The present invention relates to a food composition for relieving stress, and specifically, to a food composition for relieving stress, which reduces secretion of the stress hormone cortisol and increases secretion of the happy hormone serotonin by containing fermented and aged noni and calamansi as active ingredients, has no side effects, and is safe for the human body. The composition of the present invention may be used as a health functional food or a pharmaceutical composition. The composition of the present invention has an excellent anti-stress effect.
According to a conventional method for treatment of Sandhoff disease and Tay-Sachs disease comprising administering a modified β-subunit to a patient in the form of a protein, it is necessary that administration be performed frequently. This invention relates to a recombinant adeno-associated virus virion comprising: capsomere comprising a protein capable of forming a virus virion; and a polynucleotide packaged in the capsomere comprising a promoter sequence and nucleotide sequences operably linked to the promoter sequence encoding a first amino acid sequence derived from the amino acid sequence of the β-subunit of wild-type human β-hexosaminidase composed of amino acids 55 to 556 in the sequence as shown in SEQ ID NO: 28 by substitution of amino acids 312 to 318 with glycine, serine, glutamic acid, proline, serine, glycine, and threonine in that order and a second amino acid sequence, which is an amino acid sequence of a signal peptide linked to the N terminus of the first amino acid.
Disclosures herein relate to methods of producing oral powdered compositions for fecal microbiota transplant and related methods of treatment. Procedures for producing the powdered composition may include filtering a fecal sample with a filter medium to generate a filtrate, separating particulate matter of the filtrate to obtain a first sediment and a first supernatant, repeatedly resuspending the first sediment and separating particulate matter of the resuspended first sediment to obtain a second sediment and a second supernatant, diluting the second supernatant and repeatedly separating particulate matter out of the second supernatant to obtain a third sediment and a third supernatant, resuspending the third sediment in a cryoprotectant to obtain a mixture, and freeze-drying the mixture to obtain a freeze-dried, powdered composition, wherein the powdered composition may be substantially tasteless, odorless, and colorless.
Provided herein are pharmaceutical compositions comprising tumoricidal and/or antimicrobial components isolated from the supernatant of NK-92 cell medium and methods of using the compositions for killing cancer cells.
The present invention relates to conjugates comprising cytarabine and an amino acid for use in the treatment of cancer. In particular, the present invention relates to conjugates of cytarabine and aspartic acid for use in the treatment of hematological cancers.
The present invention relates to a method of treating allergic rhinitis in a subject (e.g., a pediatric human subject) in need thereof comprising nasally administering to the subject an effective amount of a fixed-dose pharmaceutical composition comprising mometasone or its salt and olopatadine or its salt.
Provided are a composition for treating or preventing recurrence of keloid comprising tauroursodeoxycholic acid as an active ingredient, and a method for treating keloid or preventing recurrence of keloid using the composition.
The present invention provides pharmaceutically acceptable and ophthalmologically suitable gel compositions comprising a therapeutically effective amount of a bimatoprost compound, a therapeutically effective amount of a timolol compound, and benzalkonium chloride. In certain embodiments, compositions provided by the invention further comprise a penetration enhancer component other than benzalkonium chloride. Further, the invention provides a process of preparing such compositions and methods of their use in treating ocular conditions, such as methods of reducing elevated intraocular pressure and/or treating glaucoma, such as open-angle glaucoma.
The disclosure provides for an oral composition, the oral composition including at least one active agent, at least one filler component, and water in an amount sufficient such that the oral composition has a total moisture content of about 15% to about 30% by weight or greater based on the total weight of the oral composition.
Embodiments disclosed herein describe, amongst other things, dosage forms, compounds, compositions, pharmaceutical compositions that can be used in the treatment of, for example, restless leg syndrome.
Provided herein are low impurity compositions comprising a compound represented by Formula (I):
which are useful in the treatment of disorders related to the activity of the c-KIT and PDGFRα kinases, and oncogenic forms thereof.
The present invention encompasses compounds of formula (I)
wherein the groups R1 to R4 and X1 to X5 have the meanings given in the claims and specification, their use as inhibitors of mutant EGFR, pharmaceutical compositions which contain compounds of this kind and their use as medicaments/medical uses, especially as agents for treatment and/or prevention of oncological diseases.
Disclosed herein are compounds effective for activation of Tie-2 and inhibition of HPTP-beta. The compounds can provide effective therapy for eye conditions, for example, intraocular pressure, ocular hypertension, and glaucoma.
This application is directed to inhibitors of RAD51 represented by the following structural formula,
and methods for their use, such as to treat pancreatic cancer.
The present invention is directed to a combination comprising a glucocorticoid and a compound of formula I or a pharmaceutically acceptable salt thereof:
to a pharmaceutical composition and to a kit both comprising said combination, to the combination, composition or kit for use in the treatment of cancer, and to a method of treatment of cancer in a patient in need thereof comprising administering to said patient an effective amount of said combination, composition or kit.
A method of stimulating ventilatory and/or respiratory drive in a subject in need thereof includes administering to the subject a therapeutically effective amount of a composition comprising a cystine ester or a pharmaceutically acceptable salt thereof. Embodiments described herein relate to compositions and methods of stimulating ventilatory and/or respiratory drive in a subject in need thereof, and particularly relates to compositions and methods of treating breathing diseases and/or disorders associated with impaired ventilatory and/or respiratory drive.
The present disclosure relates to an endogenous Retrovirus K protein (ERVK) with an alternative envelope protein titled CTXLP. Said CTXLP peptide is represented by the sequences set forth in SEQ ID NO: 1. Additionally, antibodies that specifically recognize the epitope(s) set forth in SEQ ID NO:1 are and methods of use thereof and kits comprising the peptide set forth in SEQ ID NO:1 are also included in the present disclosure.
The present invention relates to a pharmaceutical composition containing liposomes, said liposome comprise an external lipid bilayer; and an internal aqueous medium including a weak acid drug with a half-life of less than 2 hours. Also provided is the use of the pharmaceutical composition disclosed herein to treat pulmonary hypertension with reduced dosing frequency.
The present application provides methods of prevention and/or treatment of breast cancer in a subject by inhibiting expression of PAX2. In the cancer treatment methods disclosed, the method of inhibiting expression of PAX2 can be by administration of a nucleic acid encoding an siRNA for PAX2. A method of treating cancer in a subject by administering DEFB1 is also provided. Similarly, provided is a method of treating cancer in a subject by increasing expression of DEFB1 in the subject.
