extends transversely from the body portion. The mounting tab includes overlying layers of material that help define a pocket configured to receive the mounting bracket. The mounting tab includes a first fastener opening configured to receive the fastening structure so that the fastening structure extends through the first fastener opening with the body portion positioned in the pocket. The fastening structure is configured for installation in the vehicle structure to initially support the airbag module in the vehicle. The airbag module further includes a fastener configured to extend through the mounting tab and the mounting bracket to connect the airbag module to the vehicle.
US11590916B2
The disclosure is directed to a steering device assembly for positioning and fastening an airbag module on a steering device of a motor vehicle. The steering device assembly comprises a first positioning body having a detent lever, a carrier, a spring element, and a second positioning body. The detent lever comprises a first leg and a second leg connected to the first leg at one leg end the detent lever is mounted for pivoting between an initial position and a final assembly position on the carrier. The spring element loads the detent lever into the final assembly position. Each leg extends to an opposite free leg end at a specified angle. The second positioning body has a stop for the free leg end of the first leg for pivoting the detent lever from the initial position into the final assembly position and a detent contour for locking with the free leg end of the second leg in the final assembly position of the detent lever. A method for installing an airbag module on a steering device of a motor vehicle by the steering device assembly.
US11590913B2
A vehicle includes a rail-mounted component and a restraint monitoring system. The rail-mounted component can include one or more restraints. The restraint monitoring system includes a restraint control module, an encoder-decoder module, and a rail-mounted component control module. The rail-mounted component control module can include a restraint deployment loop and a restraint diagnostic loop. The restraint deployment loop can include a deployment signal amplifier. The restraint diagnostic loop can include a diagnostic signal amplifier. In examples that include both the deployment signal amplifier and the diagnostic signal amplifier, the deployment signal amplifier and the diagnostic signal amplifier may be wired in parallel.
US11590900B2
A ladder rack for supporting a ladder on a vehicle. The ladder rack comprises a supporting arrangement anchored only along a single edge area of a rooftop, the supporting arrangement comprising a first load-bearing member entirely extending over the rooftop within an edge of the rooftop and a second load-bearing member extending substantially parallel to the first load-bearing member with a lateral offset, outside the rooftop and away from the edge of the rooftop. A ladder-supporting arrangement holds the ladder and connects to the first load-bearing member and to the first load-bearing member for supporting a weight of the ladder. The remainder of the rooftop surface is exempt of any member and is free for other purposes. The ladder is held on a side of the vehicle with an offset to be able to open a sliding door on the same side of the vehicle as the ladder rack.
US11590898B2
A smart license plate vault securely holds small objects, such as a vehicle key, while resembling a license plate mounting platform. The smart license plate vault may be operated by authorized third parties via a keypad located on the smart license plate vault to accept access codes and other information. The smart license plate vault may include a storage compartment with a removable cover for providing access to the storage compartment and an electronic locking mechanism for locking and unlocking the vault, a vault cover plate sensor for detecting when the vault cover plate has been placed into a closed position, a storage compartment sensor for recording information regarding an interior of the storage compartment when the vault cover plate sensor detects that the vault cover plate has been placed into the closed position, and a transmitter for wirelessly transmitting the recorded information to a remote location.
US11590890B2
The present teaching relates to method, system, and medium, for generating an augmented alert in a hybrid vehicle. First information indicating an upcoming switch in an operating mode of the vehicle is received, which specifies a set of tasks, arranged in an order, to be completed by a driver in the vehicle to achieve the upcoming switch, and a task duration for each of the set of tasks by which the task is to be completed. A current state of the driver is obtained and used to determine a set of warnings to alert the driver to perform the set of tasks. Each warning corresponds to a task in the set of tasks and is created based on the current state of the driver. A warning schedule is generated based on the set of warnings in the order of the set of tasks and transmitted so that warnings in the warning schedule are delivered to the driver.
US11590883B2
Various examples are provided related to boat loaders for trailers. In one example, a boat loader includes a primary tube extending between a first end and a second end and a light tube that can move within the primary tube. The light tube can include light elements extending along a portion of the light tube at a first end and a float attached to the light tube at a second end. The primary tube can be coupled to a trailer at the second end and the first end of the light tube can extend outward from the first end of the primary tube exposing the light elements as the primary tube is submerged in water and can retract into the primary tube as the primary tube is removed from the water.
US11590880B1
Particular embodiments may provide for a method of providing illumination for a vehicle. A signal to activate a headlamp assembly for a vehicle may be sent. The headlamp assembly may comprise a laser-based lamp positioned to provide high-beam illumination, including a plurality of beam subfields, and a light sensor configured to capture images of illuminated objects, wherein the light sensor is capable of sensing objects illuminated by visible-spectrum light. A focal region for the high-beam illumination may be determined based on images captured by the light sensor. Instructions to configure the laser-based lamp to modify a distribution of the high-beam illumination to increase brightness of one or more beam subfields of the high-beam illumination within the focal region may be sent.
US11590878B1
An apparatus, system, and method of using the apparatus and system may generally include a strap or retention device. A first end of a fastener is operatively coupled to the strap that is configured to retain a cargo contactingly adjacent a cargo support surface. A second end of the fastener is operatively coupled to the first end. The second end has a double rod formation. A magnet may be supported in a housing in the second end. The magnet may be held in position within a recess feature of the housing. A support structure 212 may be disposed between the double rod formation to provide additional strength and stability. The support structure may be made of metal, polymer, or other suitable material. The magnet that is configured to support the second end adjacent a side of the cargo support surface, wherein the side does not produce its own magnetic field.
US11590873B2
A seat assembly may include a seat, a first bladder assembly connected to the seat, a second bladder assembly connected to the seat, and/or an electrical control unit (ECU) configured to independently control the first bladder assembly and the second bladder assembly. The ECU may be configured to maintain a level of inflation of the first bladder assembly to provide a hugging effect to a user of the seat while inflating and deflating the second bladder assembly to guide breathing of said user.
US11590871B2
According to the disclosure, a seat pad 2 includes a bag-contained pad part 250 including a foam body 240 and a bag body 230 arranged inside the foam body 240.
US11590869B2
Various implementations include seats and related loudspeakers. In particular cases, a seat includes: a seat headrest portion; a seat backrest portion; and a loudspeaker assembly. The loudspeaker assembly includes at least one driver for generating an acoustic output; and an acoustic exit fixed in the seat backrest portion and angled to provide the acoustic output to a location below a nominal ear position of an occupant of the seat, wherein a firing angle of the at least one driver provides the acoustic output to achieve a consistent frequency response across a range of positions deviating from the nominal ear position.
US11590864B2
A motor vehicle seat locking device, in particular a rear seat backrest locking device, equipped with a retaining bracket that is connected to a vehicle body and can move relative thereto, and with a catch, seat-mounted, for the retaining bracket. According to the invention, the retaining bracket is connected to a rocker that can pivot with respect to a vehicle body-mounted base, about an axis that is at a distance from the bracket.
US11590861B2
To make a rotatable vehicle seat be rotatable in a small space, in a vehicle seat (1) including a seat cushion (7) provided on a floor (2) of a vehicle and a seat back (8) provided on the seat cushion, the seat cushion is provided on the floor so as to be rotatable about a selected one of multiple rotation axes (A) extending substantially vertically. Preferably, a rotation device (4) is provided between the floor and the seat cushion, the rotation device being configured to enable rotation about the selected one of the multiple rotation axes while restricting rotation about any of the remaining rotation axes.
US11590857B2
The present application discloses a charging method, an apparatus, a device, a medium, a battery management system and a charging pile. The method includes: acquiring a charging demand parameter set by a user; calculating, according to the charging demand parameter and acquired actual operation state information of a battery, a target charging scheme for charging the battery; transmitting, according to the target charging scheme, a first charging request to a charging device, so that the charging device charges the battery according to the first charging request. According to the charging method, the apparatus, the device, medium, the battery management system and the charging pile provided in the embodiments of the present application, personalized smart charging can be achieved for different users.
US11590855B2
A vehicle battery charging system includes a battery charger for charging a battery module of a vehicle. A first coolant circuit conveys a first cooling fluid therethrough. The first coolant circuit includes a chiller unit separate from the vehicle. The chiller unit and the first cooling fluid exchange heat therebetween. A second coolant circuit conveys a second cooling fluid therethrough. The second coolant circuit includes a battery module. The battery module and the second cooling fluid exchange heat therebetween. A heat exchanger exchanges heat between the first cooling fluid and the second cooling fluid.
US11590850B2
A vehicle power system includes a coil that, in a first operational mode, receives power wirelessly from an external source, a first battery connected to the coil to receive power transferred from the coil while the coil is in the first operational mode, a second battery that receives power from the first battery, and a switch that switches the coil between the first operational mode and a second operational mode in which the coil receives power from the second battery and wirelessly transfers power from the second battery to an electrical load in the vehicle.
US11590849B1
Systems and methods are disclosed for wireless powering and control of conveyors on shuttles. An example system may include a track, and a shuttle configured to move along the track, the shuttle having a conveyor, and a first induction coil. The system may include a second induction coil disposed at a first location along the track, where the second induction coil is configured to interact with the first induction coil to power the conveyor. The shuttle may not have an onboard power source coupled to the conveyor.
US11590844B2
A glass substrate includes a pair of main surfaces including a first main surface and a second main surface opposed to the first main surface; an edge surface arranged along a direction orthogonal to the pair of main surfaces; and a connecting surface arranged between the first main surface and the edge surface. The connecting surface has a plurality of pores. A difference between a 50% particle diameter of the pores in a portion 20 μm distant from the first main surface and a 50% particle diameter in a portion 20 μm distant from the edge surface is 10 μm or less.
US11590838B2
A fuel cap for a vehicle has a locking structure configured to generate a sound interval, including a head portion having a handle formed at a first side and one or more striking portions installed at a second side, and a body portion integrally assembled with the head portion and having a plurality of sound generators installed at the body portion and disposed in a state of being struck by the one or more striking portions installed at the second side of the head portion according to a rotation of the head portion by a locking torque.
US11590835B2
An electric powered vehicle includes a motor for driving one or more wheels. The electric powered vehicle may include a body including a dash panel, a cowl disposed along an upper end of the dash panel and at least partly located forward of the dash panel, an electric unit located forward of the dash panel and supported by the body, and a connector connecting the electric unit and an intermediate portion of the cowl to each other.
US11590834B2
A glass run includes at least one of: an exterior sub-lip formed so as to project obliquely from an interior side of the exterior side wall that is closer to the bottom wall than a base portion of the exterior seal lip; an interior sub-lip formed so as to project obliquely in a direction toward a base portion of the interior seal lip from an exterior side of the interior side wall that is closer to the bottom wall than the base portion of the interior seal lip, the interior sub-lip formed with a thick portion on a base portion on a side of the interior seal lip; a thick portion formed on a base portion of the exterior seal lip; or a thick portion formed on a side of the interior seal lip that is not in contact with the door glass.
US11590832B1
An assembly for a vehicle includes a vehicle body including a sill and a pillar extending upwardly from the sill defining a door opening. A member is rotatably supported by the sill and is rotatable relative to the sill from an undeployed position to a deployed position. A link is rotatably supported by the pillar and the member. A pyrotechnic actuator is supported by the vehicle body and is connected to the member.
US11590830B2
An apparatus and method to increase vehicle sun visor performance. The apparatus may be manufactured to replace or augment existing vehicle sun visors. The visor has an outer housing and internal void having a bed of leaf springs spread laterally along the visor length. Also within the void is a tongue having a stopper. A slit along the driver-facing lower end allows the stopper to be extended and/or retracted from the visor and also traverse laterally along the visor edge to closely target a solar glare during driving without the need to fully extend the whole visor, thereby minimizing obstruction of a driver's vision. The method may be employed after installing the device. A driver experiencing a solar glare may open the improved visor, extend the tongue and move it in the horizontal direction of the solar glare, then retract the tongue and close the visor when the solar glare subsides.
US11590829B2
A glass structure for a vehicle includes an outer layer of glass, an inner layer of glass, and an interlayer stack disposed between opposing surfaces of the outer layer of glass and the inner layer of glass. The interlayer stack includes at least two interlayer substrates and at least one of the interlayer substrates includes a decorative treatment. In another example, the interlayer stack includes at least two interlayer substrates and at least one of the interlayer substrates includes a functional component.
US11590828B2
An air freshener has a carrier with a pair of tabs defining a gap. A center tab extends from the pair of tabs and defines a longitudinal axis. At least one scented body is carried by one of the pair of tabs. The pair of tabs and the at least one scented body extend laterally with respect to the longitudinal axis of the center tab in opposite directions. The pair of tabs and the at least one scented body have a lateral width greater than a longitudinal depth.
US11590822B2
A mechanism is provided for controlling the internal air-quality of a vehicle, including configuring a control policy that controls an internal air-quality of a vehicle and performing an action dictated by the control policy according to a window status of the vehicle.
US11590818B2
A control device for a vehicle is provided. The vehicle comprises vehicle axles, a chassis, and at least two sensor modules. The control device comprises an energy supply unit. The control device is configured to supply energy to the at least two sensor modules via the energy supply unit. The at least two sensor modules are permanently connected to one of the vehicle axles of the vehicle. A vehicle is also provided. The vehicle comprises vehicle axles, a chassis, a sensor arrangement, and a control device comprising an energy supply unit. The sensor arrangement comprises at least two sensor modules which are permanently connected to the vehicle axle and each comprise a supply connection for providing energy into the respective sensor module.
US11590809B2
Improving the endurance of the beads (1) of a radial tire for a civil-engineering heavy vehicle by proposing a solution which blocks the propagation of the cracks initiated in the coating elastomer of the bead reinforcing layer (5), by inserting a cushion rubber (6) interposed between the coating elastomer of the carcass layer turn-up (312) and the coating elastomer of the bead reinforcing layer (5). The elastic modulus in extension of the cushion rubber (6) measured at 100% deformation must be less than the elastic modulus of the coating compound of the carcass layer. Still according to a disclosed embodiment, the thickness of the cushion rubber (6) is at least equal to the thickness of the bead reinforcing layer (5).
US11590806B2
A motorcycle tyre for off-road includes a tread portion including a bottom surface and connected bodies. The block connected bodies each include blocks protruding from the bottom surface and tie-bars protruding from the bottom surface with a height smaller than that of the blocks to connect the blocks with one another. The block connected bodies include a first connected body whose blocks and tie-bars are arranged so as to surround the bottom surface at least partially. The first connected body includes a first end block located on a first end in a longitudinal direction of the first connected body and a second end block located on a second end in the longitudinal direction of the first connected body. The first end block and the second end block are adjacent with one another, and no tie-bar connecting the first end block and the second end block is provided.
US11590801B2
The present invention relates to a composition for a non-pneumatic tire spoke. In particular, the non-pneumatic tire spoke prepared from the composition for a non-pneumatic tire spoke has excellent mechanical properties. A composition for a non-pneumatic tire spoke includes a thermoplastic polyester elastomer, a silane-based interfacial binder, and silica particles. The silica particles have an average particle diameter of 100 to 300 μm.
US11590791B2
An IR and/or UV machine-readable optical security device (e.g., micro-optic security thread) that is made up of at least one IR-absorbing component with a characteristic IR signature detectable at two or more IR-wavelengths, at least one UV-absorbing component with a characteristic UV signature detectable at two or more UV-wavelengths, at least one IR-absorbing component that absorbs IR light and emits light at a different invisible wavelength, at least one UV-absorbing component that absorbs UV light and emits light at a different invisible wavelength, or a combination thereof, is provided. The IR and UV machine-readable features do not interfere with the optical effects projected by the optical material.
US11590769B2
A tape printing device includes a platen shaft that engages with a platen roller; a thermal head that prints on a tape sandwiched with the platen roller engaged with the platen shaft; a head holder that has a rotating shaft and rotatably holds the thermal head about the rotating shaft; and a pressing member that is provided to be rotatable about the rotating shaft together with the thermal head and presses the thermal head against the platen roller, in which the pressing member has a convex portion that protrudes toward the thermal head and presses the thermal head against the platen roller.
US11590767B2
A producing method for a print by a printing system including a printing device that is manually moved with respect to a medium to perform printing on the medium, the producing method including prompting a user to designate a print plan size of a print image, printing the print image in the print plan size, and notifying a size of the print image printable in one pass by the printing device to the user before the print plan size is decided.
US11590764B2
An image is printed on the front surface M1 by discharging the inks to the front surface M from the discharge heads 321 (first head) facing the front surface M1 (recording surface) of the printing medium M from above. Thus, the inks discharged from the discharge heads 321 partially become mist to possibly produce ink mist. Accordingly, the ink cover 51 (first cover) is arranged between the discharge heads 321 and the front surface M1 of the printing medium M before the discharge heads 321 discharges the inks to the printing medium M. By providing the ink cover 51 for the front surface M1 of the printing medium M before printing in this way, the adhesion of the ink mist to this front surface M1 can be suppressed.
US11590759B2
A liquid container is removably mountable into the apparatus body of a liquid ejection apparatus. The liquid container comprises a liquid storage chamber equipped with an air intake hole and a liquid supply port, for storing liquid and a valve unit having a sealing member and an urging member. The urging member is arranged so as to be at least partly rotationally movable and the urging member has urging force for urging the sealing member in the direction of making the sealing member abut the air intake hole. The sealing member is rotationally movable between a position of abutting and closing the air intake hole and a position separated from the air intake hole so as to open the air intake hole in response to a rotary motion of the urging member.
US11590754B2
An imprint apparatus includes a controller for controlling an imprint process and a supply device for supplying an imprint material. The supply device includes discharge devices to discharge an imprint material, and a discharge controller to control the discharge devices under the control of the controller. The discharge controller includes a buffer memory to temporarily store driving waveform data. Each of the discharge devices includes a discharge element and a driver for driving the discharge element based on the driving waveform data stored in the buffer memory. While a supply step of supplying an imprint material for a first shot region is performed, the controller transfers the driving waveform data for the supply step of a second shot region to a storage area of the buffer memory which is not used in the supply step of the first shot region.
US11590741B2
A multilayer thermoplastic article blended with hydrolytically unstable polymers and a material component for improved recyclability. The multilayer thermoplastic article having an inner layer being made of a thermoplastic material, an outer layer being made of a thermoplastic material, and an intermediate layer disposed between the inner layer and the outer layer. The intermediate layer is made of a blended material comprising 50 to 99 wt. % of a hydrolytically unstable polymer and 1 to 50 wt. % of the material component selected from the group consisting of an oxygen scavenger, an oxidizable organic polymer, a passive barrier material, Iron, Ascorbic Acid, and potassium sulfite.
US11590737B2
Provided is an interlayer film for laminated glass capable of enhancing the sound insulating property and the interlayer adhesive force in an interlayer film having increased transparency. An interlayer film for laminated glass according to the present invention is an interlayer film for laminated glass having a one-layer or two or more-layer structure, the interlayer film includes a first layer containing a vinyl monomer polymer, the vinyl monomer polymer is a polymer of a polymerizable composition containing a monomer having a functional group having hydrogen bondability, and a laminated glass in which the interlayer film for laminated glass is arranged between two sheets of float glass having a thickness of 2.0 mm, a length of 30 mm and a width of 2.5 cm in conformity with JIS R3202 has a haze, measured in conformity with JIS K6714 by using a haze meter, of 0.5% or less.
US11590730B2
The present disclosure is directed to a physically crosslinked, closed cell continuous multilayer foam structure comprising at least one foam polypropylene/polyethylene layer with a KEE cap layer. The multilayer foam structure can be obtained by coextruding a multilayer structure comprising at least one foam layer composition layer with at least one cap layer composition layer, irradiating the coextruded structure with ionizing radiation, and continuously foaming the irradiated structure.
US11590728B2
The present invention provides a laminated plate capable of not only achieving a reduced weight and an increased rigidity but also improving a sound absorbing performance, and a method for manufacturing the same. A laminated plate (1) is supposed to include a core layer (2) including a plate-shaped paper honeycomb structure (4) and a pair of fiber reinforcement layers (3) sandwiching the paper honeycomb structure (4) from both sides in a thickness direction and integrated with the paper honeycomb structure 4. The through-holes (5) of the paper honeycomb structure (4) are filled with a foam resin (6), and the core layer (2) is made up of the paper honeycomb structure 4 and the foam resin (6) filled in the through-holes (5). When the foam resin (6) is filled in the through-holes (5) of the paper honeycomb structure (4), the foam resin plate (6A) is pushed into the through-holes (5) as a filling material by utilizing a compression force of a mold (11).
US11590725B2
A method produces a high-pressure gas storage container that includes a liner and a reinforcing layer. The liner houses a high-pressure gas. The reinforcing layer is formed by winding a plurality of strip-shaped reinforcing members around an outer perimeter surface of the liner. The method includes irradiating plasma on at least a portion of the reinforcing fibers, and adjusting an irradiation intensity of the plasma such that an irradiation amount of the plasma with respect to the reinforcing fibers becomes constant in accordance with changes in a transport speed of the reinforcing fibers.
US11590723B2
A heat press includes a clutch and a linkage that moves the upper platen relative to the lower platen from a first position to a second position. The distance between the upper and lower platen is less in the second position than in the first position. The clutch is coupled to the linkage and mounted to the upper platen. The clutch is configured to adjust the distance between the upper and lower platens in the second position in response to movement of the upper platen from the first position to the second position being impeded by a work piece positioned between the lower platen and the upper platen.
US11590716B2
A method is described for manufacturing a molded product having a recessed/protruding part from a molded substrate (A) including reinforcing fibers and a matrix resin by press molding, the method comprising: a step (I) of placing the molded substrate (A) between molds including an upper mold and a lower mold and deforming the molded substrate (A) in an in-plane direction by heating and pressing the molds; and a step (II) of deforming the molded substrate (A) in an out-of-plane direction by depressurizing the molds subsequent to the step (I), wherein a deformation rate ratio T represented by the following formula (1) is within a range of 0.1 to 1: T=X/Z (1) where X and Z are as defined.
US11590713B2
Shifting is a method for manipulating unidirectional non-crimp fabrics that allows for a curved fiber path along with compound surface geometry. The bases for shifting is understanding unidirectional (UD) non-crimp-fabrics (NCFs) as a semi-flexible prismatic linkage and planning manipulations such that the array of linkages can conform to the surface geometry and path plan within allowable manufacturing tolerances. This has applications in structural composite components such as the current trailing edge prefabricated unidirectional components for wind turbine blades, and for future wind turbine blade designs including a curve-linear spar cap.
US11590703B2
Apparatuses for dynamically sensing infrared (IR) radiation in an electron beam powder bed fusion (EB-PBF) printer are provided. A radiation collector receives radiation from a surface of the powder bed. An IR-transparent material rejects one or more non-IR wavelengths, and a lens focuses the IR radiation onto an optical fiber. The IR radiation is carried from the vacuum chamber of the printer to a sensor, where IR information is determined based on the received IR radiation. The IR information may be received from the sensor and used by the print controller to modify one or more parameters, such as beam intensity or scanning rate, on the fly or during the next print cycle. An occlusion member can be used to selectively block or expose the radiation collector to protect the radiation collector from condensation of vapor from vaporization of particles at high temperatures.
US11590699B2
A method and apparatus for the additive manufacturing of three-dimensional objects are disclosed. Two or more materials are extruded simultaneously as a composite, with at least one material in liquid form and at least one material in a solid continuous strand completely encased within the liquid material. A means of curing the liquid material after extrusion hardens the composite. A part is constructed using a series of extruded composite paths. The strand material within the composite contains specific chemical, mechanical, or electrical characteristics that instill the object with enhanced capabilities not possible with only one material.
US11590693B2
A method for manufacturing a deflection member is disclosed. The method may include the steps of providing an additive manufacturing apparatus that includes at least one radiation source and a vat containing a photopolymer resin, providing a reinforcing member, contacting a surface of the reinforcing member with the photopolymer resin, and directing radiation from the at least one radiation source towards a surface of the reinforcing member to at least partially cure photopolymer resin in contact with the surface of the reinforcing member to create at least a portion of a lock-on layer.
US11590689B2
According to some aspects, a method of additive fabrication wherein a plurality of layers of material are formed is provided. The method may comprise forming a layer of material in contact with a container, and subsequent to the forming of the layer of material, actively bending the container around at least one fixed point such that the layer of material separates from the container. According to some aspects, an additive fabrication apparatus configured to form a plurality of layers of material is provided. The apparatus may comprise a container, a build platform, one or more force generators, and at least one controller configured to, subsequent to formation of a layer of material in contact with the container, actively bend the container around at least one fixed point via the one or more force generators, such that the layer of material separates from the container.
US11590685B2
A fiber aggregation contains fiber containing a thermoplastic resin, each of the fiber being mutually joined and aligned.
US11590678B2
The material feeding device is configured so that in the state in which a hopper having an opening part and containing a material is attached to a coupling member configured so that the hopper is detachably attached to the coupling member, when the hopper is located in a first area, a first member configured to be able to make a sliding displacement on a slide surface having the first area where a feed hole is disposed makes the sliding displacement to a third area different from the first area to make it possible to take a communicated state in which the opening part and the feed hole are communicated with each other, and when the hopper is located in a second area, the first member makes a sliding displacement to the first area to make it possible to take a non-communicated state in which the first member covers the feed hole. The material feeding device takes the non-communicated state at least when the hopper is detached from the coupling member via a detachably attaching part disposed in the second area extending along a direction in which the first area extends.
US11590674B2
A method and processing station for producing a veneer having two parallel opposed faces and including at least one lignocellulosic layer made of lignocellulosic fibers having a grain extending along the opposed faces of the veneer. The processing station carries out the method by applying a compressive force to the veneer along at least one direction extending along the opposed faces of the veneer so as to mechanically compress the lignocellulosic fibers.
US11590673B2
Apparatus and method for separating product containing pouches from a travelling web of adhered films carried on a film support surface includes a rotary blade drum assembly having blade configurations with blade portions arranged to form the entire perimeter edge of the flange of the pouch which rotate in synchronous registration with grooves in the film support surface. In one form, at least one blade portion and associated groove portion are non-linear and other than longitudinal or transverse to the film support surface of the forming drum or travelling web of films. The blade portions may be heated and the rotary blade drum assembly may include insulating guides for the pouches.
US11590657B2
The image processing device according to the invention includes: a first acquisition unit to acquire a captured image; a display control unit to display a setting screen to allow to user to set an image processing area, which is an area where predetermine image processing is performed, in the image acquired by the first acquisition unit on a display device; and a second acquisition unit configured to acquire movable range information indicating a movable range of a working device, operations of which are controlled on the basis of a result of the predetermined image processing. The display control unit controls the display of the setting screen so as to cause the user to identify a range in which the working device is not able to operate in the image, on the basis of the movable range information acquired by the second acquisition unit.
US11590656B2
A computing system and a method for calibration verification is presented. The computing system is configured to perform a first calibration operation, and to control a robot arm to move a verification symbol to a reference location. The robot control system further receives, from a camera, a reference image of the verification symbol, and determines a reference image coordinate for the verification symbol. The robot control system further controls the robot arm to move the verification symbol to the reference location again during an idle period, receives an additional image of the verification symbol, and determines a verification image coordinate. The robot control system determines a deviation parameter value based the reference image coordinate and the verification image coordinate, and whether the deviation parameter value exceeds a defined threshold, and performs a second calibration operation if the threshold is exceeded.
US11590651B2
A method of training a robot system for manipulation of objects, the robot system being able to perform a set of skills, wherein each skill is learned as a skill model, the method comprising: receiving physical input from a human trainer, regarding the skill to be learned by the robot; determining for the skill model a set of task parameters including determining for each task parameter of the set of task parameters if a task parameter is an attached task parameter, which is related to an object being part of said kinesthetic demonstration or if a task parameter is a free task parameter, which is not related to a physical object; obtaining data for each task parameter of the set of task parameters from the set of kinesthetic demonstrations, and training the skill model with the set of task parameters and the data obtained for each task parameter.
US11590648B2
A robot system includes a robot having an arm including a first arm coupled to a base and pivoting about a first pivot axis and a second arm coupled to the first arm and pivoting about a second pivot axis parallel to the first pivot axis, and a first motor pivoting the first arm about the first pivot axis, and a control apparatus having a first motor control unit that controls the first motor. The robot has an inertial sensor that detects an angular velocity about a roll axis of the arm or an acceleration in a tangential direction of a circle around the roll axis, and the first motor control unit controls the first motor based on the angular velocity or acceleration.
US11590647B2
An exoskeleton for interfacing with a joint includes a base configured to be coupled to a user, a platform configured to be coupled to the user proximate the joint, and a plurality of substructures extending between the base and the platform. The substructures are actuated in parallel in order to move the platform.
US11590641B2
A staple gun and a method of using the same. A stapling mechanism in the housing is activated to deliver a staple through an aperture in a housing wall and drive the staple into a surface around a stack of one or more electric cables. The gun includes a reciprocating cable guide for centering the gun on the stack of cables and closing a safety switch to permit the gun's trigger to be activated. A spacer extending outwardly from the housing wall rests on the upper surface of the cable stack. The spacer and a bumper that engages a hammer of the stapling mechanism provide for automatic depth adjustment when driving the staple into the surface. A reciprocating cable guard extending outwardly from the housing wall is positioned between the stack of cables and the staple to aid in preventing the staple from piercing the cable.
US11590634B2
An apparatus and method for detecting structural and material defects in a fastener driven during a manufacturing process includes a driving tool capable of recording an angle-torque trace during the driving of the fastener and a machine learning engine operably connected to the driving tool for analyzing the recorded angle-torque trace. The machine learning engine can be provided with a number of sample angle-torque traces from sample fasteners and can self-determine a stored trace including tolerances for acceptable angle-torque trace data from the samples in an unsupervised learning process or protocol without the need for defined anomalous and non-anomalous samples being provided to the machine learning engine. Using the self-defined stored trace and acceptable tolerances, the machine learning engine can analyze attributes of subsequently recorded angle-torque traces to ascertain whether the attributes of the recorded angle-torque traces indicate anomalies within the fastener identified by the recorded trace.
US11590630B2
A workpiece grinding method includes a groove formation step, a groove removal step, and a full surface grinding step. In the groove formation step, the workpiece is ground by performing grinding feed of a grinding unit while rotating a spindle without rotation of a chuck table, so that an arcuate groove is formed with a depth not reaching a finish thickness on a side of a back surface of the workpiece. In the groove removal step, rotation of the chuck table is started with the spindle kept rotating, so that the groove is ground at side walls thereof and is removed from the workpiece. In the full surface grinding step, grinding feed of the grinding unit is performed while the spindle and chuck table are rotated, so that the workpiece is ground in an entirety thereof on the side of the back surface until the workpiece has the finish thickness.
US11590624B2
A method for treating an interior weld joint located along an inner surface of a pipe includes the steps of: (a) advancing an internal grinder device within the pipe to the interior weld joint, wherein the internal grinder device includes a hollow housing that has a first open end and a first grinding implement that is disposed within the hollow housing and coupled thereto with a first biasing member; and (b) controllably rotating the hollow housing to at least a threshold speed at which time and under centrifugal force, the first grinding implement moves from an at rest retracted position to a deployed position in which the first grinding implement extends radially beyond the first open end for contacting and grinding the interior weld joint as the hollow housing and the first grinding implement are rotated.
US11590621B2
A machine tool includes: an imaging unit for capturing an image of a tool from a side of the tool; a shape extraction unit for extracting the shape of the tool from the image of the tool captured by the imaging unit; a wear detection unit for detecting the degree of wear of the tool based on the shape of the tool; and a changing unit for changing at least one of the pitch and the depth of cut according to the degree of wear.
US11590619B2
The present invention discloses a scrap removing device for cutting a wheel rim which comprises a main body having a working surface, a wheel rim positioning member, a first blowing member and a second blowing member sequentially disposed on the working surface from a top side thereof.
US11590616B1
An underactuated joining system for a moving assembly line includes a robot with actuated joints, an articulated compliance mechanism, and a controller. An end-effector of the mechanism is connected to linkages and to a joining tool, unactuated joints interconnect the linkages, and position sensors measure joint positions of the unactuated joints. In response to the joint positions, a controller regulates a position of the actuated joints to cause the compliance mechanism to compliantly follow the assembly line. This occurs while the tool remains engaged with a workpiece being transported along the assembly line. A method includes engaging the tool with the workpiece as the workpiece is transported by the assembly line, measuring joint positions of the unactuated joints using position sensors, and controlling a position of the active joints to cause the compliance mechanism to compliantly follow the workpiece along the assembly line.
US11590605B2
Provided is a joining method that can prevent a plastic flowing material from flowing out from a butt section and that can reduce the thickness and weight of metal members. The joining method is for joining a first metal member and a second metal member by using a rotary tool comprising a stirring pin, and is characterized in that: the stirring pin comprises a flat surface perpendicular to the rotation axis of the rotary tool and comprises a protruding section protruding from the flat face; and in a friction stirring step, the flat surface is brought into contact with the first metal member and the second metal member, and a front end face of the protruding section is inserted deeper than an upper overlapping section to join an upper front butt section and the upper overlapping section.
US11590603B2
[Problem] To provide: a roll-bonded body which is able to be suppressed in waviness in the surface; and a method for producing this roll-bonded body. [Solution] A roll-bonded body according to the present invention is obtained by bonding a first metal layer and a second metal layer with each other by means of rolling, and is characterized in that the surface of the first metal layer has an arithmetic average waviness (Wa1) 0.01-0.96 and a maximum waviness height (Wz1) of 0.2-5.0 μm.
US11590583B2
The invention relates to a machining tool (2) for processing a bore in a workpiece, in particular for simultaneous processing of a plurality of bores distanced from one another by a predefined distance, said machining tool having a cutting body (8) extending in the direction of a tool longitudinal axis (4) and having at least one cutting element (12) arranged circumferentially, and a guide body (10), which adjoins the cutting body (8) in the direction of the tool longitudinal axis (4), is fastened to the cutting body (8) and has at least one circumferentially arranged guide element (20). The guide body (10) is free of cutting elements (12) and the guide body (10) is designed to exert a preload force such that, during use, the at least one guide element (20) is preloaded against a bearing for the guide body (10).
US11590577B2
Various embodiments include an acoustic-energy deposition and repair system that includes at least one Directed Acoustic Energy Deposition (DAED) tool configured to apply acoustic energy to feedstock material in at least one of three vibrational modes; and a drive system to move the DAED tool in at least one of three-coordinate positions. In various examples, the acoustic-energy deposition and repair system further includes at least one in-situ metrology tool mounted proximal to the DAED tool to measure a grain size of deposited material. Other methods, devices, apparatuses, and systems are disclosed.
US11590572B2
A method of making a cutting tool includes providing a first sintered cemented carbide body of a WC, a metallic binder phase and eta phase and wherein the substoichiometric carbon content in the cemented carbide is between −0.30 to −0.16 wt %. The first sintered cemented carbide body is subjected to a heat treatment at a temperature of between 500 to 830° C. for a time between 1 to 24 h. A cutting tool made according to the above method having an increased resistance against comb cracks is also provided.
US11590569B2
To provide novel low-temperature sinterable copper particles that can be sintered even at a low temperature of, for example, around 100° C. or less, and a method for producing a sintered body by using the same. The low-temperature sinterable copper particles according to the present invention are coated with a carboxylic acid, and a surface of the copper particle is oxidized so as to have a cuprous oxide fraction (Cu2O/(Cu+Cu2O)) in the copper particle of 4% by mass or less or so as to have an average coating thickness of cuprous oxide of 10 nm or less. The low-temperature sinterable copper particles are subjected to low-temperature firing in an atmosphere of 0.01 Pa or less.
US11590568B2
Disclosed herein are embodiments of methods, devices, and assemblies for processing feedstock materials using microwave plasma processing. Specifically, the feedstock materials disclosed herein pertains to scrap materials, dehydrogenated or non-hydrogenated feed material, recycled used powder, and gas atomized powders. Microwave plasma processing can be used to spheroidize and remove contaminants. Advantageously, microwave plasma processed feedstock can be used in various applications such as additive manufacturing or powdered metallurgy (PM) applications that require high powder flowability.
US11590565B2
A continuous casting and rolling line for casting, rolling, and otherwise preparing metal strip can produce distributable metal strip without requiring cold rolling or the use of a solution heat treatment line. A metal strip can be continuously cast from a continuous casting device and coiled into a metal coil, optionally after being subjected to post-casting quenching. This intermediate coil can be stored until ready for hot rolling. The as-cast metal strip can undergo reheating prior to hot rolling, either during coil storage or immediately prior to hot rolling. The heated metal strip can be cooled to a rolling temperature and hot rolled through one or more roll stands. The rolled metal strip can optionally be reheated and quenched prior to coiling for delivery. This final coiled metal strip can be of the desired gauge and have the desired physical characteristics for distribution to a manufacturing facility.
US11590562B2
A casting mold includes: an upper mold; a lower mold; a horizontal mold; and a core. The core includes a main body part, and a baseboard part that continues to the main body part. The lower mold includes an accommodation part that accommodates the baseboard part. The casting mold further includes an urging member that urges the baseboard part toward an inner face of the accommodation part.
US11590561B2
A method for producing a sand mold includes mixing artificial sand with a furan resin composition including a furan resin precursor, preparing molding sand having the artificial sand and a surface-modified layer containing a resin cured product covering the artificial sand and including a curing agent attached to the surface-modified layer by mixing the curing agent including xylene sulfonic acid with the artificial sand with which the furan resin composition is mixed, and curing the furan resin composition, after mixing the artificial sand with the furan resin composition, and curing an added portion of the binder in the molding sand by adding the binder to the molding sand. In the step of curing the added portion of the binder, the curing agent for curing the furan resin composition is used also as a curing agent for curing the binder.