The present invention relates to the use of cannabidiol (CBD) in the treatment of focal seizures. In one embodiment the patients suffering from focal seizures are children and young adults. CBD appears particularly effective in reducing focal seizures in patients suffering with etiologies that include: Lennox-Gastaut Syndrome; Tuberous Sclerosis Complex; Dravet Syndrome; CDKL5; Neuronal ceroid lipofuscinoses (NCL); febrile infection related epilepsy syndrome (FIRES); Aicardi syndrome and brain abnormalities in comparison to other seizure types. Significantly CBD additionally is very effective in the reduction of a sub-type of focal seizures, focal seizures with impairment.
Methods and apparatus are disclosed for sterilizing raw hazardous medicine and the filling and capping syringes disposed within closed and sterile plastic bags to provide sterile medical preparations apart from laminar flow hoods and like equipment. Of particular note, such methods are particularly applied to providing syringes filled with sterilized hazardous drugs while reducing concern for unintentional spills and sterilizing medical preparations and filling large numbers of syringes with steps reduced by novel apparatus and methods. Also, a capping plate is disclosed which provides a method for capping a plurality of male syringe luer fittings by a single displacement step followed by facile release of cap and associated syringe from the capping plate for use in a medical procedure.
The present invention relates to the reduction of tissue interface pressure. The present invention provides a method to immerse an individual to a desired depth into a support surface. The method of the present invention maintains a desired level of immersion over time independent of the motion of the individual or changes in the position of the support surface or externally applied loads to the support surface, alone or in combination. The method of the present invention is an improvement to using an individual's weight or height or other sensor to determine inputs to an algorithm for immersing the individual to a certain depth into the surface. No pressure measurements or displacement measurements are required in accordance with the present invention, and the height and weight of the individual is not required.
A female external urinary device useful in managing urine output of a female, such as for surgical use, includes a core having a suction channel and an interior reservoir fluidically communicating with the suction channel, an absorbent layer, and a fabric cover. Desirably, the urinary device includes a moderately absorbent soaker layer disposed inwardly with respect to the core. A urinary device assembly includes the core and a pelvic belt that may be secure to the core and positioned to collect urine from a female patient.
A monitor device for an ostomy system and a method of monitoring an ostomy appliance is provided. The monitor device includes a processor; memory; and a first interface connected to the processor and the memory, the first interface including a plurality of terminals including a ground terminal and a first terminal for collecting ostomy data from an ostomy appliance of the ostomy system via the first interface. The processor is configured to process the ostomy data according to a processing scheme, the processor including an ostomy processing controller configured to control the processing scheme, wherein to control the processing scheme includes applying a first processing scheme or a second processing scheme different from the first processing scheme.
The present invention relates to a hand motion control system and a control method thereof, and more specifically, to a hand motion control system for a myoelectric hand, and to a control method thereof. The system enables not only grasping motions for grasping an object, but also the expression of hand gestures expressing emotions or intent, based on a limited myoelectric signal transmitted via two myoelectric sensors provided on the myoelectric hand. Furthermore, the system enables a wide variety of hand postures and grasp types that are determined by the position of a thumb, which can be changed by a user, thus easily expanding the range of applications of the myoelectric hand.
A device for ligament balancing includes a mount at a first end of the device and a head portion at a second end of the device, the head portion having a substantially planar surface, a first paddle, and a second paddle, wherein the first and second paddle are rotatable about a first longitudinal axis and a second longitudinal axis, respectively, relative to the substantially planar surface. The device further includes a stem extending from the head portion and a shaft extending between the stem and the mount. The mount includes a coupling portion configured to couple the device to a robotic device such that movement of the device is controlled by the robotic device.
An implantable device is disclosed. The device includes a two or three-piece frame assembly that is configured to be delivered in a series configuration and subsequently nested or telescoped in-situ.
An implantable accommodating intraocular lens (IOL) has an optic lens sized to fit within a capsular lens bag of an eye; and a plurality of haptics angularly spaced around and radially extended from the optic lens, with each haptic: having a tongue that forms an arcuate sulcus gripping part that, in use within the capsular lens bag, inserts into and follows a circumferential groove of the sulcus to restrict circumferential sliding of the tongue around the sulcus; and being structured to move, under contraction and expansion of ciliary muscles of the eye, to adjust the optic lens to accommodate a focal power of the eye.
Systems and methods for data-compressive sensing in accordance with embodiments of the invention are illustrated. In one embodiment, a sensor array includes an array of sensor circuitries including a sensor and a comparator. Sensor circuitries in the array are connected via wires which form a series of wired-OR circuits. Readouts can be used to measure the signal on the wires and a decoder in communication with the readouts can be used to resolve signals sensed by particular sensors in the array and their locations.
Devices, methods, and systems are provided for loading an implantable device into a container. One aspect of the loading system contains a loader element with a loading tunnel that is configured to gradually contract an implantable device into a compressed state of reduced size relative to an expanded state as the implantable device travels through the loading tunnel.
An implantable prosthesis for hernia repair is designed for minimally invasive, robotic, or laparoscopic surgery. Various embodiments of the implantable prosthesis are tailored for inguinal hernia repair, including direct, indirect, and bilateral hernia defects, as well as for femoral hernia repair.
An implant and suture locking system is provided. The implant can include a lateral or distal anchor, and a medial or proximal anchor. One or more suture loops can extend between and operatively connect the anchors. A medial suture loop can extend through apertures in the medial anchor to provide efficient and easily adjustable tensioning and suture locking for the implant.
An absorbent article having longitudinal cuffs of improved structure is disclosed. The improved cuffs may be elasticized by a plurality of elastic strands that are substantially greater in number, closer in spacing, lower in pre-strain, and lower in decitex, or any combination of these, as compared with those in conventional articles. This combination of features results in ruffles or gathers of cuff material joined to the elastic strands that are substantially greater in machine-direction frequency and substantially lesser in z-direction amplitude, than those in conventional articles. As a result, the cuff structure lies more closely and evenly against the wearer's skin, has an improved, more cloth-like appearance, provides improved gasketing, and provides improved wearer comfort, as compared with cuff structures in conventional articles. A method for manufacturing articles with such cuff structures, utilizing a warp beam as a supply mechanism, is also disclosed.
The present invention relates to garments and kits, including uses thereof, for providing therapeutic compression such as compression therapy for the treatment of circulatory disorders such as Lymphedema and Venous Disease.
Disclosed embodiments relate to wound therapy apparatuses and methods for use in negative pressure wound therapy (NPWT). Such wound therapy apparatuses and methods may reduce maceration during NPWT. The wound therapy apparatus may include a porous hydrophobic layer surrounded by a hydrophilic ring. The hydrophilic ring may serve to prevent passage of liquid while negative pressure is applied to the wound, but allow liquid passage to an absorbent ring when negative pressure is no longer applied. A transmission layer may also be included, underlying the absorbent layer.