US11590557B2
A wire forming apparatus 1 comprises a rotary table 22 that is rotatably supported by a table body 21, a slide tool unit 100A that is attached to the rotary table 22 and supports a slide tool T1 capable of sliding toward a wire guide, and a tool slide mechanism 60 that is supported by the table body 21 and transmits a driving force for sliding the slide tool T1 to the slide tool unit 100A. The tool slide mechanism 60 has a single motive power transmission member 61 that is rotatably supported by the table body 21, and a driving force generated by a rotation of the motive power transmission member 61 is transmitted, in common, to a plurality of slide tools T1 attached to the rotary table 22.
US11590556B2
A straightening apparatus for straightening cables includes a first roller group having several rollers and a second roller group having several rollers opposite the first roller group. The cable alternates in a transport direction between the rollers of the first roller group and the rollers of the second roller group. The straightening apparatus further includes an infeed device with which the first roller group can be displaced in a closing direction against the second roller group. In order to secure the position of the first roller group displaced in the closing direction by the infeed device, the straightening apparatus includes a backstop which blocks a backward movement of the first roller group against the closing direction. The backstop has a clamping roller which is received in a wedge gap.
US11590549B2
An method of manufacturing a hot press-formed member comprises heating a blank of an aluminum-based plated steel sheet in a heating furnace, removing the heated blank from the heating furnace and conveying the removed blank between an upper mold portion and a lower mold portion of a mold, mounted on a press, to be seated; and performing a forming process after the upper mold portion of the mold is in contact with the seated blank.
US11590548B2
An assembly for bending a conduit and a portable conduit bender. The assembly may generally include a portable bender including a base having a base surface supportable on a work surface, a housing supported by the base and defining a housing axis, the housing including a handle engageable by an operator to carry the bender, and a shoe supported by the housing for pivoting movement about the housing axis, the shoe defining a channel for supporting a conduit to be bent; and a pipe threader removably supported by the housing, the threader being operable to pivotably drive the shoe relative to the housing to bend the conduit.
US11590538B2
Bulk material cleaner (1) comprising a support frame (2) and a screen housing (3), which can be oscillated and/or vibrated by a drive (5). At least one screen (6) is arranged in the screen housing (3). The screen housing has a feed opening (7) and at least two outlet openings (8, 9), the outlet openings (8, 9) being for a first fraction (F1) and a second fraction (F2), respectively. Moreover, the bulk material cleaner (1) comprises an air separator (10), which is only fastened on the screen housing (3).
US11590529B2
Provided is a mask manufacturing method which includes preparing a mask sheet and a frame, stretching the mask sheet, and fixing the stretched mask sheet to the frame, and forming cell openings in the mask sheet fixed to the frame.
US11590522B2
Kits for vehicles may include pulse-width-modulated solenoids configured to selectably turn individual nozzle assemblies on and off and vary their flow rates when installed in fluid communication with the nozzle assemblies, one or more wirelessly-controllable solenoid controllers, a wiring harness to electrically connect the pulse-width-modulated solenoids to the controller(s), a wirelessly-communicating GPS antenna system, a LiDAR sensing system which may be wirelessly-communicating, associated wiring and bracketry to connect the kit with a vehicle, and a mobile device configured to wirelessly cause the one or more controllers to turn individual nozzle assemblies on and off and vary their flow rates based on sensed data and/or recorded data, in view of user-selected criteria.
US11590520B2
The invention relates to a dispensing device (11) for spraying a sprayable medium, in particular a fluid or powder, which device is designed as a handheld apparatus, in which a compressed air device (86) is provided, comprising a spray head (14) that is connected to the housing (12) and is intended for dispensing the medium, comprising a fluid line (44) leading from the storage container (41) to the spray head (14) and comprising a supply line (36) leading from the compressed air device (86) to the spray head (14), and comprising a first nozzle (38) that is connected to the supply line (36) and, separately therefrom, comprising a second nozzle (46) that is connected to the fluid line (44) and that protrudes into an airflow emerging from the first nozzle (38), such that an atomizing zone (49) is formed outside of the spray head (14), wherein, in a plan view of the outlet opening (83) of the first nozzle (38), the second nozzle (46) covers at least 1% of an internal cross section of the first nozzle (38).
US11590517B2
An applicator for a syringe is provided that includes a hub configured to be disposed at least partially within a nozzle of the syringe and defining a fluid passage therethrough, with one or barbs on the hub that frictionally and sealingly engage an interior of the nozzle in a manner minimizing void space associated with waste of deliverable material, and an applicator tip extending distally from the hub. The barb(s) may have varying diameters in order to enable the applicator to be engaged and utilized with syringes having different diameter nozzles. Further the fluid passage through the hub and applicator tip is dimensioned to minimize the volume of material that is retained within the applicator after use, thereby increasing the volume of material that can dispensed from the syringe for use in a procedure or procedures and minimize waste.
US11590511B2
A flow-type field-flow fractionation apparatus 1 includes a first heater 14 and a second heater 16. The first heater 14 heats a carrier fluid between a first pump 12 and a separation cell 3. The second heater 16 heats a focus fluid between a second pump 15 and the separation cell 3. Thus, the carrier fluid heated by the first heater 14 is sent by the first pump 12 and flows into the separation cell 3, and the focus fluid heated by the second heater 16 is sent by the second pump 15 and flows into the separation cell 3. This can stabilize temperatures of the carrier fluid and the focus fluid flowing into the separation cell 3. Then, when an analysis is performed using the flow-type field-flow fractionation apparatus 1, the analysis can be performed with high reproducibility.
US11590509B2
A polycrystalline silicon block fracture device includes a fracturing part mechanically fracturing a polycrystalline silicon block material to produce a polycrystalline silicon fragment including a polycrystalline silicon powder having a particle size of 500 to 1000 μm then discharging from a discharging port; a falling movement part continuous with a downstream of the fracturing part allowing said polycrystalline silicon fragment discharged from the discharging port to fall by gravity; a receiver part positioned at downstream of the falling movement part and receives the polycrystalline silicon fragment after falling through the falling movement part; and the falling movement part includes a suction removing part in which at least part of the polycrystalline silicon powder included in the polycrystalline silicon fragment is removed by suctioning to a different direction from falling direction; the suction removing part suctions at a suction rate of 1 to 20 m3/min.
US11590508B2
A destruction device capable of destroying a plurality of types of storage devices includes: a support plate mounting part to which a support plate is detachably mounted; a crushing member mounting part to which a crushing member is detachably mounted; a support plate detection part capable of detecting the support plate mounted on the support plate mounting part; a crushing member detection part capable of detecting the crushing member mounted on the crushing member mounting part; and a control unit that determines whether the support plate detected by the support plate detection part and the crushing member detected by the crushing member detection part correspond to a same type of storage device, and executes a crushing process for crushing the storage device upon determining that the support plate and the crushing member correspond to the same type of storage device.
US11590502B2
The present disclosure relates to a consumable sample partition device and it assembly and use. The sample partition device can be used to test a sample for absence of microorganisms (sterility) and/or for concentration of said organisms (bio-burden). The sample partition device partitions the sample input volume into multiple discrete measurement zones with little or no loss of sample (e.g., zero-loss) and with little operator involvement, thereby reducing operator- and environment-based false positives.
US11590498B2
There is provided an arrangement (100) which allows for mixing a first fluid with a second fluid at a predetermined volume mixing ratio in a capillary driven fluidic system. The arrangement (100) allows filling an initially empty mixing chamber (110) with the first fluid. The arrangement then allows emptying a predetermined fraction of the first fluid from the mixing chamber (110) such as to form an empty space in the mixing chamber (110). The arrangement then allows filling the empty space of the mixing chamber (110) with the second fluid, thereby allowing a predetermined volume of the first fluid to mix with a predetermined volume of the second fluid over time.
US11590488B2
A dosing device is proposed which is designed for dosed output of a fluid. The dosing device has a block-shaped channel body, through which a dosing channel system passes. The dosing channel system has a fluid infeed opening and a plurality of fluid output openings. The fluid output openings are formed by the channel apertures of narrowed output sections of a plurality of output channels of the dosing channel system. The entire dosing channel system, including the output channels, is formed in the block-shaped channel body. The dosing channel system is preferably structured such that the flow velocity of the fluid channelled through during operation is at least substantially the same throughout with the exception of in the output sections of the output channels.
US11590485B2
Embodiments of the present disclosure are directed to a process for modifying catalysts comprising introducing a precursor agent and hydrogen gas to a conversion reactor; contacting the precursor agent with a conversion catalyst in the conversion reactor, thereby producing an active agent; introducing the active agent to a production reactor; and contacting the active agent with a hydroprocessing catalyst in the production reactor, thereby producing a modified hydroprocessing catalyst.
US11590482B1
Provided is a catalytic washcoat having a catalyst component and an alumina binder, wherein the catalyst component includes an aluminosilicate molecular sieve having a beta (BEA) and/or chabazite (CHA) framework, and about 1 to about 10 weight percent of a base metal component comprising iron and/or copper, wherein said weight percent is based on the weight of the aluminosilicate molecular sieve.
US11590481B2
Provided herein are methods for hydroisomerization of a hydrocarbon feedstock comprising contacting the hydrocarbon feedstock with hydrogen and a catalyst to yield a hydrocarbon product having an increase in branched hydrocarbons relative to the hydrocarbon feedstock. The present catalysts comprise a heteroatom-doped Beta zeolite having a trivalent cation as a framework metal oxide, an extra-framework species comprised of cerium and/or cobalt, and from 0.01 to 1.5 wt. % of a group VIII or VIB metal, or a combination thereof.
US11590476B2
A method of producing a porous carbon composite fibrous mats formed of a network of carbon fibers incorporated with porous carbon particles. The method includes electrospinning a polymer solution to form a porous layer of polymeric fibers and the polymeric fibers are doped with a precursor of conductive metal particles, wherein the polymer solution includes a polymer and the precursor of the conductive metal particles, electrospraying a metal organic framework suspension onto the porous layer of polymeric fibers, wherein the metal organic framework suspension includes metal organic framework particles, repeating the electrospinning and electrospraying in an alternating manner to form a porous network of polymeric fibers incorporated with the metal organic framework particles, and heating the porous network of polymeric fibers incorporated with the metal organic framework particles to form the porous carbon composite fibrous mats. The porous carbon composite fibrous mats and its applications thereof are also disclosed herein.
US11590470B2
A liquid process assembly, the assembly including a length of pipework, and a reversible pump for selectively reciprocally moving liquid through the pipework.
US11590468B1
An automatic chemical solution formulating device combines and mixes stored solids and liquids into user specified formulations and dispenses those formulations into containers. Chemical solids are stored in cartridges of material separated into predetermined dosages (for example in reeled blister packs), avoiding the need for weighing during formulation. Elements include user interface, computer-controlled automated loading and unloading port for reagent-containing cartridges, cartridge conveyor system, reader for identifying cartridges, blister-pack strip drive system, punching mechanism to release reagents, portioning chamber to mix solvent with solids or liquids with optional portioning, accommodating formulation delivery port, position sensors, liquid flow measuring devices, liquid and gas pumps and valves, and label printer. The combination of these elements allows high-speed formulation and dispensing of user-specified formulations.
US11590462B2
An aerator for aerating a liquid as the liquid is being poured from a container includes an aerator body configured to be at least partially inserted into the container. The body includes an inlet, an outlet, and a flow control chamber disposed between the inlet and the outlet. A flow control element is movably disposed in the flow control chamber between a first position where the flow control element is spaced away from a stop and a second position where the flow control element engages the stop. The flow control chamber communicates with the outlet when the flow control element is in the second position allowing liquid to be poured from the container and allowing air to be introduced into the flow control chamber for mixing with the liquid being poured from the container to aerate the liquid being poured from the container.
US11590453B2
A non-oxidizing, buffered disinfectant concentrate is provided to be included in a solution used to disinfect a membrane. The solution applied to the membrane is configured to have a pH that is compatible with the membrane. The disinfectant concentrate includes an aqueous solvent; a hydrotrope; a strong acid surface cleanser; a biocidal active, preferably, at least two biocidal actives; a buffer agent; and, optionally, an anionic surfactant. The biodical active may be selected to function both as a biocide and as a weak acid/buffer combination. A disinfectant solution applied to the membrane includes from about 0.1 wt % to about 3.5 wt % of this disinfectant concentrate.
US11590445B2
Provided is an apparatus for treating waste gas of the electronics industry, and the apparatus includes: a reaction chamber in which an inlet and an outlet are formed and an inner space for purifying waste gas is formed; a first partition plate extending from an inner wall of the reaction chamber facing the inlet in a direction toward the inlet, dividing the inner space into a pre-treatment zone for collecting dust in the waste gas and a remaining purification zone; a second partition plate extending vertically downward from a ceiling of the reaction chamber, dividing the purification zone into a thermal decomposition zone for heating and thermally decomposing waste gas and a post-treatment zone; and a heater installed at the ceiling of the reaction chamber so as to be located in the thermal decomposition zone to thermally decompose a perfluorinated compound by heating waste gas introduced into the thermal decomposition zone; and a dry scrubber unit including one or more catalysts to collect at least one of the dust, a fluorine compound, and nitrous oxide (N2O) in waste gas introduced into the post-treatment zone.
US11590435B2
A coalescence filter for purifying a fluid which contains a carrier and at least one liquid contaminant by coalescing of the at least one contaminant, where the coalescence filter includes an inlet for supplying the fluid to a filter element present in the coalescence filter, where the filter element includes a primary coalescence medium which is provided for coalescing of the at least one contaminant in the primary coalescence medium during the displacement of the fluid through the primary coalescence medium. The coalescence filter further includes an outlet for discharging the coalesced contaminant from the filter element, where the primary coalescence medium comprises at least one layer of a porous material, where the primary coalescence medium has a total thickness of at least 3.5 mm.
US11590434B2
A method and an apparatus suitable for a continuous chromatography process which only needs three separation columns, and a two-step process containing two chromatographic steps, in which the first chromatographic step (capture) is performed alternating and sequentially on two separation columns, the second chromatographic step (polishing) is performed, also sequentially, on the third column.
US11590433B2
A method and system for solid phase extraction of a compound of interest from a sample matrix using a syringe having a barrel and a plunger, a sorbent for use with the syringe, and a desalting purification column having an end configured to receive liquid from the syringe body.
US11590431B2
A base plate for supporting a plurality of interlocking building bricks includes a planar sheet having a top surface and a bottom surface, with a plurality of nodes projecting from the top surface. The plurality of nodes includes a node having a vertical cylindrical wall and a horizontal top wall, the vertical cylindrical wall tapering along its vertical height; the node also having a bevel extending around a circumference of the node at an edge where the vertical cylindrical wall transitions to the horizontal top wall. A method of assembling a composite base plate includes securing two component base plates to one another via a common backing material. A method of printing on a base plate includes applying ultraviolet ink to at least the top surface of the base plate from an ultraviolet light printer, the base plate having a plurality of studs or nodes projecting from the top surface.
US11590426B2
A computing system is provided. The computing system includes a server having one or more processors configured to receive from a user computing device run-time telemetry data, the run-time telemetry data being recorded during execution of a target program of a plurality of programs by the user computing device and being indicative of communication between the user computing device and a user input device. The one or more processors are further configured to determine a performance metric based on the run-time telemetry data, determine an updated driver parameter for the target program based on the determined performance metric, send the updated driver parameter to the user computing device, and apply the updated driver parameter for use during a subsequent execution of the target program.
US11590415B2
A system for displaying a mobile device screen comprises a head mounted display for displaying a first content to a user, a video camera mounted on the head mounted display, the video camera operable to capture a video image of a scene in front of the user, a region detection processor operable to detect a region of the captured video image comprising a mobile device screen, and an image processor operable to replace a corresponding region of the displayed first content in the head mounted display with the detected region of the captured video image comprising the mobile device screen.
US11590410B2
It is suggested to provide a line marking device having a GNSS receiver or prism for a robotic total station. The line marking device further has at least one spray nozzle and a comparator adapted to compare a detected location to a predetermined pattern. The comparator calculates a location and/or a direction error. Further the line marking device has a prompting device for providing steering information to a user. The provided information is the location and/or direction error. The at least one spray nozzle and the GNSS receiver or the prism are in a fixed spatial relation to a connecting element, which is connected or connectable to an unmovable receiving element of a cart.
US11590409B2
A self-propelled, one-wheeled vehicle may include a board having two deck portions each having a concave front footpad configured to receive a foot of a rider, and a wheel assembly disposed between the deck portions. The concave front footpad has a rider detection sensor in the form of a membrane switch conforming to the shape of the footpad (e.g., facilitated by one or more slots formed in the membrane switch). A motor assembly drives the vehicle in response to board orientation and rider detection information.
US11590403B2
The disclosure herein provides a golf GPS device with a sensor mechanism to automatically switch between video and audio only modes of the device. More particularly, when a player attaches the golf GPS device to a piece of clothing or hat, the device automatically switches to audio-only mode. When the player detaches the golf GPS device, the device automatically switches to video mode, with or without audio. The golf GPS device further includes one or more processors configured to repeatedly determine in which one of the plurality of holes the device is located, to repeatedly compute a distance between the device and a feature of the determined hole, and to cause to display the hole number of the determined hole and the computed distance on the display screen.
US11590397B2
Systems and methods for assisting a user with creating a custom shots-made basketball practice arrangement are provided. A detector detects made basketball shots. A user interface receives a user selection of a subset of pass receipt locations for a custom shots-made basketball practice arrangement located about a basketball playing surface. A control system receives data indicating the user selection and a number of shots to be made and commands an ejector to launch basketballs to a particular one of the pass receipt locations in the subset until data is received indicating that the selected number of shots to be made are made at the particular one of said plurality of pass receipt locations, cease launching the basketballs to the particular one of the pass receipt locations, and begins launching basketballs to a second particular one of the pass receipt locations in said subset.
US11590395B2
Embodiments of golf club heads, golf clubs, and methods to manufacture golf club heads and golf clubs are generally described herein. In one example, a golf club head includes a hollow body portion including a material having a first density and an interior cavity. A face pocket portion may be in the first interior cavity at or proximate to the front portion of the body portion, define a second interior cavity, and at least partially enclose the first interior cavity. A face portion is coupled to the front portion to enclose the second interior cavity. A first filler material may be injected into the first interior cavity from an external port. A second filler material may fill the second interior cavity. The first filler material and the second filler material may have at least one different physical property. Other examples and embodiments may be described and claimed.
US11590391B2
A method for exercising muscles in an ankle, foot, and/or leg of a user includes positioning a foot of a user onto a first body of an exercise device. The first body is spaced away from a second body of the device and pivotably connected to the second body of the device at a pivot axis. The pivot axis is adjacent to a central portion of the first body. The method includes rotating the first body about the pivot axis, with the foot, against a first resistive force. Rotating the first body includes subjecting the foot to a first motion. The method includes positioning the foot onto the second body. The method includes rotating the second body about the pivot axis, with the foot, against a second resistive force. Rotating the second body includes subjecting the foot to a second motion, the second motion being different than the first motion.
US11590389B1
An exercise machine system that allows for completion of a plurality of exercises on one machine is disclosed. The exercise machine system includes a frame having a front bar and a base with a first cross bar extending therebetween; a weight attachment bar pivotally attached to the first cross bar via a pivot joint secured to the first cross bar, the weight attachment bar extending to a weight end; a triangular frame extending from the front bar; a second cross bar extending from the base and coupled to the triangular frame; a body support positioned above the triangular frame, the body support having one or more pads to allow for supporting a person thereon, the body support having one or more bars configured to removably couple to the body support; a leg support secured directly to the body support, the leg support having one or more pads; a cable having a first end and an opposing end; a first pulley secured directly to the leg support via first anchor; and a second pulley secured directly to the weight attachment bar via a second anchor.
US11590386B2
An exercise system includes a frame, an upper body carriage, a lower body carriage, a positioning carriage, a resistance assembly attached to the frame, and a connecting mechanism. The frame includes a right guide rail, a left guide rail, and a central guide rail disposed between the right guide rail and the left guide rail. The upper body carriage includes an upper right and an upper left carriage slidingly attached to the right and left guide rail, respectively. The lower body carriage includes a lower right and lower left carriage slidingly attached to the right and left guide rail, respectively. The connecting mechanism mechanically couples one of the upper body carriage, the lower body carriage, or the positioning carriage to the resistance assembly such that the resistance assembly applies a predetermined level of resistive force to the upper body carriage, the lower body carriage, and/or the positioning carriage.
US11590381B2
This technology relates generally methods of making and using systems designed to enhance athletic skill development and, more particularly, to methods of maintaining proper foot alignment for certain activities that require agility and consistency. There exists a need for a training device that not only allows a user to dynamically transition back-and-forth between a wider and narrower stance, but also protects the lower extremities of the user when in a narrower stance. In particular, during the process of bringing their legs together, the user's foot and ankle could be injured if the training device is not designed in such a way to ergonomically accommodate the ankle and/or have appropriate cushioning features to insulate the foot and/or ankle from full impact against blunt or sharp surfaces.
US11590380B2
An adjustable barbell system may include a base, two or more weights, a handle assembly, an additional weight, and selection assembly. The two or more weights may be supported by the base and grouped into a first set of weights associated with one end of the barbell system and a second set of weights associated with an opposing end of the barbell system. The handle assembly may be selectively fixedly joined to the first and second set of weights. The additional weight may be disposed distally of the handle assembly. The selection assembly may be secured to the additional weight. The selection assembly may include a selection member that may be linearly moveable between a selected position where the additional weight is operatively secured to the handle assembly and an unselected position where the additional weight is disengaged from the handle assembly.
US11590379B1
An exercise apparatus includes first and second elastic, elongate cables each having a first end portion configured to be grasped by a user, and a second end portion configured to be detachably coupled to one another. The cables are together configured to provide resistance to being stretched along their lengths in response to an application of a tension force and return to their unstretched lengths upon the user releasing the tension force. The first cable has a first elasticity, and the second cable has a second elasticity that is different than the first elasticity of the first cable.
US11590378B2
An exercise chair allows a user to obtain physical exercise at his or her desk or other workplace. An exemplary exercise chair may include a frame, including a base, an angled section angled upward from the front of the base, and a back support extending upward from the rear of the base; a seat support rotatably connected to the angled section; and at least one resistance element connected to a rear portion of the seat support and to the back support.
US11590375B1
A method of temporarily operating sprinklers and mobile sensors during buildings/facilities alterations, renovations, additions, repairs, rehabilitations, relocations and any other similar activities where personnel may trigger sprinkler systems through accidental actions (or inactions) during their chores. This minimizes the possibility of damages during the building's construction/renovation.
US11590373B2
A fire extinguishing system for a vehicle includes a fire detection device outputting a fire detection signal in response to detecting a fire and is installed in a predetermined space of the vehicle. A controller outputs a control signal for spraying fire extinguishing agent when the fire detection signal is received from the fire detection device. An air tank stores compressed air and a fire extinguishing agent cylinder is connected to the air tank through an air hose, is filled with the fire extinguishing agent, and is operated to discharge the fire extinguishing agent by the compressed air, supplied from the air tank through the air hose, by the control signal. A spray nozzle assembly is connected to the fire extinguishing agent cylinder through a fire extinguishing agent hose and sprays the fire extinguishing agent being supplied, from the fire extinguishing agent cylinder, through the fire extinguishing agent hose.
US11590370B2
Systems and methods for treating skin and subcutaneous tissue with energy such as ultrasound energy are disclosed. In various embodiments, ultrasound energy is applied at a region of interest to affect tissue by cutting, ablating, micro-ablating, coagulating, or otherwise affecting the subcutaneous tissue to conduct numerous procedures that are traditionally done invasively in a non-invasive manner. Lifting sagging tissue on a face, neck, and/or body are described. Treatment with heat is provided in several embodiments.
US11590367B2
Disclosed herein are systems and methods for identifying radiation therapy treatment data for patients. A processor accesses a neural network trained based on a first set of data generated from characteristic values of a first set of patients that received treatment at one or more first radiotherapy machines. The processor executes the neural network using a second set of data comprising characteristic values of a second set of patients receiving treatment at one or more second radiotherapy machines. The processor executes a calibration model using an output of the neural network based on the second set of data to output a calibration value. The processor executes the neural network using a set of characteristics of a first patient to output a first confidence score associated with a first treatment attribute. The processor then adjusts the first confidence score according to the calibration value to predict the first treatment attribute.
US11590365B2
Disclosed is a bore based medical system comprising a camera carrier configured to be mounted in the bore based medical system and configured to monitor and/or track patient motion within said bore based medical system during radiotherapy, the bore based medical system comprising a rotatable ring-gantry configured to emit a radiotherapy beam focused at an iso-center of the bore based medical system, wherein the ring-gantry is configured to rotate at least partly around a through-going bore having a front side and a back side, configured to receive from said front side, a movable couch configured to be moved into and out from the through-going bore, wherein further the through-going bore comprises an inner side facing an inside of the bore, and wherein the camera carrier is configured to be mounted inside the bore in connection with the inner side of the through-going bore.
US11590339B2
Device and method for controlled and monitored transdermal delivery of active agents and use thereof
An iontophoretic patch for transdermal delivery of biologically active agents includes at least two electrodes in contact with at least two hydrogel reservoirs. At least one of the hydrogel reservoirs carries at least one active agent and, in use of the iontophoretic patch, is disposed on a user's skin and delivers at least one active agent into the skin. The patch includes a control unit to generate a stimulation pattern having stimulation parameters delivered to stimuli locations on the skin. A stimulation unit generates a time sequence of pulses from the stimulation parameters generated by the control unit. The patch further includes a demultiplexing unit configured to perform independent spatio-temporal distribution of the electrical pulses in the time sequence of pulses to at least one electrode; at least one optical sensing system, for continuously measuring an amount of the active agent in the hydrogel reservoir; and a feedback unit.
US11590335B2
Devices and methods for sterilizing the outer and inner surfaces of a working end-site of a medical device such as a catheter hub, luer connector, luer component, needleless access site, and/or access port are discussed. The sterilizing device can include a housing, a sterilizing element including an antipathogenic agent configured for sterilizing the working end-site of a medical device, and a cap hingedly coupled to the housing and configured to hermetically seal the sterilizing element within the housing. One or more features on the cap and housing serve to hermetically seal the cap to the housing prior to use.
US11590333B2
A tubular coupling comprising a first connector comprising a body defining a first passageway portion and a valve area, the valve area comprising a first volume adjacent to an end of the first passageway portion; and a second volume in fluid communication with the first volume; and a first valve disposed in the first volume of the valve area; and a second connector adapted to receive at least a portion of the first connector, the second connector comprising: a body defining a second passageway portion and a valve area, the valve area comprising: a first volume adjacent to an end of the second passageway portion; and a second volume in fluid communication with the first volume; and a second valve disposed in the first volume of the valve area.
US11590325B2
The utility model discloses a urinary catheter for women and peristaltic pump, which comprises a body tube with an inner surface and an outer surface, and further comprises an external urethral orifice fixing part which can at least sleeve the catheter tip end inside when applied, a flexible urethral guide part, a urinary catheter driving part sleeved with the cylindrical body of the external urethral orifice fixing part, a hydrophobic part for leakage stop at the urinary outlet of the urinary catheter, a thin segment, a pump tube, a tube bed and other special structures for dilating the narrowed part of the urethra, which not only eliminate the defect of the traditional “non-guided suspended placement” in a safe mode of “US-guided adjacent placement” and completely avoid contamination of the urinary catheter by the periurethral tissue, but also avoid the injury of urethral intima caused by urethral stricture in the placement procedure to the greatest extent; avoid contamination of the urinary catheter outlet by urine outflow; effectively clear the blockage of urine inlet due to blood clots and tissue masses in bladder during indwelling, and can also minimize the residual urine volume when used in conjunction with a special peristaltic pump.
US11590322B2
Systems and methods for positioning a wire for advancement through a vessel wall, and advancing it through one or more vessel walls, generally include a delivery catheter and an alignment catheter or a receiving catheter, and a guidewire. In some variations, the systems and methods may be used to bypass an occlusion or other barrier that may prevent advancement of a wire or tools through an endoluminal space. In these variations, the systems and methods include a delivery catheter, a bypass catheter, a receiving catheter, and a guidewire. The delivery and receiving catheters each generally include a side aperture, a deflection surface, and an alignment element, and the bypass catheter generally includes two side apertures, two deflectors, and two alignment elements. In some variations, the systems and methods may assist in treatment of a patient suffering from critical limb ischemia.
US11590311B2
A headgear assembly includes a strap of a first flexible material with an elongate edge, and a second flexible material folded around and running along the elongate edge. The second flexible material may be an elastic material. The second flexible material may also cover an intersection or joint in the first flexible material such that the first flexible material may be made from two flexible materials layered together or joined end to end.
US11590310B2
A patient interface for treating sleep disorder breathing includes a textile tube that also provides support for the seal forming structure. The textile tube includes an inner and outer layer that are joined along seams to form an air chamber or passageway. The textile tube can be pre-shaped so that the textile tube resiliently returns to a pre-determined shape prior to the introduction of pressurized air.
US11590309B2
An interface device is structured to be connected in fluid communication with a source of breathing gas and to provide a flow of breathing gas to the airways of a patient. The interface device includes a support (24), a deformable portion (28) situated on the support, and an interface portion (32) situated on the deformable portion and being structured to be engaged with the patient in the vicinity of the airways, with the deformable portion including a plurality of deformable elements (36) that form a lattice structure and that are connected with the support at a plurality of spaced apart points of connection (44) on the support. The interface device may be formed via an additive manufacturing process.
US11590298B2
An inhaler for facilitating inhalation of dry powder includes a body defining an interior space and a mouth piece. At least one annular member is positioned within the interior space and is rotatable with respect to the mouth piece. The at least one annular member includes a plurality of compartments. Each compartment defines a cavity configured to hold dry powder. Each compartment includes at least one flap and an opening configured to release the dry powder when the at least one flap is reconfigured from a closed position to an open position. The at least one flap covers the opening and inhibits the dry powder from being released from the cavity in the closed position.
US11590297B2
A dry powder inhaler with a blister folding device can include a housing to receive a single blister containing a dose of medicament for inhalation by a user, and a mouthpiece through which a dose of medicament is inhaled by a user and a blister opening device. The blister opening device can include a blister support element for supporting a blister containing a dose of medicament for inhalation by a user, and a blister folding element co-operable with the blister support element. The blister folding element and the blister support element can be movable relative to each other between a first position, for insertion of the blister into or onto the blister support element, and a second, burst, position in which the blister folding element has co-operated with the blister support element.
US11590276B2
A rectal drainage appliance is disclosed comprising a tubular element having an inflatable balloon at a distal end for anchoring the appliance in the rectum. The appliance includes one or more of: (i) first and second auxiliary lumens communicating with the inflatable balloon to provide independent inflation and pressure monitoring paths coupled to the balloon; (ii) a pressure state indicator defined by a mechanical element configured to flip between first and second states or shapes responsive to sensed pressure; and (iii) a collapsible auxiliary lumen larger than the inflation lumen, and configured to permit admission of irrigation fluid. The pressure state indicator may also be used in intestinal drains.
US11590269B2
An apparatus for ultrafiltration of a patient being overhydrated due to congestive heart failure, comprising a tube set including a connector (21) for connection to a patient line (3) for access to the peritoneal cavity of the patient. A flow pump (41-43) is arranged for addition and removal outflow and inflow (recirculation) of fluid from/to the peritoneal cavity. An osmotic agent peristaltic pump (16) is arranged for replenishment of glucose solution to the fluid added to the peritoneal cavity for promoting ultrafiltration. The glucose is replenished intermittently for keeping a concentration of glucose substantially constant in the peritoneal cavity. The flow pump comprises a pressure chamber (43) with rigid walls and a flexible pump bag (41) arranged therein. An air pump (45) pressurizes the chamber for outflow of fluid from the peritoneal cavity by a sub pressure and inflow of fluid to the peritoneal cavity by an overpressure, which pressures are maintained within safe limits.
US11590266B2
The invention relates to biodegradable iron alloy-containing compositions for use in preparing medical devices. In addition, biodegradable crystalline and amorphous compositions of the invention exhibit properties that make them suitable for use as medical devices for implantation into a body of a patient. The compositions include elemental iron and one or more elements selected from manganese, magnesium, zirconium, zinc and calcium. The compositions can be prepared using a high energy milling technique. The resulting compositions and the devices formed therefrom are useful in various surgical procedures, such as but not limited to orthopedic, craniofacial and cardiovascular.
US11590263B2
The invention relates to a porous osteoinductive calcium phosphate material having an average grain size in a range of 0.1-1.50 μm, having a porosity consisting essentially only of micropores in a size range of 0.1-1.50 μm, and having a surface area percentage of micropores in a range of 10-40%.
US11590245B2
A method of passively detecting radiofrequency (RF) signals spontaneously emitted by a non-equilibrium population of electrons that are spin polarized by flowing through a chiral media during relaxation of the spin polarized electrons to equilibrium at a frequency corresponding to a Zeeman spin-flip energy of the spin polarized electrons under influence of a magnetic field (MF). The MF is applied to the chiral media for a predefined time period to shift a frequency and magnitude of the spontaneously emitted RF signals in line with Zeeman effect. The shifted emitted RF signals is passively detected and stored for medical use applications using a receiver antenna tuned to a resonant frequency of the shifted emitted RF signals.
US11590239B2
The present invention concerns novel and improved antibody-conjugates for targeting CD30. The inventors found that when antibody-conjugates were prepared using a specific mode of conjugation, they exhibit an improved therapeutic index. The mode of conjugation comprises a first step (i) of contacting a glycoprotein comprising 1-4 core N-acetylglucosamine moieties with a compound of the formula S(F1)x-P in the presence of a catalyst, wherein S(F1)x is a sugar derivative comprising x functional groups F1 capable of reacting with a functional group Q1, x is 1 or 2 and P is a nucleoside mono- or diphosphate, and wherein the catalyst is capable of transferring the S(F1)x moiety to the core-GlcNAc moiety, to obtain a modified antibody; and a second step (ii) of reacting the modified antibody with a linker-conjugate comprising a functional group Q1 capable of reacting with functional group F1 and a target molecule D connected to Q1 via a linker L2 to obtain the antibody-conjugate wherein linker L comprises S—Z3-L2 and wherein Z3 is a connecting group resulting from the reaction between Q1 and F1. The invention also relates to a use for improving the therapeutic index of an antibody-conjugate and to a method for targeting CD30-expressing cells.
US11590236B2
Disclosed are methods and compositions for repolarizing a tumor associated macrophage (TAM) from M2 to M1 comprising administering to a subject in need thereof an effective dose of a compound comprising a dextran backbone and one or more CD206 targeting moieties conjugated thereto. In certain aspects, the compound further comprises a therapeutic agent selected from: paclitaxel, gemcitabine, lapatinib, and doxorubicin. In further aspect, the therapeutic agent comprises a chelator and at least one metal ion. In certain implementations, the at least one metal ion comprises at least one Cu(II) ions.
US11590224B2
Provided herein are antigen-binding proteins (ABPs) that selectively bind to TIGIT and its isoforms and homologs, and compositions comprising the ABPs. Also provided are methods of using the ABPs, such as therapeutic and diagnostic methods.
US11590217B2
Cancer is treated via a coordinated treatment regimen that use various compounds and compositions that employ prime-boost vaccination in combination with immune modulatory treatment and biasing of an immune response towards a Th1 profile.
US11590213B2
Nanoparticles to treat autoimmune diseases and HIV infection are provided. The nanoparticles comprise a biocompatible polymer and a complex, wherein the complex is a major histocompatibility complex (MHC) class I antigen E (HLA-E) linked to a peptide, and wherein the HLA-E-peptide complex is linked to the surface of the nanoparticle. The present invention also relates to methods for treating autoimmune diseases and HIV infection.
US11590209B2
The present invention relates to formulations and methods for treatment of sexual dysfunction in females diagnosed with both sexual dysfunction and controlled hypertension.
US11590201B2
In certain aspects, the present disclosure relates to the insight that a polypeptide comprising a truncated, ligand-binding portion of the extracellular domain of endoglin (ENG) polypeptide may be used to treat fibrotic disorders.
US11590199B2
Disclosed herein is a use of an adenosine triphosphate (ATP) binding cassette (ABC) transporter peptide inhibitor HX-12C. This disclosure also discloses a method of treating a tumor with multidrug resistance mediated by the ABC transporter using a combination of the peptide HX-12C shown in SEQ ID NO: 1 and an ABC transporter substrate chemotherapeutic drug. Moreover, this disclosure also provides a composition for treating a tumor with multidrug resistance mediated by an ABC transporter, consisting of the peptide HX-12C shown in SEQ ID NO: 1 and an ABC transporter substrate chemotherapeutic drug.
US11590196B2
Disclosed herein are polypeptides and fusion polypeptides that have anti-angiogenic activity that can be used to inhibit tumor growth and tumor metastasis. The polypeptide consists of 9 or less consecutive amino acid residues (e.g., 8, 7, 6, 5, or 4) comprising the active core amino acid sequence DWLP, or an amino acid substitution variant thereof. Specific amino acid substitutions are disclosed herein. In some embodiments, the peptide consists essentially of 4-6 mers identified as exhibiting the activity of prosaposin A. Also disclosed herein are therapeutic compositions comprising the polypeptides and fusion polypeptides, and their use in the treatment, prevention, and inhibition of angiogenesis-related diseases and disorders such as cancer and cancer metastasis.