An orthodontic aligner includes a shell defining at least one cavity sized to receive one of a patient's teeth. The cavity includes a lingual portion, a labial portion, and an occlusal portion. A bite structure forms at least a portion of the occlusal portion and is configured to be spaced apart from an occlusal surface of the patient's tooth by a distant sufficient to interfere with full closure of the patient's jaws. The bite structure has a non-planar surface that does not conform to the patient's tooth. The non-planar surface includes at least two spaced-apart projections separated by a boundary. The spaced-apart projections are spherical-like projections or ellipsoidal-like projections. The boundary has a grid-like appearance that spans the bite structure side to side. The spaced-apart projections define a tooth-engaging plane of the bite structure. The bite structure is an integral portion of the shell.
Methods and systems are provided for manufacturing an appliance for correcting malocclusions of a patient's teeth. The method may include measuring the positions of a patient's teeth and receiving tooth movement constraints. The method may also include generating an initial treatment plan based on the measured tooth positions and the tooth movement constraints and measuring the malocclusions of the patient's teeth for one or more types of dental malocclusions. The method may also include generating a plurality of treatment plans from the initial treatment plan based on the measured malocclusion and generating a model of an appliance for each stage of the treatment plan. The method may also include generating instructions for fabricating the appliance for each stage of the treatment plan based on the model of the appliance for each stage of the treatment plan.
An electrical discharge irrigation includes a power source to produce a first voltage, a circuit coupled to the power source to convert the first voltage to a second voltage, a discharge capacitor to receive the second voltage from the circuit, a transistor and/or a controlled rectifier coupled to the discharge capacitor to receive the second voltage, and an output tip. This tip is coupled to a transistor and/or a controlled rectifier and includes a first end, a second end, a longitudinal axis extending between them, an electrode located in an interior space of the tip to receive an electrical charge from the a transistor and/or a controlled rectifier and to release an electric discharge, and a ground return. The ground return is an outside surface of the tip. A space between the electrode and the ground return holds a conductive medium in contact with the electrode and the ground return.
Methods, systems, and apparatuses are described for generating an interdental filler model for a patient. Locations for ends of the interdental filler model may be determined. A curvature of the interdental filler model may be determined. A shape of the interdental filler model may be determined. A first arc may be determined for a first end of the interdental filler model and a second arc may be determined for a second end of the interdental filler model. A set of arcs may be interpolated between the first arc and the second arc. The set of arcs may be grounded on the patient's gingiva. The interdental filler model may be generated based on the set of arcs.
Medical software tools platforms utilize a surgical display to provide access to specific medical software tools, such as medically-oriented applications or widgets, that can assist surgeons or surgical team in performing various procedures. In particular, an endoscopic camera may register the momentary rise in the optical signature reflected from a tissue surface and in turn transmit it to a medical image processing system which can also receive patient heart rate data and display relevant anomalies. Changes in various spectral components and the speed at which they change in relation to a source of stimulus (heartbeat, breathing, light source modulation, etc.) may indicate the arrival of blood, contrast agents or oxygen absorption. Combinations of these may indicate various states of differing disease or margins of tumors, and so forth. Also, changes in temperatures, physical dimensions, pressures, photoacoustic pressures and the rate of change may indicate tissue anomalies in comparison to historic values.
A memory device includes a first and second conductor respectively included in a first and second layer stack stacked in a first direction and separated from each other; a first and second portion of a semiconductor extending in the first direction between the first and the second layer stack, and separated from each other in same layer; a first film between the first conductor and the first portion; a second film between the second conductor and the second portion; a first insulator between the first conductor and the first film; a second insulator between the second conductor and the second film; a third insulator between the first insulator and the first film; and a fourth insulator between the second insulator and the second film. The third and fourth insulator have a higher dielectric constant than the first and second insulator.
A head immobilization system for immobilizing a patient's head in a supine position of the patient includes a support rail structure adapted to be coupled to a patient rest. The system can further include a mask frame adapted to be coupled to at least one deformable upper mask sheet. The mask frame is releasably connected to the support rail structure via a first interface section and a second interface section, with at least two pins protruding from the first interface section in a first direction, and at least two pin-receptions provided at the second interface section. Each one of the pin-receptions receives one of the pins. A catch-mechanism for each pin-reception and each corresponding pin allows the pin to be pushed further into the pin-reception in the first direction, but interlocks in case of an attempted withdrawal of the pin from the pin-reception in a second, opposite direction.
The invention describes a novel implementation of ultrasound or OCT technology to approximate the dimensions of fluid-filled structures (when using ultrasound technology) or other structures (when using OCT technology). The invention in a preferred embodiment is an elongated member such as a catheter that uses ultrasound or OCT technology to approximate the dimensions of a structure into which the catheter has been placed. In a preferred embodiment, the catheter includes multiple ultrasound transducers arranged in an annular or circumferential configuration on, embedded into or within the body of the elongated member so that distance measurements can be obtained between the elongated member and the wall of the immediately facing structure (e.g., a fluid-filled lumen). Utilizing these measurements, the present invention approximates for the physician the shape and size of the structure into which the elongated member is placed. The invention also includes a method for producing three-dimensional images from two-dimensional images.
A device for editing a panoramic radiography image of an examination object generated by a panoramic X-ray machine, including: an input interface for receiving the panoramic radiography image as well as reconstruction data of the panoramic radiography image, the reconstruction data including information on a course of projection lines of the panoramic radiography image between an X-ray source and an X-ray detector of the panoramic X-ray machine as well as information on an image surface of the panoramic radiography image; an evaluation unit for evaluating the reconstruction data and for determining an image section of the panoramic radiography image that has been generated on the basis of one of the projection lines with two intersection points with the image surface; an image editing unit for editing the panoramic radiography image based on the determined image section; and an output unit for outputting the edited panoramic radiography image.
Various methods and systems are provided for breast positioning assistance during mammography and image guided interventional procedures. In one example, a sensor detection system is utilized to evaluate one or more of a patient position, a breast position, and breast anatomy to determine if the patient and breast are adjusted to desired positions preferred for a desired view and imaging procedure prior to acquiring x-ray images, with real-time feedback provided to guide the user to position the breast and/or the patient based on the evaluation. The evaluation is performed by an artificial intelligence (AI) model stored on the x-ray mammography system that is trained using sensor data obtained from imaging procedures performed using the x-ray mammography system and fashioned into training datasets by a training module located on the x-ray mammography system. The datasets are supplied to the AI model without any transmission of the datasets exteriorly of the mammography system.
An apparatus for estimating cardiovascular information includes: a main body; and a strap connected to the main body and formed to be flexible to be wrapped around an object, wherein the main body may include: a pulse wave measurer configured to measure, from the subject, a first pulse wave signal by using a first light of a first wavelength, and a second pulse wave signal by using a second light of a second wavelength, the first wavelength being different from the second wavelength; a contact pressure measurer configured to measure a contact pressure between the object and the pulse wave measurer; and a processor configured to extract a cardiovascular characteristic value based on the first pulse wave signal, the second pulse wave signal, and change in the contact pressure, and estimate cardiovascular information based on the extracted cardiovascular characteristic value.