US11590195B2
An improved plant medicament composition, comprising an extract of Sorghum bicolor plant material for treating sickle cell disease is described. A method for the preparation of said composition having the property of inhibiting sickle cells is also provided.
US11590190B2
Various embodiments of the invention relate to compositions comprising vitamins, minerals and trace elements, antioxidants, amino acids, probiotics, and other components and methods for using such compositions to treat or prevent diseases associated with oxidative stress, including cardiovascular disease.
US11590178B2
The present invention discloses application of a bile acid composite bacterial agent in the preparation of feed additives for mutton sheep. The bile acid composite bacterial agent comprises Parabacteroides distasonis bacterial suspension and bile acid, and the Parabacteroides distasonis bacterial suspension is obtained by cultivation and fermentation of Parabacteroides distasonis LCG-06 with the deposit number CGMCC No. 20820. The bile acid composite bacterial agent of the present invention has natural components and has no toxic and side effects, and can significantly increase the growth rate of mutton sheep and promote nutrition absorption, accelerate the decomposition of in vivo fat of mutton sheep, thereby reducing the body fat percentage of mutton sheep, increasing the slaughter weight and slaughter rate of mutton sheep, increasing the incomes for breeding of mutton sheep. Therefore, it has broad application prospects.
US11590174B2
Disclosed herein is a method for treating an osteoarthritis in a subject in need thereof. The method mainly includes administering to the subject an effective amount of isolated mitochondria. According to some embodiments of the present disclosure, the isolated mitochondria are administered to the subject in need in the amount of about 1 mg/kg to about 100 mg/kg.
US11590173B2
This invention provides a fluid therapeutic placental product comprising placental cells and a placental dispersion comprising placental factors. The placental cells and the placental dispersion are derived from placental tissue. A placental tissue can optionally be an amnion, chorion, or a trophoblast-depleted chorion. The placental product of the present invention is useful in treating a patient with a tissue injury (e.g. wound or burn) by applying the placental product to the injury. Similar application is useful with ligament and tendon repair and for engraftment procedures such as bone engraftment.
US11590166B2
The present invention relates to a pharmaceutical composition which contains activated charcoal, Carum carvi extract, papain and, optionally, α-galactosidase and β-galactosidase for the treatment of gastrointestinal disorders.
US11590165B2
The present invention generally relates to liquid compositions and methods for treating oral inflammation by administering a liquid composition to the oral cavity. The liquid composition is prepared from a powder containing calcium glycerophosphate, one or more sodium phosphate salts, sodium chloride, and optionally sodium bicarbonate and silica. The powder is mixed with a quality of water to form a liquid that is supersaturated with calcium ions and phosphate ions and is essentially free of visible particles and precipitate.
US11590164B2
The present invention relates to antimicrobial formulations. More particularly, the invention relates to monovalent copper-containing and/or monovalent copper-generating products for healing wounds and burns, and particularly for chronic wounds, prevention of wound infections and infections in various implants as well as medical/surgical devices.
US11590154B2
A fixed-dose combination drug product formulated for oral delivery comprises a fixed 158.3 mg dose of clarithromycin, a fixed 13.3 mg dose of clofazimine and a fixed 40.0 mg dose of rifabutin. The fixed-dose combination drug product is sufficiently designed for use in treating pulmonary Mycobacterium avium Complex (MAC) disease in a subject in need thereof. A method for treating MAC disease in a human having MAC lung infection comprising orally administering, twice daily, about 475 mg of clarithromycin, about 40 mg of clofazimine and about 120 mg of rifabutin. A kit for treating pulmonary MAC disease in an individual having MAC lung infection comprises a supply of fixed-dose combination drug products, wherein each of the fixed-dose combination drug products comprise a fixed 158.3 mg dose of clarithromycin, a fixed 13.3 mg dose of clofazimine and a fixed 40.0 mg dose of rifabutin; and instructions for use.
US11590150B2
The present disclosure relates to a pharmaceutical composition for preventing or treating statin-induced adverse effects or a pharmaceutical composition for co-administration with statin, the pharmaceutical composition containing, as an active ingredient, at least one selected from the group consisting of an isoprenoid-based compound, zaragozic acid, terbinafine, and ketoconazole. The pharmaceutical composition according to the present disclosure may prevent and/or treat adverse statin effects that can be induced by statin, that is, can be induced at any time by oxisterols present at abnormal levels in the body. The pharmaceutical composition can not only treat but also prevent the adverse effects of various statin therapeutics whose use has recently increased rapidly, and thus it is expected that the pharmaceutical composition can be widely used for various diseases and the utilization thereof can further be increased.
US11590141B2
The present invention provides a prophylactic or therapeutic agent for hypoxic injury, ischemia-reperfusion injury or inflammation, an agent for protecting cells for transplantation, and an agent for preserving organism. A prophylactic or therapeutic agent for hypoxic injury, ischemia-reperfusion injury or inflammation, an agent for protecting cells for transplantation, or an agent for preserving organism, containing, as an active ingredient, at least one kind selected from a heterocyclic compound represented by the formula (I) wherein each symbol is as described in the DESCRIPTION, or a salt thereof; an isothiocyanate compound represented by the formula S═C═N—R5 (II) wherein the symbol is as described in the DESCRIPTION; and a TRPA1 agonist.
US11590139B2
Provided herein are Aminopurine Compounds having the following structures: wherein R1, R2, and R3 are as defined herein, compositions comprising an effective amount of an Aminopurine Compound, and methods for treating or preventing a cancer, for example, melanoma.
US11590134B2
Described herein are compounds that are inhibitors of autophagy and their use in the treatment of disorders such as cancers.
US11590131B2
The disclosure relates to methods for treating galactosemia and manifestations of galactosemia using aldose reductase inhibitors.
US11590126B2
Compounds of Formula (I) are provided herein. Such compounds, as well as pharmaceutically acceptable salts and compositions thereof, are useful for treating diseases or conditions, including conditions characterized by excessive cellular proliferation, such as cancer and tumors, as well as viral infections such as HIV.
US11590124B2
Dosage forms, drug delivery systems, and methods related to sustained release of dextromethorphan or improved therapeutic effects are disclosed. Typically, bupropion or a related compound is orally administered to a human being to be treated with, or being treated with, dextromethorphan.
US11590122B2
Pharmaceutical compositions are provided, which comprise cabozantinib or pharmaceutically acceptable salts thereof, and at least one pharmaceutically acceptable excipient, wherein the inventive compositions exhibit enhanced bioavailability compared to the currently marketed or commercially available formulations. The present invention also provides manufacturing processes thereof and use of the said inventive compositions for the prevention, treatment or prophylaxis of disorders in human patients in need thereof. The present invention relates to oral pharmaceutical compositions of cabozantinib, methods for their administration, processes for their production, and use of these compositions for treatment of diseases treatable by cabozantinib.
US11590112B2
The invention provides a p38 MAPK inhibitor of Formula I, or a pharmaceutically acceptable salt or solvate thereof: Formula I for use in the treatment or prevention of hypercytokinemia in a human patient; wherein R is C1-3alkyl, optionally substituted by one or more halo, NR1R2 or hydroxy, and R1 and R2 are independently H, halo or C1-3alkyl, optionally substituted by one or more F. Also provided are compositions for use in the treatment or prevention of hypercytokinemia comprising the p38 MAPK inhibitor of Formula I; and methods for treating or preventing hypercytokinemia in a human patient in need thereof comprising administering to the patient a therapeutically or prophylactically effective amount of a p38 MAPK inhibitor of Formula I. The invention also provides a p38 MAPK inhibitor and an antimicrobial agent, such as an antiviral agent, for use in the treatment or prevention of hypercytokinemia.
US11590102B2
The present invention relates to, in part, methods for the treatment of methanogen-associated disorders such as, for example, Irritable Bowel Syndrome (IBS) using at least one anti-methanogenic lovastatin analog or derivative. In addition, modified-release formulations comprising at least one anti-methanogenic lovastatin analog or derivative are provided which release the anti-methanogenic lovastatin analog or derivative in the gastrointestinal tract.
US11590095B2
Described herein are pharmaceutical compositions comprising fumarate esters, methods for making the same, and methods for treating subjects in need thereof. In particular, oral controlled release pharmaceutical compositions comprising fumarate esters suspended in liquid matrices are described. One embodiment described herein is a pharmaceutical composition comprising fumarate esters suspended in a lipid or lipophilic liquid with enhanced bioavailability.
US11590094B2
Fixed-dose combination drugs comprising an NSAID as a first drug component and a GABA-type calcium channel blocker as a second drug component are contemplated. Further contemplated aspects also include methods of administration of combination drugs and drugs contained herein.
US11590093B2
Described herein are kits, compositions, and combination therapies comprising sulindac for use in the treatment of fragile X syndrome (FXS).
US11590090B2
An oral pharmaceutical dosage form that comprises both acetaminophen and a glutathione replenishing agent, such as N-acetylcysteine. This allows co-administering the glutathione replenishing agent along with acetaminophen, which may be beneficial in rapidly counteracting the toxic effects of acetaminophen overdose. The oral dosage form could be in the form of a tablet or capsule. The dosage form may be designed to compartmentally separate the glutathione replenishing agent from having chemical interaction with the acetaminophen. The dosage form may be designed to mask the taste or smell of the glutathione replenishing agent.
US11590077B2
The present disclosure provides methods of treating breast cancer including administering aqueous suspensions comprising solubilized fulvestrant, non-solubilized fulvestrant particles having one or more of an LD Dv(10) between about 1.5 and about 2.1 microns, an LD Dv(50) between about 5.5 and about 9.0 microns, and an LD Dv(90) between about 15 and about 35 microns, with the aqueous suspensions further including a surfactant, a polyvinylpyrrolidone, and a sugar alcohol, and a water-soluble excipient. The water-soluble excipient can be an aryl-Ci-6alk-OH, a Ci-6alkyl-OH, a buffering salt, a polysorbate, a polyalkylene glycol, a Ci-i2alkylene glycol, a phosphatidylcholine, or a combination thereof.
US11590075B2
The present disclosure relates to methods and products for reducing adhesions. In certain embodiments, the present disclosure provides a method of reducing adhesions in a subject, the method comprising exposing a region in the subject susceptible to formation of an adhesion to an agent having iron chelation and/or antioxidant activity, thereby reducing adhesions in the subject.
US11590064B2
The present invention provides an anhydrous, sprayable sunscreen composition comprising one or more oil soluble UV filters and a combination of film formers comprising at least one copolymer of trimethylolpropane, adipic acid, neopentyl glycol and hexanediol and at least one acrylates/octylacrylamide copolymer having a molecular weight of at least 50 kDA measured using Dynamic Light Scattering.
US11590060B2
An emesis containment system is configured to attach to the face of a wearer in order to contain emesis ejected from the wearer's mouth and/or nose without necessitating the wearer, or any other party, to use their hands to hold, guide, or otherwise interact with the system during use. The emesis containment system comprises a rigid or semi-rigid mask configured to attach to the user's face and a flexible bag attached to the mask. The system including the mask and flexible bag move with the wearer's head, and emesis ejected from the wearer's mouth and/or nose is directed into the flexible bag.
US11590059B2
A feeding bottle has a first layer and optionally a second layer. The feeding bottle offers an improved user experience by mitigating against spills, leaks, improving feeding comfort, or offering information to the user about the feeding environment. The feeding bottle has a reusable liner that is compatible with breast pumps. The liner stores fluid such as breast milk in the freezer. The liner is adaptable to feeding bottle holders, collars, and/or nipples and thus facilitates feeding infants. The liner is adaptable to breast pumps, a liner cap, and one or more of a bottle holder, collar and nipple, such that the liner offers a pump, store, feed solution that is reusable and simplifies the number of parts required for any/all of pumping, storing and feeding activities.
US11590057B2
An example of an electronic medical fluid transfer device can comprise a fluid transfer module with a multidirectional flow control valve and an intermediate container or pumping region, a sensor configured to detect whether at least one of a vacuum or gas is present in the fluid transfer module, a first electromechanical driver configured to interface with and control the multidirectional flow control valve on the fluid transfer module, a second electromechanical driver configured to be mechanically linked to and control the intermediate container or pumping region according to an operational parameter, and one or more computer processors configured to communicate electronically with the sensor and the first and second electromechanical drivers to determine the operational parameter based on a flow characteristic of medical fluid to be transferred and adjust the operational parameter based on output of the sensor.
US11590053B2
A system for managing treatment of a person in need of emergency assistance is provided. The system includes at least one camera configured to be mounted to a person in need of medical assistance. The system also includes an image processing device, which can be configured to receive images captured by the at least one camera and to process the images to generate a representation of a rescue scene surrounding the person. The system further includes an analysis device. The analysis device can be configured to determine a characteristic associated with a resuscitation activity based on analysis of the representation of the rescue scene generated by the image processing device. A computer-implemented method for managing treatment of a person in need of emergency assistance is also provided.
US11590049B2
The present invention relates to a movement-dependent stabilisation support system (100) for stabilising a moving body (200), which comprises a plurality of sensors (110), a plurality of actuators (120) and a control unit (130). The plurality of sensors (110) continuously detects movement parameters of the body (200), on which basis the control unit (130) determines whether there is an instability of the body (200). If it is determined that there is an instability, the control unit (130) selects a stabilisation strategy, according to which the actuators (120) are controlled. When controlled, the actuators (120) attached to the body (200) stiffen and limit the freedom of movement of the body (200), such that a movement in the direction of the imminent unstable state is prevented or suppressed. In this way, the body (200) is supported in its stabilisation and an imminent fall is prevented.
US11590046B2
A flexible anchor member comprising a member for placement about a body part; at least one substantially inextensible textile element circumscribing the member and secured to itself or the member; and a force transfer coupler coupling a portion of the at least one substantially inextensible textile element to an actuator such that the substantially inextensible textile element constricts about the member for a duration of an applied force. Another flexible anchor member comprising an outer member including a substantially inextensible textile material configured for directing a force applied by an actuator to act upon all or a portion of the body part; an inner member for positioning between the body part and the outer member, a first surface of the inner member configured for frictionally engaging the body part or intervening clothing; and at least one coupler for coupling the outer member and the inner member.
US11590042B2
A novel technique for the fabrication of a casket dome lid from, for example, Smooth-One-Side (“S1S”) hardboard is disclosed. The invention is also directed to the fabrication of a casket lid which has a domed configuration both in the lateral and longitudinal directions of the lid. The method comprises the steps of providing a lid blank having a first end, second end, and a central region; providing a pair of diagonal voids oriented at corners of the first end of said blank and extending inward toward the central region; placing the lid blank in a vacuum fixture; and flexing the lid blank into a domed configuration via the vacuum fixture, such that the blank is domed in both a longitudinal and a transverse direction.
US11590041B2
An apparatus and method for maintaining a patient in the prone position while maintaining access to the patient's oral airway. The apparatus includes a body portion which in turn has a plurality of segments, each of which may accommodate a number of inserts therein as determined by the relative size of the patient. The segments may be selectively joined together approximately midway along the body portion and the inserts disposed therein may be independently adjusted so as to raise the patient's chest and hips off of a surface. The distal ends of the same segments may also be joined together to further form a head rest which maintains the patient's head and face off of the surface, thereby permitting access to the patient's oral airway even when the patient is lying face down. The inserts are removable and may be stored separately from the body portion when not in use.
US11590039B1
A propulsion assist device for a wheelchair having a hand rim slideably housed inside a channel of a frame pivotably connected to a lever arm. The frame is further comprised of a portion of grip material positioned inside the channel along an underside of a top of the frame. When a pair of devices are installed on a pair of hand rims of the wheelchair, the wheelchair is moved forward by a coordinated rowing motion of both lever arms forwards and then backwards along the hand rim. The pivoting motion of the frame causes the grip material sandwiched between the frame and the hand rim to pressure grip the hand rim and turn it when a user moves the lever arms through their rowing motion. Repositioning the frame along the hand rim causes the gripping material to release and slide along the hand rim before repositioning.
US11590034B2
Reusable absorbent accessories are configured to be worn by a wearer, are configured to be washed and re-worn numerous times, and comprise adhesive bonds within a bonded region; a base; a moisture capture assembly bonded to the base within the bonded region and comprising a moisture retention portion configured to absorb and retain moisture from the wearer, and an anti-leak portion configured to restrict moisture from exiting the moisture retention portion and positioned toward the assembly exterior side of the moisture capture assembly relative to the moisture retention portion.
US11590021B2
An apparatus for providing prolonged topical cooling to the external female genitalia as a therapeutic benefit to and relief from female itching and burning is disclosed as a lightweight, portable cooling unit in combination with one or more labial inserts which are specifically designed to conform to the user's anatomy. The cooling unit is typically a container capable of both cooling and transporting the labial inserts during travel, and providing easy access to relief when needed by the user. A cooled labial insert can be applied to the external female genitalia for treatment of the acute symptoms associated with vulvar inflammation and irritation. The inventive apparatus can maintain a cooling temperature to the affected area for an extended period of time, limited only by the life of the cooling power source. The labial inserts can be worn in public with minimum disruption to the user's clothing and mobility.
US11590020B2
The present invention relates to methods for use in the selective disruption of lipid-rich cells by controlled cooling. The present invention further relates to a device for use in carrying out the methods for selective disruption of lipid-rich cells by controlled cooling.
US11590015B2
Disclosed is a base plate, a sensor assembly part and a method for manufacturing of a base plate or a sensor assembly part. The method comprising: positioning a coupling part; positioning an electrode assembly; providing one or more terminal elements; positioning the one or more terminal elements; securing the one or more terminal elements, by securing the distal part of each of the one or more terminal elements to the coupling part and positioning the proximal part of each of the one or more terminal elements to contact respective connection parts of the one or more electrodes, wherein after securing the one or more terminal elements, the terminal element bend of each of the one or more terminal elements forms a second angle, the second angle being less than the first angle.
US11590013B1
The present disclosure provides a brace system including an upper portion and a lower portion. The brace system may also include a first pulley rotatably coupling the upper portion to a first intermediate link positioned between the upper portion and the lower portion. The brace system may also include a second pulley rotatably coupling the first intermediate link to a second intermediate link positioned between the upper portion and the lower portion. The brace system may also include a third pulley rotatably coupling the second intermediate link to the lower portion. Further, the brace system may include at least one tension-bearing element substantially encircling each of the first pulley, the second pulley, and the third pulley.
US11589997B2
Described here are systems and methods for positioning a surgical implant, such as a glenoid component, or other medical device intra-operatively. In general, the systems and methods described in the present disclosure implement a computer vision system, which may be a structured light computer vision system, together with a suitable optical tracker as an accurate intra-operative tool for predicting post-operative implant position in surgical procedures.
US11589989B2
In one embodiment, a method of repairing a heart valve accesses an interior of a patient's beating heart minimally invasively and inserts one or more sutures into each of a plurality of heart valve leaflets with a suturing instrument. The suture ends of the sutures are divided into suture pairs, with each pair including one suture end from a suture inserted into a first valve leaflet and one suture end from a suture inserted into a second valve leaflet. One or more tourniquet tubes is advanced over the suture pairs to the leaflets to draw the sutures together to coapt the leaflets and then the sutures are secured in that position.
US11589985B2
Apparatus and methods are described herein for use in the transfemoral delivery and deployment of a prosthetic mitral valve. In some embodiments, a method includes inverting an outer frame of a prosthetic mitral valve when in a biased expanded configuration. After inverting the outer frame, the prosthetic mitral valve is inserted into a lumen of a delivery sheath such that the mitral valve is moved to a collapsed configuration. The delivery sheath is inserted into a femoral vein and moved through the femoral vein and a septum of a heart until a distal end of the delivery sheath is disposed in the left atrium of the heart. The prosthetic mitral valve is moved distally out of the delivery sheath such that the inverted outer frame reverts and the prosthetic mitral valve assumes its biased expanded configuration. The prosthetic mitral valve is then positioned within a mitral annulus of the heart.
US11589979B2
An intraocular lens includes an optical body having a geometric center point through which a longitudinal axis extends and a second main axis extends as a transverse axis. The transverse axis is perpendicular to the longitudinal axis. A flat first and a second haptic body are each adjacent to the optical body. The first and second haptic bodies are arranged point-symmetrically to the geometric center. An outer radius of the intraocular lens about the geometric center and a radial distance from the geometric center to an intersection point of the transverse axis with a circumferential line of the intraocular lens have a ratio to one another from 1:0.5 to 1:0.9. The first haptic body has a recess on the left of the longitudinal axis and another recess on the right thereof. The two recesses each have a length and a width, the length being greater than the width.
US11589977B2
The present invention relates to a kit for preparing a customizable flesh simulating silicone gel or a flesh simulating silicone foam in particular for use in medical devices and a process for preparing said customizable flesh simulating silicone gel or silicone foam, in particular by using a 3D-printer.
US11589975B1
A small diameter vascular prosthesis includes an outer textile graft, an intermediate self-supporting coil or stent and an inner microporous layer. The outer textile graft allows for tissue ingrowth. The inner microporous layer provides blood impermeability without preclotting the prosthesis. The coil or stent provides kink resistance and resistance again collapsing of the outer textile graft and the inner microporous layer.
US11589974B2
The invention relates to a prosthesis (1) for the repair of an inguinal hernia comprising: a textile (2) of elongate shape, a resilient frame (3) connected to said textile, characterized in that said frame comprises a convex cranial segment (3c), a caudal segment (3d), a lateral corner segment (3b) joining together the convex cranial segment and the caudal segment, and a folding segment (5) joining a medial end of said convex cranial segment to a point located on the caudal segment while leaving the region of the medial end of the textile free of any frame, said frame being able to adopt an unstressed configuration, in which said textile is deployed, and a stressed configuration, in which said convex cranial segment, said caudal segment and said folding segment are substantially collected together and aligned on one folding direction, said textile forming thereby at least one fold along said folding direction.
US11589973B2
Implantable medical constructs formed by winding using winding support structures that can be flexible and can be integrated into the medical construct with biocompatible fiber(s) and/or yarn(s) and at least one continuous length collagen fiber. The implantable medical construct can include open suture anchor apertures formed using posts during a winding sequence.
US11589971B2
The specification discloses a dental curing light including 1) a light engine, 2) a coaxially aligned, camera-based viewing system, and 3) a control system providing a variety of safety features and simplified, operator-friendly operation. The camera's field of view (FOV) is coaxial with the centerline of the curing beam of the light engine. The curing light includes a multi-planar dichroic mirror (MDM) providing viewing and light beam direction aligned with the target. The MDM provide multiple images to the camera from different angles. The camera provides real-time measurement of light intensity reflected back from the targeted surface. Using the multiple image portions reflected by the multi-planar dichroic mirror, the control system computes the distance between the curing light and the target. The reflected intensity and the calculated distance enable the control system to compute a light engine irradiance to achieve a desired irradiance at the targeted surface.
US11589960B2
Provided is a method of forming a customized alveolar bone tissue. The method includes obtaining first data having image information corresponding to an original alveolar bone of an alveolar bone defect, obtaining second data having image information on a defective portion of the alveolar bone defect, calculating third data having image information on a barrier membrane covering the alveolar bone defect by using the first data and the second data, and forming a barrier membrane artificial tissue corresponding to the barrier membrane by using the third data.
US11589953B2
The present disclosure is directed to tools, systems and methods for recontouring/reshaping gum tissue by engaging a consumable tip on a dental hand tool to abrade/ablate excess or mal-contoured gum tissue to allow better visualization of the tooth/implant structure and reduce the periodontal pockets to provide improved access for cleaning. In some embodiments, the dental hand tool may use vibrational movement, longitudinal reciprocating movement, rotational movement, reciprocating rotational movement, or a combination of any of the above movement schemes. In some embodiments, a consumable tip may be directed for cleaning tooth/implant surfaces and for recontouring/reshaping gum tissue.
US11589948B2
A hooked surgery camera for use in surgical robotic systems includes a hook coupled to a side or end of a camera body, for attaching the camera to tissue during a surgery. The camera also includes a lens on another end of the camera body, and electronic components inside the camera body. The electronic components include a battery, a digital camera module and a wireless data transmitter. The hooked surgery camera provides a supplementary view of the surgical site, that is from a different perspective than the view provided by an endoscope, during laparoscopic surgeries. Other aspects are also described and claimed.
US11589945B2
A surgical restraint is disclosed including a body strap, a sling, and a connecting strap. The body strap is arranged and disposed to wrap over patient's torso and around a support disposed below the patient, restraining the patient against the support. The sling is arranged and disposed to cradle an upper arm, an elbow and a forearm of a patient's arm. The connecting strap includes a first attachment site associated with a brace and a second attachment site associated with the sling. The connecting strap is arranged and disposed to cross over the patient's shoulder between the first attachment site and the second attachment site. The surgical restraint is arranged and disposed to restrain the patient's arm against the patient's torso and removed from a surgical site.
US11589942B2
A surgical instrument includes an end effector, a shaft assembly, and a torque wrench integrally connected with the shaft assembly. The shaft assembly has an acoustic waveguide extending therethrough and the end effector projects distally from the shaft assembly. The acoustic waveguide has a proximal end portion configured to rotatably couple with an ultrasonic transducer assembly. The torque wrench is configured to transmit torque applied to the acoustic waveguide up to a predetermined torque. A portion of the torque wrench is configured to deflect upon receipt of torque greater than the predetermined torque. Accordingly, the portion of the torque wrench slips relative to the acoustic waveguide for limiting coupling of the acoustic waveguide to the ultrasonic transducer assembly to the predetermined torque.
US11589936B1
A robotic surgical system is described. In some embodiments, the robotic surgical system includes a physician-side shaft controlled by a physician, the movement of which is tracked by a plurality of physician-side balls and transmitted to a plurality of patient-side balls, which in turn, move a patient-side shaft and attached surgical device, such as a stent retriever.
US11589923B2
A system and method for streamlining inventory and ordering for certain surgical supplies. The method includes scanning, by an imaging device, a surgical site and receiving, by a processor communicatively coupled to the imaging device, data from the scan. The method also includes the processor analyzing the data, where the analyzing includes searching the data to identify predefined key features in the data that are parameters utilized by a Statistical Shape Model (SSM). The processor applies the SSM to generate a three dimensional replica of a predetermined portion of the surgical site. The processor also defines, based on the replica, at last one of: surgical planes or orientations. The processor then utilizes the replica and the surgical planes or orientations to select a solution.
US11589920B2
Ablation catheters and systems include coaxial catheter shafts with an inner lumen for delivering an ablative agent and an outer lumen for circulation of a cooling element about the catheter. Induction heating is used to heat a chamber and vaporize a fluid within by wrapping a coil about a ferromagnetic chamber and providing an alternating current to the coil. A magnetic field is created in the area surrounding the chamber which induces electric current flow in the chamber, heating the chamber and vaporizing the fluid inside. Positioning elements help maintain the device in the proper position with respect to the target tissue and also prevent the passage of ablative agent to normal tissues.
US11589915B2
An ultrasonic device may include an electromechanical ultrasonic system defined by a predetermined resonant frequency, in which the system may include an ultrasonic transducer coupled to an ultrasonic blade. A method of estimating a state of an end effector of the ultrasonic device may include applying a drive signal defined by a magnitude and a frequency to the ultrasonic transducer, sweeping the frequency of the drive signal from below a first resonance to above the first resonance of the electromagnetic ultrasonic system, measuring and recording, impedance/admittance circle variables Re, Ge, Xe, and Be, comparing, the measured impedance/admittance circle variables Re, Ge, Xe, and Be to reference impedance/admittance circle variables Rref, Gref, Xref, and Bref, and determining, a state or condition of the end effector based on the result of the comparison. An electromechanical ultrasonic system may include a control circuit to effect the method.
US11589907B2
A bone screw comprising a shaft having a wall, the wall including a minor diameter and at least one thread having an external thread form. The thread form including a first portion comprising a crest of the thread form and a second portion extends between a minor diameter of the thread form and the first portion. The first portion having a solid configuration relative to the second portion. In some embodiments, systems, spinal constructs, surgical instruments and methods are disclosed.
US11589901B2
An external adjustment device for non-invasively adjusting an implant, the external adjustment device including a controller in communication with an actuator associated with the adjustable implant and a sensor configured to receive information from or about the adjustable implant. The external adjustment device may further comprise a power source and a display. According to one exemplary embodiment, the external adjustment device comprises a magnetic element configured to generate a rotating magnetic field; and a driver configured to drive the magnetic element to generate the rotating magnetic field and configured to rotate a permanent magnet of an adjustable implant, wherein upon placing the external adjustment device in proximity to an adjustable implant having a permanent magnet the magnetic element is configured to magnetically couple with the permanent magnet, and wherein the external adjustment device is configured to non-invasively determine one or more of a magnetic coupling state and a stalled state of the magnetic element and the permanent magnet disposed within the adjustable implant.
US11589900B2
Disclosed are improved devices, systems and methods for external fixation and/or support of damaged or fractured limbs or other anatomies of a patient.
US11589897B2
Various aspects of the present disclosure are directed toward introducer apparatuses, systems, and methods for positioning an implantable medical device within a patient. The introducer may include a housing having a proximal opening and a distal opening and configured to position the implantable medical device adjacent the distal opening prior to ejection and an ejection rod configured to pass through the proximal opening and eject the implantable medical device from the housing through the distal opening of the housing.
US11589894B2
A medical device is capable of aspirating an object in a body lumen, while preventing the retention of the object therein, and effectively discharging the object. The medical device includes: a rotatable drive shaft having a lumen; a cutting portion fixed to a distal portion of the drive shaft to cut the object; and a housing that contains a proximal portion of the drive shaft and has a discharge port through which the cut object is discharged. The drive shaft has a proximal opening portion that extends around a portion of a circumference of the drive shaft to expose a discharge opening. The discharge port includes a discharge hole through which the cut object discharged through the discharge opening of the proximal opening portion is discharged from the housing, and a guide surface that protrudes toward the proximal opening portion to guide the cut object into the discharge hole.
US11589887B2
A surgical apparatus comprises a body assembly, an ultrasonic transducer, a shaft assembly, a motor, and a locking feature. The ultrasonic transducer is operable to convert electrical power into ultrasonic vibrations. The shaft assembly comprises a waveguide operable to transmit ultrasonic vibrations. The motor is operable to rotate the ultrasonic transducer to thereby selectively couple the ultrasonic transducer with the waveguide. The locking feature is configured to selectively prevent rotation of at least a portion of the shaft assembly relative to the body assembly. The locking feature and the motor may be activated automatically in response to an operator positioning a proximal portion of the shaft assembly in a distal portion of the body assembly. The surgical apparatus may include a feature configured to alert a user when the waveguide has been adequately secured to the ultrasonic transducer.
US11589886B2
A cutting instrument comprising: an outer tube comprising a distal end and a proximal end; an inner tube rotatably disposed within said outer tube, said inner tube comprising a distal end, a proximal end and a region intermediate said distal end and said proximal end, said region comprising a plurality of slits formed in said inner tube so as to render said region of said inner tube flexible; and a bellows disposed adjacent to said plurality of slits so as to render said region of said inner tube fluid-tight.
US11589885B2
Systems and methods for treating tissue may include one or more delivery devices, a grasping element, a first ring for anchoring to a wall of a gastrointestinal tract, and a second ring operably couplable to a radially inward surface of the first ring. Other embodiments include methods of treating tissues, including tubular tracts of tissue, comprising coupling a first ring to first tissue of a wall of a tissue tract, relocating a target tissue proximally to a position proximal to the first ring, coupling a second ring to the first ring, and cutting tissue proximal to the interface of the first and second rings.
US11589881B2
A clot removal device for removal of an occlusion from a lumen in a patient's body is provided. The clot removal device has a lumen, an elongated member positioned within the lumen and extending axially from a proximal end to a distal end of the lumen, a handle attached to the proximal end of the lumen, a first expandable member positioned along a length of the elongated member, a second expandable member positioned along the length of the elongated member, wherein the second expandable member is distal to the first expandable member relative to the handle. The handle has at least one actuation mechanism and at least one of the following applies: a) the first expandable member is coupled to the at least one actuation mechanism and is configured to be moveable relative to the second expandable member upon manipulation of the at least one actuation mechanism; b) the first expandable member is configured to mechanically expand or contract by manipulating the at least one actuation mechanism; c) the second expandable member is coupled to the at least one actuation mechanism and is configured to be moveable relative to the first expandable member upon manipulation of the at least one actuation mechanism; or d) the second expandable member is configured to mechanically expand or contract by manipulating the at least one actuation mechanism.
US11589875B1
An endoscopic clip apparatus includes a clip sleeve defining an interior passage along a longitudinal axis and having a distal end with a plurality of openings defined in the distal end. A clip including a plurality of arms is disposed in the clip sleeve, and each arm includes a distal tip extending from the clip sleeve through one of the plurality of openings. Each arm includes a convex curved section oriented away from the longitudinal axis. The clip sleeve and clip are axially moveable relative to each other such that when the clip sleeve travels over the convex curved section of each arm toward the distal tip of each arm, each arm is constrained by the clip sleeve and each distal tip advances toward the longitudinal axis to grasp tissue.
US11589873B2
A system, device and method for left atrial appendage occlusion detection is disclosed. The system for occlusion detection comprises a sheath; a delivery system comprising: a delivery catheter extending between a proximal end and a distal end; and a handle coupled to the proximal end of the delivery catheter; a medical tool coupled to a distal end of the delivery catheter at a target location within a portion of an organ of a patient, the medical device comprising a hub including a bore defining an axis, an occluder portion coupled to the hub and an anchor portion extending between a first end and a second end; at least one pressure sensor configured to measure a pressure of the target cavity while blood is suctioned form inside the left atrial appendage; and at least one processor configured to process the pressure measurement acquired from the at least one pressure sensor.
US11589863B2
Systems and methods for controlling staple firing include an end effector, a drive system configured to apply a force or torque to cause staple firing to occur, and a processor. The end effector includes a first jaw and a second jaw holding staples. The processor is configured to monitor the applied force or torque to cause staple firing to occur and maintain application of clamping by the first jaw and the second jaw while suspending application of the force or torque that causes the staple firing, when the applied force or torque is outside an acceptable range of force or torque.
US11589860B2
A suture transport system is disclosure for placing a flexible member along a tunnel, the system including a means of transporting a flexible member along a tunnel from a first opening in the tunnel through to a second opening at an opposite end of the tunnel, such that the flexible member extends from both the first and second opening. The system also includes a means of capturing a portion of the flexible member at the second opening, to inhibit the flexible member from retracting into the tunnel second opening. The means of capturing includes an aperture for capturing the portion of the flexible member.
US11589853B2
The invention relates to a sealing device for repair of cardiac and vascular defects or tissue opening such as a patent foramen ovale (PFO) or shunt in the heart, the vascular system, etc. and particularly provides an occluder device and trans-catheter occluder delivery system. The sealing device would have improved conformity to heart anatomy and be easily deployed, repositioned, and retrieved at the opening site.
US11589841B2
The purpose is to provide an ultrasound imaging device capable of automatically detecting a boundary of a biological tissue in an ultrasound image. An ultrasound imaging device includes an image generation module which receives ultrasound waves transmitted from a surface of an analyte toward an inside of the analyte and reflected therein to generate an ultrasound image inside the analyte, a reference point setting module which sets a reference point of a tissue of interest of the ultrasound image, a first seed point imparting module which imparts one or more seed points to the ultrasound image with reference point, and a region demarcating module which demarcates a region to which the seed point belongs and divides an image region of the analyte included in the ultrasound image into a plurality of regions according to a type of tissue.
US11589835B2
Intraluminal ultrasound devices, systems and methods are provided. In one embodiment, an intraluminal ultrasound device includes a flexible elongate member configured to be positioned within a body lumen of a patient, the flexible elongate member including a distal portion and a longitudinal axis; and a transducer array disposed at the distal portion of the flexible elongate member and circumferentially positioned around the longitudinal axis of the flexible elongate member. The transducer array includes a plurality of micromachined ultrasound transducers (MUTs). In addition, the transducer array is configured to obtain ultrasound imaging data of the body lumen in response to a first electrical signal, and apply an ultrasound therapy within the body lumen in response to a second electrical signal.
US11589834B2
A deep neural network for metal artifact reduction is described. A method for computed tomography (CT) metal artifact reduction (MAR) includes generating, by a projection completion circuitry, an intermediate CT image data based, at least in part, on input CT projection data. The intermediate CT image data is configured to include relatively fewer artifacts than an uncorrected CT image reconstructed from the input CT projection data. The method further includes generating, by an artificial neural network (ANN), CT output image data based, at least in part, on the intermediate CT image data. The CT output image data is configured to include relatively fewer artifacts compared to the intermediate CT image data. The method may further include generating, by detail image circuitry, detail CT image data based, at least in part, on input CT image data. The CT output image data is generated based, at least in part, on the detail CT image data.
US11589825B2
Systems and methods for blood pressure estimation using smart offset calibration can include a computing device associating a calibration photoplethysmographic (PPG) signal generated from a first sequence of image frames obtained from a photodetector of the computing device with one or more measurement values generated by a blood pressure measurement device different from the computing device. The computing device can obtain a recording PPG signal generated from a second sequence of image frames obtained from the photodetector, and identify a calibration model from a plurality of blood pressure calibration models based on the calibration PPG signal and the recording PPG signal. The computing device can generate a calibrated blood pressure value using the recording PPG signal, features associated with the calibration PPG signal and the identified calibration model.