A prosthesis for monitoring a characteristic of flow includes a first tubular prosthesis having a lumen and a sensor for detecting the characteristic of flow through the lumen. The sensor may be covered with another tubular prosthesis or by a layer of material in order to insulate the sensor from the fluid flow. A pocket may be formed between the tubular prosthesis and the adjacent layer of material or prosthesis and the sensor may be disposed in the pocket.
A method for determining a driving intention of a user in a vehicle using electroencephalography (EEG) signals, comprising:
acquiring (100) a plurality of EEG signals on a user in the vehicle,
determining (101, . . . , 104) a plurality of features of the EEG signals,
for each feature of the EEG signals, performing (111, . . . , 114′) a respective preliminary soft classification process, so as to obtain a plurality of preliminary soft predictions of driving intention each based on a feature of the EEG signals,
performing (120) a soft classification process based on the plurality of preliminary soft predictions so as to obtain the driving intention of the user.
An inventive medical system has a housing with a first guiding surface. A preassembled module is received in the housing. The module includes electronics electrically connected to an analytical sensor, an insertion component configured for inserting the analytical sensor into body tissue of a user and a sterility cap at least partially surrounding the insertion component. The module has a second guiding surface. A protective cap is removably connected to the housing and covers the preassembled module. The protective cap is removable from the housing by pulling the protective cap from the housing. The first guiding surface guides the protective cap during the pulling of the protective cap from the housing and the second guiding surface guides the sterility cap during pulling the sterility cap from the insertion component. The length of the first guiding surface exceeds the length of the second guiding surface.
A continuous blood glucose measurement body attachment unit is manufactured in an assembled state in an applicator so as to minimize additional operations, such that the body attachment unit can be attached to the body with only a simple operation of the applicator. The body attachment unit has a wireless communication chip so as to be capable of communicating with an external terminal, thereby enabling simple and convenient usage without an additional operation in which a separate transmitter must be connected and enabling maintenance to be more easily performed, and after the body attachment unit is attached to the body, an operation starts by the control of a user, such that an operation start time point can be adjusted to an appropriate time point according to the needs of the user, and an operation can start in a stabilized state, such that blood glucose can be more accurately measured.
A smart monitoring system comprising a plurality of sensor devices coupled to appliances and fixtures within a dwelling environment, where at least one of the plurality of sensor devices comprises sensor elements including an accelerometer. The system further comprising a computing device operative to receive event signals from the plurality of sensor devices, identify a possible fall event from one or more of the plurality of sensor devices based on the event signals, sample sensor data from one or more of the plurality of sensor devices wherein the sensor data includes measurements of movement. The computer device is further operative to determine a fall has occurred based on the sampled sensor data, sample additional sensor data from the one or more of the plurality of sensor devices for additional motion at a period of time subsequent to the possible fall event, and determine a recovery from the fall based on the additional sensor data.
Systems and methods for prompting a user to perform an exercise and monitoring the exercise are provided. Multiple independent sensors or sensor systems may be used to calculate energy expenditure. Various criteria may be used to manually or automatically select the independent sensor or sensor system or combination that will be used with the energy expenditure calculations.
The invention relates to a method for determining at least one state variable of the organism of at least one farm animal, wherein at least one probe device for measurement of at least one physical parameter is disposed in the gastro-intestinal tract of the farm animal and at least one evaluation unit is disposed outside the gastro-intestinal tract of the farm animal. The method performs the following steps: determining at least one first physical parameter by the probe device; converting the first physical parameter into a first state variable of the organism of the farm animal in a probe control unit of the probe device; transmitting the first state variable by the probe device to the evaluation unit; and converting the first state variable into a second state variable in the evaluation unit.
A pressure sensor configured for biological pressure measurement at a distal end portion of an elongated member comprises a dissolvable hydrophilic material coated on a surface of the pressure sensor. A guide wire for biological pressure measurement may include a tube extending along a longitudinal axis of the guide wire; and a pressure sensor for biological pressure measurement, at least a portion of the pressure sensor being mounted within the tube. The pressure sensor comprises a pressure sensor membrane facing a top side of the tube. A circumferential wall of the tube includes at least six openings: a first distal opening, a second distal opening located on a right side of the tube, a third distal opening located on a left side of the tube, a first proximal opening, a second proximal opening located on a right side of the tube, and a third proximal opening located on a left side of the tube. The first distal opening is larger than the second and third distal openings, and the first proximal opening is larger than the second and third proximal openings.
Systems are provided for generating data representing electromagnetic states of a heart for medical, scientific, research, and/or engineering purposes. The systems generate the data based on source configurations such as dimensions of, and scar or fibrosis or pro-arrhythmic substrate location within, a heart and a computational model of the electromagnetic output of the heart. The systems may dynamically generate the source configurations to provide representative source configurations that may be found in a population. For each source configuration of the electromagnetic source, the systems run a simulation of the functioning of the heart to generate modeled electromagnetic output (e.g., an electromagnetic mesh for each simulation step with a voltage at each point of the electromagnetic mesh) for that source configuration. The systems may generate a cardiogram for each source configuration from the modeled electromagnetic output of that source configuration for use in predicting the source location of an arrhythmia.
Monitoring of one or more key indicators can provide powerful insights into the operation and state of different physical systems. For example, continuous monitoring of multiple analytes in a subject allows for detailed insights into personal health as well as allowing for the implementation of preventative health measures. Herein are described design and processing methods for a small wireless multi-analyte sensing platform that can be used to monitor multiple analytes such as glucose, lactate, Urea and other physicochemical quantities. The design techniques and processing methods presented herein can be used for a multitude of other applications and are not limited to those described here.
An optical measurement system comprising an optical source configured for delivering sample light in an anatomical structure, such that the sample light is scattered by the anatomical structure, resulting in physiological-encoded signal light that exits the anatomical structure, an optical detector configured for detecting the physiological-encoded signal light, and a processor configured for acquiring a TOF profile derived from the physiological-encoded signal light, the initial TOF profile having an initial contrast-to-noise ratio (CNR) between a plurality of states of a physiological activity in the anatomical structure. The processor is further configured for applying one or more weighting functions to the initial TOF profile to generate a weighted TOF profile having a subsequent CNR greater than the initial CNR between the plurality of states of the physiological activity. The processor is further configured for processing the weighted TOF profile, and identifying one of the plurality of states of the physiological activity.
Techniques for monitoring control points of a computer-assisted device include one or more articulated arms having one or more control points and a control unit coupled to the one or more articulated arms. Each control point of the one or more control points is located based on a kinematic configuration of the one or more articulated arms. The control unit is configured to determine, during a movement of a table that causes a change in the kinematic configuration of the one or more articulated arms, an actual spatial configuration of the one or more control points; determine, based on a comparison of the actual spatial configuration with an expected spatial configuration of the one or more control points, whether to perform a remedial action; and perform the remedial action in response to a determination to perform the remedial action.
A robotic arm according to various implementations includes: a tool driver configured to hold a surgical tool; a first section comprising a first end coupled to a base, a second end distal from first end; a first link that includes a motor configured to rotate at least a portion of the first section around a pitch axis; a second link coupled to the first link, the second link including a motor configured to rotate at least a portion of the first section around a roll axis; and a second section comprising: a first end coupled to the second end of the first section, a second end distal from the first end, a first link that includes a motor configured to rotate at least a portion of the second section around a roll axis, a second link coupled to the first link.
A computer-implemented method and a system for computer guided surgery, which include a transposition of an action, planned in a virtual environment with respect to a virtual referential RP, to a physical action performed with a surgical tool in a real operating theatre environment for orthopedic surgery of a patient.
An electrosurgical apparatus and method for performing thermal treatment in the gastrointestinal tract, e.g. to ablate duodenal mucosal tissue. The apparatus comprises an instrument having a flexible cable and an applicator suitable for use with a gastroscope, which can be deployed within a patient to delivery energy in a targeted or otherwise controllable manner. The applicator can deliver microwave energy by radiation. The direct and depth-limited nature of microwave energy can be make it more effective than treatments that rely on thermal conduction. The applicator may include a radially extendable portion arranged to move an microwave energy delivery structure into contact with duodenal mucosal tissue at the treatment region. The applicator may comprise any of a balloon, bipolar radiator, movable paddle, and rotatable roller element.
A bipolar electrosurgical device is disclosed that operates in a mechanical cutting mode and a hemostasis mode. The device includes a housing and a blade assembly extending from the housing. The blade assembly forms a cutting tip and cutting window at a distal end region to provide mechanical cutting of tissue and first and second electrode assemblies to provide electrical energy to tissue. The first electrode assembly includes an outer shaft defining a first electrode surface and the second electrode assembly includes an electrode body extending along and electrically isolated from an outer shaft and defining a U-shape in cross section.
A device for providing a magnetic treatment by evoking muscle contraction by a time-varying magnetic field and providing a RF treatment by heating biological structure. The device may provide a pressure treatment. The device includes an applicator having an RF electrode and a magnetic field generating device. The device may also include a main unit, a human machine interface, and a control unit. The control unit adjusts a signal provided to the RF electrode and creates an RF circuit, and also adjusts the signal provided to the magnetic field generating device and creates a magnetic circuit electrically insulated from the RF circuit. The RF circuit may include a power source and a power amplifier, and the magnetic circuit may include an energy storage to supply the magnetic field generating device with electric current.
A bone plate according to an exemplary aspect of the present disclosure includes, inter alia, a body portion. The body portion includes a first slotted portion extending at least partially through the body portion and a plurality of teeth adjacent the first slotted portion for engaging a driver in the first slotted portion. The body portion also includes a second slotted portion extending at least partially through the body portion and a ramped portion at least partially surrounding the second slotted portion. The ramped portion tapers from an outer surface of the body portion toward an inner surface of the body portion.
A surgical clip pack includes a frame configured to engage a portion of a surgical access device. The frame includes a storage compartment and an annulus defining a lumen that has a diameter at least as large as a diameter of an opening of the surgical access device. A receptacle is disposed within the storage compartment and is configured to house a surgical fastener.
An apparatus includes a handle assembly having a body, a shaft assembly having an outer tube member, an end effector, an anvil, a first trocar closure system, and a second trocar closure system. The end effector has having a staple deck fixed relative to the body, a staple driver operable to actuate relative to the staple deck between an unfired position and a fired position, and the trocar configured to selectively couple with the anvil and actuate relative to the staple dreck. The first trocar closure assembly can actuate in a first motion to drive the trocar between a distal position and a first closed position. The second trocar closure assembly can actuate in a second motion between the first closed position and a second closed position. The staple drive is inoperable at least until the first trocar closure assembly actuates the trocar to the first closed position.
A system for interchangeable retractor blades includes a shell, a first retractor blade, and a second retractor blade. The shell includes a rigid proximal end configured to attach to a surgical retractor and an opening, a distal closed end, and a pliable portion including a pocket in communication with the opening and extending along a length of the shell to the distal closed end. The first retractor blade includes a first geometry received through the opening into the pocket and that shapes the pliable portion to configure the shell in a first configuration. The second retractor blade includes a second geometry received through the opening into the pocket and that shapes the pliable portion to configure the shell in a second configuration.
A control device includes: a processor configured to obtain a first picture signal and a second picture signal, calculate first ranging information based on the first picture signal, calculate second ranging information based on the second picture signal, estimate a first subject distance corresponding to the first ranging information, estimate ranging information corresponding to a second focal position, perform arithmetic processing to determine degree of reliability of the first ranging information, and output a result of the arithmetic processing.
An imaging system includes a lighting controller for independently controlling emission of illumination light to be emitted by a light source in: (i) a non-all-line exposure period, which contains a reading period in which electrical signals are sequentially read out on a horizontal-line basis from an image sensor for one frame or one field period, and in which at least one horizontal line of the horizontal lines for the one frame or the one field period is not exposed to light, and (ii) in an all-line exposure period, in which all of the horizontal lines for the one frame or the one field period are exposed to light.
An ultrasound endoscope includes an insertion part including a distal end part having an ultrasound transducer array of ultrasound transducers, a cable inserted into the insertion part, and a substrate, including electrode pads, that electrically connects the ultrasound transducers and the cable, and is disposed in the distal end part. The cable has a non-coaxial cable including a first cable bundle consisting of signal wires and ground wires, and a first shield layer with which the first cable bundle is coated, and an outer coat with which a second cable bundle consisting of the non-coaxial cables is coated. Each first cable bundle is individually led out from the cable, and each signal wire of the first cable bundle is led out and electrically bonded to the corresponding electrode pad. The ultrasound endoscope further includes a fixing part that fixes relative positions of the substrate and each first cable bundle.
A cleaner includes: a suction motor that generates suction force; a dust separation unit that separates dust from air sucked by the suction force; a motor housing that covers the suction motor; a flow guide that surrounds an outer side of the motor housing and guides air discharged from the dust separation unit to the suction motor; and a body that forms an external appearance by surrounding the flow guide and guides air discharged from the suction motor together with the flow guide.