US11589820B2
Systems and methods for controlled sympathectomy procedures for neuromodulation are disclosed. A system for controlled micro ablation procedures is disclosed. A guidewire including one or more sensors or electrodes for accessing and recording physiologic information from one or more anatomical sites within the parenchyma of an organ as part of a physiologic monitoring session, a diagnostic test, or a neuromodulation procedure is disclosed. A guidewire including one or more sensors and/or a means for energy delivery, for performing a neuromodulation procedure within a small vessel within a body is disclosed.
US11589817B2
A contact lens according to an embodiment of the present disclosure includes: a lens section that is worn on an eyeball; an acquisition section that is provided in the lens section and acquires biological information; and an output section that outputs the biological information acquired by the acquisition section to an external apparatus to be worn on a human body. The output section has one or a plurality of coil antennas extending along a front surface of the lens section, and a capacitor that is coupled to the one or the plurality of coil antennas in series or in parallel.
US11589813B2
A garment (e.g., a shirt) for monitoring biometric properties of the wearer of the garment is disclosed. The garment may include sensors for monitoring or assessing the vital signs and body position of the wearer. A processor associated with the garment may provide an output indicative of an assessed condition of the wearer based on the assessed vital signs and the assessed body position of the wearer of the fabric. The garment may include an injector assembly that is used to administer a drug injection to the wearer when the assessed condition indicates that the wearer is in an alert condition.
US11589805B2
In some implementations, a mobile device can adjust an alarm setting based on the sleep onset latency duration detected for a user of the mobile device. For example, sleep onset latency can be the amount of time it takes for the user to fall asleep after the user attempts to go to sleep (e.g., goes to bed). The mobile device can determine when the user intends or attempts to go to sleep based on detected sleep ritual activities. Sleep ritual activities can include those activities a user performs in preparation for sleep. The mobile device can determine when the user is asleep based on detected sleep signals (e.g., biometric data, sounds, etc.). In some implementations, the mobile device can determine recurring patterns of long or short sleep onset latency and present suggestions that might help the user sleep better or feel more rested.
US11589804B1
Disclosed is a care device recommendation server providing a service for recommending a skin care device for a user, the care device recommendation server including: a data management unit configured to obtain face images of the user from a shin measurement device including a camera and a display; a skin condition determination unit configured to determine a first skin condition of the user corresponding to a first time point at which the face images are obtained, based on the obtained the face images; a care device recommendation unit configured to determine the skin care device for the user among a plurality of care devices included in a care device DB based on the determined first skin condition; a care device control value-providing unit configured to provide a first control value of the skin care device corresponding to the first skin condition to each of a user terminal of the user and the skin measurement device; a care device control unit configured to remotely control the care device such that the skin care device is driven by the control value; and a history provision unit configured to provide information about a previous skin condition of the user, which corresponds to each of the face images of the user obtained from the data management unit, to the user terminal.
US11589801B2
One aspect of the invention relates to a method for intraoperative assessment of parathyroid gland viability in a surgery. The method includes diffusing a beam of light onto a tissue surface of a parathyroid gland of a patient to illuminate the tissue surface; acquiring images of the illuminated tissue surface, where each of the acquired images includes a speckle pattern; and processing the acquired images to obtain speckle contrast images for the intraoperative assessment of parathyroid gland viability.
US11589795B2
A method includes receiving a bipolar signal sensed by a pair of electrodes at a location in a heart of a patient. One or more electrocardiogram (ECG) signals are received, sensed by body-surface electrodes attached to the patient. Two or more successive QRS complexes are identified in the bipolar signal. One or more activations are detected in the bipolar signal, which occur within a window-of-interest that begins at least a given time with respect to the identified QRS complexes. The detected activations are checked whether they are late potentials, by verifying whether (i) the activations do not coincide with a predefined event observed in the ECG signals, and (ii) the activations are repeatable in the successive QRS complexes. In response to deciding that at least one of the detected activations is a late potential, the latest of the at least one of the late potentials is visualized to a user.
US11589786B2
A syringe-based device includes a housing, a pre-sample reservoir, and an actuator. The housing defines an inner volume between a substantially open proximal end portion and a distal end portion that includes a port couplable to a lumen-defining device. The pre-sample reservoir is fluidically couplable to the port to receive and isolate a first volume of bodily fluid. The actuator is at least partially disposed in the inner volume and has a proximal end portion that includes an engagement portion and a distal end portion that includes a sealing member. The engagement portion is configured to allow a user to selectively move the actuator between a first configuration such that bodily fluid can flow from the port to the pre-sample reservoir, and a second configuration such that bodily fluid can flow from the port to a sample reservoir defined at least in part by the sealing member and the housing.
US11589780B2
An oral appliance includes: 1) a body defining a channel to accommodate an upper dentition; and 2) a motion sensor. The body includes a front portion defining a recess, and the motion sensor is affixed to the front portion.
US11589778B2
Provided are a body size estimation apparatus, a body size estimation method, and a program that enable the estimation of the body size of a user even when the user has not taken a T-pose in advance. A body size data storage unit (50) stores body size data indicating a body size of a user. A posture data acquisition unit (52) acquires position data indicating positions of a plurality of body parts away from each other of the user. A body size estimation unit (54) estimates a body size of the user based on positions of two or more body parts indicated by the position data. A body size update unit (56) updates, in a case where the estimated body size is larger than the body size indicated by the body size data stored in the body size data storage unit (50), the body size indicated by the body size data to the estimated body size.
US11589776B2
Various embodiments of the disclosed technology present a structural foundation for volumetric flow reconstructions for expiratory modeling enabled through multi-modal imaging for pulmonology. In some embodiments, this integrated multi-modal system includes infrared (IR) imaging, thermal imaging of carbon dioxide (CO2), depth imaging (D), and visible spectrum imaging. These multiple image modalities can be integrated into flow models of exhale behaviors enable the creation of three-dimensional volume reconstructions based on visualized CO2 distributions over time, formulating a four-dimensional exhale model which can be used to estimate various pulmonological traits (e.g., breathing rate, flow rate, exhale velocity, nose/mouth distribution, tidal volume estimation, and CO2 density distributions). Various embodiments also enable the accurate acquisition of numerous pulmonary metrics that are then stored within distributed systems for respiratory data analytics and feature extraction through deep learning embodiments.
US11589768B2
Medical devices and methods for making and using medical devices are disclosed. An example electrophysiology medical device may include a catheter shaft including a distal end portion and a sensing assembly having three or more terminals. The sensing assembly includes one or more current-carrying electrodes and one or more sensing electrodes. The one or more current-carrying electrodes, the one or more sensing electrodes, or both includes a mini-electrode. The mini-electrode is disposed on one of the other electrodes. The medical device may also include a controller coupled to the sensing assembly.
US11589765B2
A hemodynamic parameter (Hdp) monitoring system for diagnosing a health condition of a patient and for establishing Hdp marker values or Hdp surrogate marker values for purposes of comparison with Hdp values of a patient is provided. An Hdp monitor senses, measures, and records Hdp values exhibited by the patient during a basal or non-exposure period and furthermore Hdp values exhibited by the patient during or after an exposure period during which the patient is exposed to low-energy electromagnetic output signals. An electrically-powered generator is adapted to be actuated to generate said low-energy electromagnetic carrier output signals for exposing or applying to the patient such output signals during said exposure period.
US11589760B2
This disclosure relates generally to physiological monitoring, and more particularly to feature set optimization for classification of physiological signal. In one embodiment, a method for physiological monitoring includes identifying clean physiological signal training set from an input physiological signal based on a Dynamic Time Warping (DTW) of segments associated with the physiological signal. An optimal features set is extracted from a clean physiological signal training set based on a Maximum Consistency and Maximum Dominance (MCMD) property associated with the optimal feature set that strictly optimizes on the objective function, the conditional likelihood maximization over different selection criteria such that diverse properties of different selection parameters are captured and achieves Pareto-optimality. The input physiological signal is classified into normal signal components and abnormal signal components using the optimal features set.
US11589746B2
Optical coherence tomography (OCT) imaging systems, handhold probes, and methods that use a field curvature to match a curved surface of tissue are disclosed. According to an aspect, an OCT imaging system includes optical elements to generate diverging light. The system also includes one or more mirrors and a lens system configured to scan the diverging light onto a curved surface of an object for imaging of the object.
US11589745B2
Embodiments of the invention include a method to determine a binocular alignment, the method comprising: measuring a disassociated phoria of a first eye and a second eye of a patient at an apparent distance; and determining an accommodative convergence of the first eye and the second eye at the apparent distance using the measured disassociated phoria. In other embodiments, a system to determine a binocular alignment comprises a stereo display, for a projection of images for a first eye and a second eye; an accommodation optics, to modify the projection of the images according to an apparent distance; an eye tracker, to track an orientation of the first eye and the second eye; and a computer, coupled to the stereo display, the accommodation optics and the eye tracker, to manage a determination of the binocular alignment.
US11589743B2
The present disclosure provides methods, computing device readable medium, devices, and systems that utilize a cheek retractor and/or a mobile device holder for case assessment and/or dental treatments. One cheek retractor includes a first and a second lip holder, both including imaging markers of a predetermined size to determine a scale of teeth of a user, where each imaging marker is located a predefined distance from the remaining imaging markers, and where the lip holder is to hold a cheek away from a mouth of a user to expose teeth of the user. A mobile device holder can include elements to receive a mobile device to capture images of the patient's teeth.
US11589738B2
A disposable suction valve is provided. In some embodiments, the disposable suction valve may include a stem providing an air passage through the stem, a spring, a spring stanchion cup, and a boot. A method for manufacturing a disposable suction valve may include several steps. A stem and spring stanchion cup are molded, and a bottom end of the stem is placed through the center of a spring. The bottom end of the stem is placed through a stem opening in the spring stanchion cup, and the tabs or the spring stanchion cup are placed into recessed apertures of the stem. The boot may be over-molded on the spring stanchion cup or molded and placed onto the spring stanchion cup.
US11589737B2
A wire-driven manipulator includes a first member and a second member into both of which a flexible member is inserted, the second member being disposed more on a base end side than the first member, wherein the first and the second members are bent by a drive of the flexible member, wherein the first member includes a bonding portion mechanically bonded with the member, wherein the second member is independent of the first member and the member, and wherein a variation of an average curvature of the first member caused by a drive of the members is larger than a variation of an average curvature of the second member.
US11589730B2
A glass holder attachment for a receptacle for items to be washed includes a holder configured to hold a plurality of stemmed glasses, a plurality of first feet to enable the glass holder attachment to be set on the receptacle and washed together with the stemmed glasses in a household dishwasher, and a plurality of second feet to enable the glass holder attachment to be set down on a level surface in such a manner that the stemmed glasses are arranged at a distance above the surface.
US11589729B2
An article holder assembly for use in a dishwasher appliance includes a first attachment arm for securing to a first side wall of a rack of the dishwasher appliance, a second attachment arm for securing to an opposing, second side wall of a rack of the dishwasher appliance, and at least one article positioning arm secured between the first and second attachment arms. The article positioning arm(s) is movable between an engaged position and a disengaged position. Thus, the article positioning arm(s) defines a predefined geometry configured to receive a portion of one or more articles for cleaning in the dishwasher appliance. Further, when the article positioning arm(s) is in the engaged position, the predefined geometry positions and secures one or more of the articles on a rack of the dishwasher appliance for cleaning.
US11589722B2
A cleaning method and a cleaning robot are provided. The method includes: after the cleaning robot obtains a cleaning instruction for a target scene, acquiring a current power of the cleaning robot and a scene map for the target scene; if it is determined that the current power is insufficient to clean all areas to be cleaned in the target scene, determining a target cleaning area from all the areas to be cleaned in the target scene, based on a target dirtiness level for each of the areas to be cleaned; cleaning the target cleaning area based on the scene map, the target dirtiness level for the target cleaning area and the current power. A more intelligent cleaning robot and a more reasonable cleaning process are realized.
US11589721B2
The present invention provides a cleaning unit, comprising: a columnar body part having a rotation guide opening formed on the outer circumferential surface thereof; a shaft installed to reciprocate a predetermined distance in the longitudinal direction thereof in a hollow formed in the body part; a drive part that protrudes from the shaft in the radial direction thereof; a brush part that has one side installed on the outer circumferential surface of the body part along the longitudinal direction thereof and rotates on the basis of the one side as a rotation axis; and a driven part that extends from the brush part toward the drive part, passes through the rotation guide opening, and is inserted into a rotation guide groove formed in the drive part. The rotation guide groove extends at a predetermined angle with respect to the longitudinal direction of the shaft, and as the shaft reciprocates, the driven part is guided to rotate by means of the rotation guide groove, and the brush is rotated by means of the rotation of the driven part. The cleaning unit may include a robot cleaner or a cleaner operated by means of a user's operation.
US11589719B1
A retractable platform for use in conjunction with a toilet seat configured to be compact when in the retracted position. The retracted platform becomes a generally leveled standing platform when engaged in the opened position providing a stable platform for a child to stand on and turn around to position oneself to sit on a toilet seat. When the platform is in the retracted position, it allows an adult to sit on a toilet seat without any obstruction from the stool to their legs or feet. A cut out on its front panel receive adult-sized feet so the platform in the retracted position does not have to be physically moved when an adult needs to use the toilet. The retracted platform can be easily moved to assist a child needing a vertical advantage in a different location.
US11589715B2
A grab bar includes a continuous support bar extending between a first end and a second end vertically spaced apart from the first end. The continuous support bar has a top section extending away from the first end, a bottom section extending away from the second end and angling upward toward the top section, and a bend formed between and connecting the top section and the bottom section. A brace member is coupled to and extends between the top section and the bottom section.
US11589704B2
Beverage preparation device (1) for preparing a beverage from a beverage dose (2) comprising: —a brewing unit (3) for receiving the dose (2) and preparing a beverage from the ingredients contained within the dose and pressurized liquid injected in the dose, —a pressure pump (4) for supplying pressurized liquid to the brewing unit (3), —beverage dispensing means (5) connected to the brewing unit and comprising a beverage injector (6) arranged for dispensing the beverage through a bottom (8) of a beverage receptacle (7); wherein the beverage dispensing means (5) comprises a residual beverage draining valve (9), between the beverage injector (6) and the brewing unit (3), which is arranged to be moved between a beverage dispensing position and a residual beverage draining position, wherein the residual beverage draining valve (9) and/or the beverage receptacle (7) comprise valve activation means (10) arranged to move the draining valve between a beverage dispensing position in response to the engagement of the bottom of the receptacle with the beverage injector and a residual beverage draining position in response to the removal of receptacle from the beverage injector (6).
US11589698B2
A hanging weight structure for a curtain has a hanging weight member, a connecting member, and two cover caps. The hanging weight member has two sides respectively mounted with the slot and the longer slot, and then each two hanging weight members are connected by a connecting member, so that each hanging weight member located at the lower portion of the curtain sheet is connected to each other through the connecting member to ensure the stability of the hem of the curtain sheet and maintain the curtain sheets being straight when they are collected or unfolded. Furthermore, a cover cap has the positioning rod that positioning the connecting member, which helps to improve the shading and dimming effect of the curtain sheets.
US11589683B2
The present disclosure is directed to a high chair that is permanently secured to a picnic table to facilitate the public enjoyment of communal meals and recreational time by families that include small children. In some embodiments, the high chair may be configured to extend above the upper surface of the picnic table, providing the additional benefit of facilitating interaction and attunement between a child occupant of the high chair and adult occupants of the picnic table bench seats. In other embodiments, the high chair may be configured such that a food tray of the high chair is substantially level with the upper surface of the picnic table.
US11589680B2
A furniture item with at least one wedge-shaped bed and with a vertical axis of rotation, about which the at least one bed and/or at least one wedge-shaped functional element are/is mounted in a rotatable manner. The axis of rotation is arranged at one of the two ends of the bed or is formed by the axis of rotation of a rotary part, on which one of the two bed ends is fastened.
US11589677B2
A suspended pull-out cabinet organizer assembly includes: a front mounting bracket including a front facing flange and a first support arm and a second support arm; a rear mounting bracket including a rear mounting face, a first mounting arm, and a second mounting arm; a pair of drawer slides spanning the front mounting bracket and the rear mounting bracket, each drawer slide including at least two mounting tabs; and an organizer including a series of at least two mounting bosses corresponding to each mounting tab on the first drawer slide and the second drawer slide, wherein the organizer is mounted to the first drawer slide and the second drawer slide by securing each mounting tab to a corresponding mounting boss.
US11589671B2
An apparatus for dispensing a material from a cartridge comprises a dispensing head having a passage therethrough, the passage extending from a receiving socket to a dispensing orifice through said dispensing head, an outer casing, securable to the dispensing head and rotatably relative to the dispensing head and an end cap threadably received within the dispensing head and having an end connector disposed towards the dispensing head. The receiving socket and the end connector are adapted to receive the cartridge so as to rotatably fix the end cap relative to the dispensing head wherein rotation of the outer casing threadably moves the end cap in a longitudinal direction thereby compressing the cartridge between the dispensing head and the end cap. A kit may include the apparatus and a cartridge extending between first and second ends and having an interior adapted to contain a substance to be dispensed therefrom.
US11589668B2
A beauty instrument with mask includes a flexible mask and a controller. The flexible mask includes a first flexible layer, a second flexible layer, a plurality of functional layers located between the first flexible layer and the second flexible layer, and a plurality of electrodes electrically connected with the plurality of functional layers. The functional layer includes a graphene layer. The flexible mask is electrically coupled with the controller via the plurality of electrodes.
US11589667B2
A device for ensuring safe operation of a robot used for cosmetics applications, including the retrofitting of robots not originally design for such applications. In some embodiments, the robot is used for the automatic placement of eyelash extensions onto the natural eyelashes of a subject. In some embodiments, a safety barrier is provided by a physical barrier or light curtain. In other embodiments, readily deformable end effectors are used.
US11589660B2
A handheld appliance having a body and an attachment, the body includes an attachment mechanism having a slot and an actuator, the attachment including a protrusion adapted to engage with the slot wherein the actuator has a first position and a second position and the actuator is moved from the first position towards the second position as the protrusion engages with the slot. In the first position the actuator may at least partially obscures the slot. The actuator includes a surface which may interact with the protrusion when the protrusion engages with the slot. The surface may be adapted to at least partially define the slot at or near the second position. When the protrusion is at a pre-determined position within the slot, the actuator may return towards the first position. The actuator may be biased into the first position.
US11589656B2
A waterproof zipper with at least one curve includes a first tape and a second tape, and interlocking elements attached to the first tape and the second tape, wherein the first tape and the second tape are curved, and wherein a curve of at least one of the tapes was caused by compaction of that tape. The zipper is coated on at least one side with a fluid impervious coating.
US11589654B2
A last matching a user's foot can be provided through a simple configuration. A last for forming a footwear upper configuring an article of footwear comprises: a common portion invariable in shape and position, a movable portion invariable in shape and positionally variable with respect to the common portion, and a position adjustment mechanism that changes a position of the movable portion with respect to the common portion and fixes the movable portion in a predetermined position.