The present invention is a drinking straw washing machine with a washing region, a sanitizing region, a straw retaining track, and a motor assembly. The washing region comprises a washing cogwheel rotatably positioned therein that receives straws via the straw retaining track. The washing cogwheel and sanitizing cogwheel are oriented parallel to the straw retaining track. The motor assembly is mechanically coupled to the washing cogwheel and thereby rotates the washing cogwheel to guide straws along the straw retaining track and through a cleaning solution included in the wash region. the sanitizing region comprises a sanitizing cogwheel rotatably positioned therein that receive straws from the washing region via the straw retaining track. The motor assembly is mechanically coupled to the sanitizing cogwheel and thereby rotates the sanitizing cogwheel to guide straws along the straw retaining track, through a sanitizing solution in the sanitizing region, and out of the sanitizing region.
A system for ascertaining fresh water consumption by an, in particular, commercial dishwasher (1) or a component thereof. The system includes a container (12, 22) for temporarily storing liquids, wherein the container (12, 22) has a liquid inlet (25), which can be flow-connected to a fresh water source if required, and a liquid outlet (23), which can be flow-connected to a freshwater consuming means, in particular a freshwater consuming means of the dishwasher (1), if required. The system further includes at least one pressure sensor (B3, B4) for detecting an, in particular, hydrostatic pressure in the container (12, 22), and an evaluation device which is designed to ascertain a fresh water volume flow into the container (12, 22) depending on at least one output value of the at least one pressure sensor (B3, B4).
A dishwasher is disclosed. When the dishwasher performs a drying process, the dishwasher increases a temperature of a washing space before air inside the washing space is discharged, thereby maintaining the temperature of the washing space at an appropriate drying temperature and increasing efficiency of the drying process.
A squeeze mop comprises a mop head having a central head region secured relative to a handle and a pair of cleaning pad supports which are pivotally located relative to the central head region and movable towards one another to compress the cleaning pad material therebetween, the mop head further comprising biasing means to rotate the two pad supports away from the position at which the cleaning pad material is compressed between the pad supports, said biasing means comprising an elongate elastomeric element the two ends of which are secured to a respective one of the two cleaning pad supports and wherein the head region comprises a platform section for engagement by the elastomeric element, said platform section being located closer to the handle than the at least one position about which the pad supports are pivotally located relative to the head region.
Provided are a cleaning robot and a control method thereof. The control method of the cleaning robot including a first rotation member and a second rotation member each performing a rotational motion around a first rotation axis and a second rotation axis according to the present disclosure includes: obtaining acceleration of the cleaning robot and at least one of rotational loads and rotational speeds of the respective first and second rotation members, during driving of the cleaning robot; determining whether the obtained acceleration is abnormal and whether at least one of the obtained rotational loads or at least one of the obtained rotational speeds is abnormal; and determining that an obstacle is detected when the acceleration is determined to be abnormal and at least one of the rotational loads or at least one of the rotational speeds is determined to be abnormal.
A display device (3) on a liquid dispenser (1), the display device having at least one display element (4) and a drive device (5) for moving the display element (4) between an initial position and a display position. The drive device (5) is provided with an interface (6), via which the drive device (5) can be connected to a dispensing device (2) of the liquid dispenser (1) such that the drive device (5) is automatically activated by the actuation of the dispensing device (2) of the liquid dispenser (1).
A prefabricated shower pan for installation on an installation site having a waste outlet hole includes a drain hole configured to communicate with the waste outlet hole of the installation site via a drain assembly, a shower pan floor having a slated surface towards the drain hole, at least one side wall surrounding and supporting at least a portion of the circumference of the shower pan floor, and an accommodation space disposed below the drain hole and configured to accommodate the drain assembly for connecting the drain hole in the shower pan floor and the waste outlet hole at the installation site, and the accommodation space extends to the at least one side wall, and an optional side wall opening is disposed at the at least one side wall.
The invention relates to a corn dog mold device comprised of an upper half and a lower half that attach to one another in a snap-like fashion via a plurality of protrusions. The upper half has a convex area and the lower half has a concave area that receive the upper and lower portions of a corn dog, and wherein each half has a semi-circular opening that allows the stem of a corndog to extend outwards from the halves. To use the device, a corn dog can be battered and both halves can be secured to each other with the battered corn dog within the device. The device can be placed within a freezer for 3 to 5 minutes to allow the shape of the battered corn dog to settle before cooking, wherein after 3 to 5 minutes the corn dog can be removed from the device and then fried.
A lid assembly for use with a micro puree machine including a lid, a clip mechanism, and a release mechanism. The defines an axis. The clip mechanism is movable between an inward position and an outward position relative to the axis of the lid. The release mechanism is positionable relative to the clip mechanism between a home position and a release position and is operable to move the clip mechanism between the inward position and the outward position. At times the release mechanism is positioned toward the home position, the clip mechanism is moved toward the inward position. At times the release mechanism is positioned toward the release position, the clip mechanism is moved toward the outward position. The clip lever is operable to cause the clip mechanism to engage with or disengage from the blade assembly during installation and removal of bowl assembly from a micro puree machine.
In a beverage pod arranged for use in a beverage forming machine to make a beverage, the beverage pod has a container with an interior space, and with a beverage material located in the interior space. The beverage material is usable to form a beverage by interaction of the beverage material with a pressurized liquid introduced into the interior space upon initiation of a mixing process. The beverage pod further includes a turbulent flow creating structure in the interior space to cause mixing of the beverage material and pressurized liquid relative to the container, in response to a pattern of water jets exiting the turbulent flow creating structure so as to saturate and mix the beverage material.
Embodiments provide a beverage capsule, a brewing device, and a beverage dispenser. The beverage capsule comprises an inner cup, an outer cup and a sealing film, and the top edge of the inner cup is provided with an inner cup outward flange, which fits with the top edge of the circumferential wall of the outer cup to form a ring surface seal, and has an outward extension part that extends to the outer side of the outer cup in the radial direction, and the sealing film seals the top opening of the inner cup. In such an arrangement, the beverage capsule can form a tear opening between the inner cup outward flange and the top edge of the circumferential wall of the outer cup by means of a film tearing mechanism acting in a tearing form.
An improved reusable containers system having a first threaded means located on the top of the containers and a second threaded means located on the bottom of the container. The container has an opening on top. The bottom of the container can be either open or closed. The various accessories can be attached to the threaded means. The containers can be secured to one another to create various configurations. Further, there are various accessories which can be secured to the threaded means for special applications.
A seat connection mechanism and a seat employing that mechanism where the mechanism is constructed from a combination of metal, for example extruded or cast, plastic bushings and plastic covers to create a fully enclosed tilt mechanism for seats which is reliable, easy to maintain and allows for easy removal of seats for repair thereof so long as the person removing the seat knows the removal process. Thus vandalism is inhibited and a relatively economical bracket and seat is provided with substantial durability and reliability.
A harness assembly for carrying a hunting tree stand includes a first upper strap having a first end portion, a second end portion, and an intermediate portion disposed between the first and second end portions: A second upper strap includes a first end portion, a second end portion, and an intermediate portion disposed therebetween. An upper strap buckle is coupled to the first end portion of the first upper strap and the first end portion of the second upper strap. A bridging strap includes a first end portion and a second end portion. The first end portion is coupled to the intermediate portion and is also coupled to the intermediate portion, such that an adjustable loop is formed by the bridging strap, the first end portion of the first upper strap, the upper strap buckle, and the first end portion of the second upper strap.
A lip balm container, including a housing having a dial to rotate a gear to extend and retract a gear strip. The gear strip is in communication with a lip balm tube at least partially retained within the interior of the housing, wherein rotating the dial permits the extension and retraction of a lip balm disposed within the lip balm tube. A lid pivotally engaged, via a hinge, with the housing to enclose the lip balm within the housing.
A contact lens package includes a base having a proximal end and a distal end, a solution well between the proximal end and the distal end, a contact lens support in the solution well, a top opening between the proximal end and the distal end and over the contact lens support, and a via through a wall of the base adjacent the well, the via providing a fluid exit for solution within well. A removable lid overlying the top opening may be removably affixed over the top opening such that a user may remove the lid to access the contact lens. Using this package, fluid can be drained away from the contact lens in the package before removal from the package by a user, thus providing good adhesion between a user's finger or applicator and the lens over prior packaging.
A running shoe with a lateral side, a medial side, a heel section, a forefoot section, and a midfoot section. A front end of the forefoot section forms a toe box and a rear end of the heel section forms a heel counter. The running shoe includes a sole and an upper, wherein the upper has a textile main material. The running shoe has tightening bands with at least one compressing tightening band and tensioning bands with at least one compressing tensioning band. The tightening bands are arranged in the heel section and in the midfoot section of the running shoe and in the forefoot section. At least one tightening band is configured to exert an inwards-directed compression force when the shoe is worn and is configured to run along a non-expanding line (line of non-extension) of the foot of the wearer when the shoe is worn.
A shoe has a main body, an ankle strap, plantar bridge, and a toe loop connected to the main body. The main body wraps around the dorsal instep area of the foot and the plantar bridge wraps around the plantar midfoot area of the foot, without covering the ball, the plantar metatarsals, the heel, or the toes. The ankle strap is attached at its ends to the main body and extends around the back of the foot above the heel for constraining the main body from forwarding movement. The toe loop surrounds one of the toes and connects with the main body from above the foot, for constraining the main body from rearward movement.
A system may include a bottom layer and a sensing layer disposed on a first side of the bottom layer. The first sensing layer may include a first sensing element and a second sensing element. The first sensing element and the second sensing element may include one of: a force sensing element, a strain sensing element, a motion sensing element, or an environmental sensing element. The first sensing element and the second sensing element may be of a different type of sensing element. The system may also include a communications interface configured to couple the sensing layer with a host controller.
A footwear article includes a hinged portion in a heel region that may be biased in various positions to increase or decrease a size of a foot-insertion opening. The hinged portion may be arranged in a first position, in which the hinged portion is more upright and is in position to cup a wearer's heel or Achilles region when the footwear article is worn. In addition, the hinged portion may be rotated downward or rearwardly (e.g., away from the foot-insertion opening) to a second position, which may increase a size of the foot-insertion opening and/or may change an angle along which a foot can pass through the foot-insertion opening when the footwear article is being donned or doffed. One or more elastic members may be attached to the hinged portion and to some other portion of the footwear article to bias the hinged portion.
Articles of footwear having an upper that includes a tensile support structure are described. The tensile support structure is formed by a plurality of strands that are arranged in a chain-linked configuration. The chain-linked arrangement of the strands assists with distributing tensile forces over portions of the upper of the article of footwear and helps to conforms the upper to a foot of a wearer upon the application of tension.
An article of footwear may include an upper and a sole structure secured to the upper. The sole structure includes a midsole, an outsole secured to the midsole, and one or more plates positioned within the midsole. Each of the plates has a downwardly-facing concave side and an upwardly-facing concave side. The downwardly-concave side may be positioned on a medial side (or a lateral side) of the footwear, and the upwardly-concave side may be positioned on the lateral side (or the medial side) of the footwear. The undulating medio-lateral configuration of each plate may increase the overall support provided to a wearer's foot during a side-to-side or “banking” movement.
A fluid-filled chamber is provided and includes a first barrier layer, a second barrier layer, a foam structure, and a tensile member. The second barrier layer is secured to the first barrier layer to define an interior void between the first barrier layer and the second barrier layer. The interior void contains a predetermined volume of fluid. The foam structure and the tensile member are disposed within the interior void, whereby the tensile member includes a plurality of fibers extending in a first direction between the first barrier layer and the second barrier layer.
Disclosed are belt adjustment systems, particularly for wearing around a user's waist, that permit a continuum of belt loop sizes or a larger selection of belt loop sizes. The belt adjustment system includes an elongate belt member having a first end, a second end and a series of teeth positioned on an inner surface near the second end and a fixation member having first and second adjustment elements.
A waistband of an article of clothing including an inner fabric layer, and an outer fabric layer integrally formed or coupled with the inner fabric layer. The waistband also includes a mesh layer disposed between the inner and outer fabric layers. The waistband further a first adhesive layer and a second adhesive layer disposed between the mesh layer and the inner fabric layer, and configured to couple the mesh layer with the inner fabric layer.
The present invention discloses a shark resistant composite fabric that has an outer layer of a woven or knitted shark bite resistant fabric material; an intermediate layer neoprene. An inner layer of a woven or knitted shark bite resistant fabric material may also be provided.
A protective apparel support system is disclosed comprising a support frame configured to rest on the shoulders of a wearer, the support having a first shoulder member, a second shoulder member and a shield engagement portion. A shield is selectively coupleable to the support and protective apparel is coupled to the shield.
A mask apparatus includes a mask body including an air duct disposed at a front surface of the mask body, and a fan module mounting portion disposed at a suction-side of the air duct, a fan module disposed at the fan module mounting portion and configured to supply external air to the air duct, a mask body cover that is coupled to the front surface of the mask body and covers the fan module and the air duct, a seal coupled to a rear surface of the mask body and configured to contact a user's face and define a breathing space for the user, a sealing bracket that fixes a portion of the seal to the rear surface of the mask body, and a pad configured to be disposed inside the breathing space.