US11589653B2
A tension-retaining system for retaining tension in a tensioning cord of a wearable article may include a retainer including an anchor and a wedge. The anchor may define a notch, and the wedge may have a tensioning cord coupling feature. The wedge may have an engagement portion that fits within the notch with the engagement portion disposed further in the notch than the tensioning cord coupling feature.
US11589651B2
A shoe includes a knit upper and a sole secured to the knit upper. The knit upper is formed with a first type of knit structure knitted with a thermoplastic yarn in a first area. The first area is in at least the toe region of the knit upper. In a second area including at least the medial and lateral metatarsal regions of the knit upper, the knit upper is formed with a second type of knit structure knitted with a second yarn having a higher melting temperature than the thermoplastic yarn. A rear boundary line of the first area and a forward boundary line of the second area define a boundary line between the first and second areas.
US11589648B2
Methods for manufacturing three-dimensional components of articles, including articles of footwear, apparel, and sporting equipment are provided. The disclosed methods comprise providing a first composition comprising a plurality of foam particles suspended in a liquid polymerizable composition, polymerizing a first portion of the liquid polymerizable composition to form a first layer of polymeric material at least partially encapsulating a first portion of the plurality of foam particles, repeating the polymerizing and forming for at least a second and third iteration, each iteration forming a layer on the previous layer, thereby forming a three-dimensional component having at least three layers, each layer including foam particles at least partially encapsulated by the first polymeric material. Articles manufactured using the disclosed methods are also provided.
US11589641B2
A ski boot of the kind comprising a substantially rigid outer shell and a cuff articulated to the shell is provided and further includes a locking device which can be switched between a first configuration, in which the rotation of the cuff relative to the shell is allowed, and a second configuration, in which the rotation of the cuff relative to the shell is prevented. The locking device of the ski boot also includes deadlocking means which prevents the locking device from being accidentally moved from the configuration in which it is, specifically when it is in the second configuration.
US11589628B2
A tubular sleeve having a proximal end opposite a distal end, a cutout formed through the tubular sleeve proximate the distal end, a first panel having at least a trailing edge and spanning a first portion of the cutout, a second panel having at least a leading edge and a trailing edge and spanning a second portion of the cutout, and a third panel having at least a leading edge and spanning a third portion of the cutout. The second panel may overlap the first panel across the entire width of the cutout such that the second-panel leading edge is distal to the first-panel trailing edge. The third panel may overlap the second panel across the entire width of the cutout such that the third-panel leading edge is distal to the second-panel trailing edge. In some aspects, a mitten may be affixed to an interior surface of the tubular sleeve.
US11589613B2
The present disclosure discloses a power supply assembly for an electronic cigarette and an electronic cigarette. The power supply assembly includes a main body and a trigger switch. The main body may be provided with an accommodation space for accommodating circuit components. The trigger switch may be mounted inside the accommodation space by a seal. A first channel and an air flow sensing duct may be connected to the trigger switch. The first channel may include a first end and a second end that are arranged oppositely. The first end may communicate with the air suction pathway of an atomizer of the electronic cigarette, and the air flow sensing duct may communicate with a lateral wall of the first channel close to the first end.
US11589612B2
Provided is an aerosol generating device distributing and transmitting power from a battery to two heaters, wherein the aerosol generating device includes the battery, a first heater heating a first aerosol generating substrate, a second heater heating a second aerosol generating substrate, and a controller controlling power supplied from the battery to the first heater and the second heater, wherein the controller controls power to be supplied from the battery to the first heater and the second heater at different times.
US11589604B2
A method for producing a food product includes preparing a mixture including one or more dried food ingredients and at least one oil or fat, wherein a total fat content in the mixture is 30% by mass or more, wet pulverizing the dried food ingredients in the mixture, and obtaining a food composition including the at least one oil or fat and 20% to 98% by mass of fine particles of the dried food ingredients. The wet pulverization is performed with a maximum pressure of 0.01 to 1 MPa and under a rising temperature condition satisfying T1+1
US11589597B2
The present invention is directed to pulse protein products, very low in, or substantially free of, pea/vegetable flavour notes characteristic of conventional commercial pulse protein products and useful for the fortification of food and beverage products and prepared without the use of salt in the process. The pulse protein products of the present invention are obtained by extracting pulse protein source with water to form an aqueous pulse protein solution, at least partially separating the aqueous pulse protein solution from residual pulse protein source, adjusting the pH of the aqueous pulse protein solution to a pH of about 1.5 to about 3.4 to solubilize the bulk of the protein and form an acidified pulse protein solution then separating the acidified pulse protein solution from the acid insoluble solid material. The acidified pulse protein solution may be dried following optional concentration and diafiltration to form a pulse protein product, which may be an isolate. The acid insoluble solid material may be washed with acidified water and then dried to form another pulse protein product. These products may be dried at the acidic pH at which they were prepared or may be adjusted in pH before drying. Also described is the preparation of an acid soluble protein product, which may be an isolate, and which provides acidic solutions of improved clarity and is derived from the acidified pulse protein solution.
US11589592B2
The present invention discloses biomass compositions for improving shelf life, increasing fruit water retention, and/or decreasing needle-drop in conifer species and methods for making the same. The composition comprises pasteurized microalgae selected from Chlorella, Aurantiochytrium, Scenedesmus, or any combination thereof.
US11589586B2
The present invention relates to pesticidal and parasiticidal isoxazoline of formula (I) and salts thereof: wherein variables R1, P, Y and Q are described herein are as defined in the description. The invention also relates to parasiticidal and pesticidal compositions comprising the isoxazoline compounds of formula (I), processes for their preparation and their uses to prevent or treat parasitic infections or infestations in animals and as pesticides.
US11589578B2
This invention refers to a paint composition with prolonged release biocides to repel, reduce, and control insects, characterized by: a) A cbp vehicle, preferably a water-based acrylic vinyl paint; b) At least one pyrethroid biocide or its mixture, selected from: b1) microencapsulated deltamethrin as an active ingredient: b2) microencapsulated cypermethrin as an active ingredient; Where said pyrethroid biocides are activated or catalyzed through (PBO) piperonyl butoxide, and Wherein said microcapsules of the active ingredients are obtained through a microencapsulation process by interfacial polymerization, and/or a microencapsulation by ionic gelation process, for a prolonged release with regards to the biocidal active ingredients' interval.
US11589573B1
An automatic duck decoy jerk string device 1 having an enclosure 2, a mounting pole 6, a lockable mount 8 for mounting the enclosure 2 at different heights on the mounting pole 6, an electric motor 10 in the enclosure 2, a battery 12 configured to power the electric motor 10, a speed control 13 to control a rotational speed of a motor drive shaft 16, an elongated slider 20 partially inside the enclosure 2 and partially outside the enclosure 2, the elongated slider 20 moves back-and-forth towards the inside of the enclosure and away from the inside of the enclosure, a gear system 14 connected to the motor drive shaft 16 to reduce the rotational speed of the motor drive shaft 16 and rotate a drive arm 18, and a link arm 28 is rotatably mounted to the drive arm 18 and rotatably mounted to the first slider end 22. A method of using the jerk string device to move duck decoys 48 on a jerk line 38 connected to the elongated slider 20.
US11589570B2
Provided herein is a system for semi-automatic and/or automatic weed removal a system for automatic detection of weeds including an optical sensor and a central server unit, with communication network, an open-loop and/or closed-loop control device and a weed removal device, wherein the optical sensor, the server unit and the open-loop and/or closed-loop control device are in data connection via the communication network, wherein image data of a weed is generated via the optical sensor and transmitted to the server unit, which analyses the transmitted image data such that the weed can be determined, and wherein, via the server unit, in the case of a clear determination of the weed, weed confirmation data is transmitted to the open-loop and/or closed-loop control device which, in response to the weed confirmation data, controls and/or regulates the weed-removal device so that the weed detected by the optical sensor can be removed.
US11589552B2
A pet containment apparatus for a truck bed that connects to the corner bed anchors and contains an overhead connection for the pet(s) to allow for free movement of the pet(s) in the truck bed, while keeping the pet(s) from exiting the truck bed. The apparatus may be static or adjustable and allow for single or multiple pets to travel safely in the truck bed. The pet(s) will be tethered overhead to allow for free movement. In preferred embodiments, the various elements of the apparatus include a sturdy, metallic frame with adjustable connectors to fit various truck beds.
US11589549B2
The invention provides seeds and plants of tomato line FIR-A818-0004. The invention thus relates to the plants, seeds, plant parts, and tissue cultures of tomato line FIR-A818-0004 and to methods for producing a tomato plant produced by crossing such plants with themselves or with another plant, such as a tomato plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to plants, seeds, plant parts, and tissue cultures of tomato line FIR-A818-0004 comprising introduced beneficial or desirable traits.
US11589548B2
The invention provides seeds and plants of tomato line FIR-XM17-4455. The invention thus relates to the plants, seeds, plant parts, and tissue cultures of tomato line FIR-XM17-4455 and to methods for producing a tomato plant produced by crossing such plants with themselves or with another plant, such as a tomato plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to plants, seeds, plant parts, and tissue cultures of tomato line FIR-XM17-4455 comprising introduced beneficial or desirable traits.
US11589547B2
The present invention provides novel tomato line SENG9234 and plant parts, seed, and tissue culture therefrom. The invention also provides methods for producing a tomato plant by crossing the tomato plants of the invention with themselves or another tomato plant. The invention also provides tomato plants produced from such a crossing as well as plant parts, seed, and tissue culture therefrom.
US11589543B2
A soybean cultivar designated 4826008 is disclosed. Embodiments include the seeds of soybean 4826008, the plants of soybean 4826008, to plant parts of soybean 4826008, and methods for producing a soybean plant produced by crossing soybean 4826008 with itself or with another soybean variety. Embodiments include methods for producing a soybean plant containing in its genetic material one or more genes or transgenes and the transgenic soybean plants and plant parts produced by those methods. Embodiments also relate to soybean cultivars, breeding cultivars, plant parts, and cells derived from soybean 4826008, methods for producing other soybean cultivars, lines or plant parts derived from soybean 4826008, and the soybean plants, varieties, and their parts derived from use of those methods. Embodiments further include hybrid soybean seeds, plants, and plant parts produced by crossing 4826008 with another soybean cultivar.
US11589540B1
A novel maize variety designated X03R618CYFR and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X03R618CYFR with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X03R618CYFR through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X03R618CYFR, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X03R618CYFR are provided. Methods for producing maize varieties derived from maize variety X03R618CYFR and methods of using maize variety X03R618CYFR are disclosed.
US11589538B2
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH011142. The invention thus relates to the plants, seeds and tissue cultures of the variety CH011142, and to methods for producing a corn plant produced by crossing a corn plant of variety CH011142 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH011142.
US11589536B1
A novel maize variety designated 4KKXD0159 and seed, plants and plant parts thereof are provided. Methods for producing a maize plant comprise crossing maize variety 4KKXD0159 with another maize plant are provided. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into 4KKXD0159 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby are provided. Hybrid maize seed, plants or plant parts are produced by crossing the variety 4KKXD0159 or a locus conversion of 4KKXD0159 with another maize variety.
US11589533B1
A novel maize variety designated SLHS06 and seed, plants and plant parts thereof are provided. Methods for producing a maize plant comprise crossing maize variety SLHS06 with another maize plant are provided. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into SLHS06 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby are provided. Hybrid maize seed, plants or plant parts are produced by crossing the variety SLHS06 or a locus conversion of SLHS06 with another maize variety.
US11589524B2
An aquaponic grow system includes a plurality of sensors for sensing nutrient levels in liquid provided to a grow chamber, and to adjust nutrient levels based on the sensed levels. In some embodiments the system includes a plurality of sensors configured to sense nutrient levels in a common chamber, with the system configured to calibrate the sensors.
US11589520B2
A growing system is described where plants are grown in containers and the containers are stored in stacks. Above the stacks runs a grid network of tracks on which load handling devices run. The load handling devices take containers from the stacks and deposit them at alternative locations in the stacks or deposit them at stations where goods may be picked out. The containers may be provided with one or more of the following services: power, power control, heating, lighting, cooling, sensing means, data logging means, growing means, water and nutrients.
US11589507B2
Operating conditions corresponding to a harvesting operation being performed by a mobile harvesting machine are detected along with a priority of a first performance pillar metric relative to a second performance pillar metric. An operating characteristic of the mobile harvesting machine is detected and a performance pillar metric value is identified for the first performance pillar metric based on the detected operating characteristic. A performance limitation corresponding to the first performance pillar metric is identified based on the detected operating conditions and an aggressiveness setting is detected that is indicative of an operating settings change threshold. It is then determined whether a settings change is to be performed based on the first performance pillar metric value, the priority of the first performance pillar metric, the first performance limitation and the settings change threshold and if the settings change is to be performed, a settings change actuator is controlled to execute the settings change.
US11589497B1
A method, a container, and a planting device are provided for improving seedling emergence from seeds through soil and improving yield of plants in a field. The method includes selectively planting two seeds next to one another within the soil to provide sufficient emergence energy so the seedlings emerge together through the soil. One of the seedlings is then selectively destroyed to provide a desired spacing between plants in the field. A capsule is provided to contain plantable agricultural products. The capsule enables uniform and consistent planting plantable agricultural products, enables close proximity planting of multiple plantable agricultural products next to one another, and enables uniform and consistent engagement and dispensing of the seeds by planting equipment. A planting device, defined by a planter plate, is designed to consistently and uniformly plant the capsules containing agricultural products within the field.
US11589495B2
A system for determining material accumulation relative to ground engaging tools of an agricultural implement may include a frame member, and first and second ground engaging tools coupled to the frame member. The first and second ground engaging tools are configured to engage soil within a field as the agricultural implement is moved across the field. The first and second ground engaging tools are electrically isolated from each other. The system may further include a power source configured to apply a voltage across the first and second ground engaging tools, a sensor configured to measure a capacitance across the first and second ground engaging tools, and a controller communicatively coupled to the sensor. The controller may be configured to determine a presence of material accumulation between the first and second ground engaging tools based at least in part on the measured capacitance.
US11589493B2
Method for detecting inadmissible operating conditions of work hydraulics of an agricultural tractor
A method is provided for detecting inadmissible operating states of a work hydraulics of an agricultural tractor. The method includes providing at least one electrically actuated control valve, a branch allocated to the at least one control valve, and an operating unit for the manual actuation of the work hydraulics of a front linkage. The method also includes connecting the at least one electrically actuated control valve to a hydraulic consumer via a hydraulic coupling, supplying hydraulic fluid to a hydraulic lifting device of the front linkage, detecting a state variable indicative of a connection state of the hydraulic coupling by a sensor unit and communicated to a control unit, and deactivating the operating unit if the control unit identifies by way of the evaluation of the state variable that a hydraulic consumer is connected to the hydraulic coupling.
US11596089B2
A method for shielding components includes the steps of providing a component and applying at least one coating region, designed to shield from a magnetic and/or an electrical field, to the component by a thermal and/or kinetic spraying method such that a first arrangement space is shielded from a second arrangement space.
US11596086B2
Systems and methods for cooling an electronic device via interface of a heat-transfer conduit of the electronic device to a cold plate assembly are disclosed. According to an aspect, a system includes an electronic device including one or more electronic components. Further, the electronic device includes a heat-transfer conduit including a first end and a second end. The first end of the heat-transfer conduit is positioned to receive heat from the electronic component(s). The heat-transfer conduit is configured to conduct heat from the first end to the second end. Further, the system includes a cold plate assembly including a cold plate and a mechanism configured to permit movement of the cold plate. At the first position, the cold plate may contact the second end for receipt of heat from the heat-transfer conduit at the second end. At the second position, the cold plate is apart from the second end.
US11596075B2
A vehicle includes a vehicle body, a vehicle seat, an inverter and an inverter cover. The vehicle body defines a vehicle interior. The vehicle seat is disposed on a floor of the vehicle interior. The inverter has a housing fixed to the floor of the vehicle interior at a location underneath the vehicle seat. The inverter cover is detachably attached to the inverter housing.
US11596056B2
A packaging substrate can include a first surface and a second opposing surface, the first surface having a mounting region configured to receive electronic components, and electrical contacts formed on the second opposing surface. A saw street region can surround the mounting region and the electrical contacts, a metal layer and a solder mask layer being formed within the saw street region on the second opposing surface, and the solder mask layer being formed over the metal layer. An electronic module can include a packaging substrate including a first surface and a second opposing surface, the first surface including a mounting region. A plurality of electronic components can be mounted on the mounting region. A ground pad can be formed on the second opposing surface of the packaging substrate, the ground pad including a solder mask layer formed thereon, the solder mask layer having a plurality of openings.
US11596055B2
For example, an apparatus may include a Printed Circuit Board (PCB) including a Ball Grid Array (BGA) on a first side of the PCB, the BGA configured to connect a Surface Mounted Device (SMD) to the PCB; an antenna disposed on a second side of the PCB opposite to the first side, the antenna to communicate a Radio Frequency (RF) signal of the SMD; and an RF transition to transit the RF signal between the BGA and the antenna, the RF transition including a plurality of signal buried-vias; a first plurality of microvias configured to transit the RF signal between the plurality of signal buried-vias and a ball of the BGA, the first plurality of microvias are rotationally misaligned with respect to the plurality of signal buried-vias; and a second plurality of microvias configured to transit the RF signal between the plurality of signal buried-vias and the antenna.
US11596049B2
Methods and apparatuses for emitting electrons from a hollow cathode are provided. The cathode includes a plasma holding region configured to hold a plasma, a gas supply source configured to supply gas to the plasma holding region, and an orifice plate disposed on a periphery of the plasma holding region. The orifice plate comprises a plurality of openings constructed to receive electrons from the plasma. The plurality of openings decouple gas conductance and electrical conductance across the orifice plate. The diameters of the plurality of openings are within a range of 20%-60%, inclusive, of a diameter of a circular opening with an area equal to a sum of the areas of the plurality of openings.
US11596028B2
In a method of manufacturing a cartridge of an electronic vaping device, wherein the cartridge includes a pre-vapor formulation storage element, an electrical inductor is formed from an electrical component, wherein the electrical inductor has an inductance indicative of a pre-vapor formulation substrate contained in the pre-vapor formulation storage element. The electrical inductor is then mounted to the cartridge.
US11596010B2
Disclosed is a method in which a first terminal receives data in a wireless communication system. Specifically, the method may include transmitting a first message that includes a sidelink communication request and receiving sidelink communication data from a second terminal. In particular, the first terminal may be a subscriber of a first Public Land Mobile Network (PLMN), and the second terminal may be a subscriber of a second PLMN different from the first PLMN. In addition, the sidelink communication data may be received by using a carrier of the first PLMN. The first terminal is capable of communicating with at least one of another UE, a UE related to an autonomous driving vehicle, a base station or a network.