A wearable airbag device for protecting the hip of a wearer includes an airbag that is formed of a sheet material having flexibility and is adapted to be put on a circumference of the pelvis of the wearer. The airbag is inflatable with an inflation gas. The airbag includes: a mounting portion that is adapted to be disposed at a region to be wrapped around the pelvis at airbag deployment; two protecting portions each of which is configured to extend downward from the mounting portion and cover an outer side of a targeted body part of the wearer at airbag deployment, the targeted body part being left and right trochanters of femurs; and a means for suppressing each of the protecting portions from expanding and floating away from the targeted body part at the lower end at deployment of the protecting portion.
A test fixture for testing aerosol provision devices may include one or more testing modules including a cavity configured to receive a portion of an aerosol provision device, processing circuitry operably coupled to the one or more testing modules, and an impedance-based interface module configured to detect insertion of the aerosol provision device into the test fixture and automatically transition the aerosol provision device to a locked state. The processing circuitry may be configured to provide a transition signal to the aerosol provision device to transition the aerosol provision device between the locked state and an unlocked state during a functional test controlled by the processing circuitry.
Provided is a method of controlling a temperature of a heater of an aerosol generating device based on temperature and humidity. The method includes detecting an external temperature and an external humidity of the aerosol generating device; determining a temperature profile of the heater; outputting a plurality of adjustment values; determining an adjustment value from among the plurality of adjustment values based on a user input; fine-tuning the temperature profile based on the determined adjustment value; and controlling power supplied to the heater based on the fine-tuned temperature profile, wherein at least one of the temperature profile and the plurality of adjustment values is determined based on at least of the external temperature and the external humidity.
An aerosol generating device and system determine whether an aerosol generating substance is separated from the aerosol generating device based on an amount of change in inductance while power is blocked from being supplied to a heater.
Systems for tamper proofing vapor device e-liquid tanks are provided. The systems comprise tanks with one or more irremovable Radio Frequency Identification tags (RFID) tags. The tanks are used in conjunction with vaping devices that are equipped with a wireless RFID scanner and a processor. The tank may include a memory device with authentication data and a partial wired circuit segment connected thereto. The vape device may also include a wired a circuit segment connected to the processor and a battery. The two wired circuit segments are connected together physically and electrically to form a complete circuit when the tank makes physical contact with the vape device. The connection allows the processor to periodically read the memory device to ensure the tank is not replaced with an adulterated tank after the RFID tag(s) enable the heating element.
An electronic vaporizing device has an air flow tube passing through a liquid storage chamber (210). The air flow tube has a plurality of micro-openings (122). A thin film heating element (121) is provided on an inner wall of the air flow tube. A plurality of micro-openings in the thin film heating element (121) are aligned with the plurality of micro-openings in the airflow tube to provide a flow of liquid from the liquid storage chamber (210) to the thin film heating element (121).
An aerosol-generating device for generating an inhalable aerosol is provided, the aerosol-generating device including: a heating chamber configured to receive an aerosol-generating article containing an aerosol-generating substrate; and a heating element disposed in the heating chamber, material of the heating element being configured to penetrate into the aerosol-generating article, and the material of the heating element including one or more of a shape memory alloy, a shape memory polymer, and a shape memory ceramic. A method for generating an inhalable aerosol with an aerosol-generating device is also provided.
There is provided an apparatus arranged to heat aerosol-generating material to volatilize at least one component of the aerosol-generating material. The apparatus includes a housing including a first opening and a chamber including a first section and a second section. A first consumable article including aerosol-generating material can be inserted through the first opening to be received within the first section of the chamber in use. The apparatus further includes a heater arrangement within the housing for heating the aerosol-generating material received within the first section of the chamber in use to generate a flow of aerosol. The second section of the chamber is upstream of the first section of the chamber and is configured to receive a second consumable article comprising a flavorant.
Disclosed are an aerosol generating article and an aerosol generating device, wherein the aerosol generating article includes a tobacco rod and a cooling segment configured to cool aerosols generated from the tobacco rod through a tobacco composition.
An aerosol generation device includes a case into which a cigarette is to be inserted; a protrusion pipe of a hollow shape protruding from one end portion of the case and having an opening; a heater installed in the case such that an end portion thereof is positioned inside the protrusion pipe, and configured to generate heat when an electric signal is applied thereto; and a heater fixing portion installed inside the protrusion pipe to support the heater and comprising a round surface that extends from an inner side surface of the protrusion pipe.
The present invention is direct to an edible composition in which fruit, vegetables and/or nuts, in conjunction with a hydrocolloid, are treated with pressure and/or heat to form an edible composition that is dimensionally stable, ambient stable for at least 12 months, has a moisture content greater than 50 wt. %, has a pH less than 4.5, has a water activity greater than 0.5, is commercially sterile, is free of artificial flavors, has a solids content greater than 10 wt. %, and does not exhibit syneresis. Also provided is a method for preparation of the edible composition.
The present invention provides the use of a composition obtainable from the pulp of a plant in the theobroma genus or an extract of said pulp, as an ingredient in a chocolate product.
Provided is a powdered green tea extract composition, including the following components (A) to (C): (A) non-polymer catechins; (B) quinic acid; and (C) a polysaccharide, wherein the powdered green tea extract composition has a volatile content of 5.6 mass % or less, wherein a mass ratio between the component (A) and the component (B), [(B)/(A)], is less than 0.2, wherein amass ratio between the component (A) and the component (C), [(C)/(A)], is 1.2 or more, wherein, when an absolute value (Δa*) of a difference between an a* value in an L*a*b* color system of the powdered green tea extract composition after storage under an atmosphere of 37° C. and 50% RH for 6 weeks and an a* value in the L*a*b* color system of the powdered green tea extract composition immediately after production is obtained, the Δa* of the powdered green tea extract composition is a value less than Δa* of a powdered green tea extract composition α which has the same mass ratio [(B)/(A)] as the mass ratio [(B)/(A)] of the powdered green tea extract composition, and which is free of the component (C), and wherein a change rate calculated by the following expression (2) is 5% or more: (Δa*−Δa1*)/Δa*×100 (2) where Δa1* and Δa* have the same meaning as Δa1* and Δa* described in Description.
A processing apparatus that includes: a pump; a microwave chamber; and at least one solid-state radio frequency source. The pump pumps a diary product through the microwave chamber; the solid-state radio frequency source includes one or more antennas and/or waveguides; the processing apparatus has a sensor and a control system, the sensor is configured to measure at least one property of the dairy product and at least one property of radiation reflected from the diary product, and a signal from the sensor is utilized by the control system to control the solid-state radio frequency source; a chamber is arranged between the microwave chamber and the solid-state radio frequency source so that the solid-state radio frequency source is free from contacting a wall of the microwave chamber, the chamber is cooled by a cooling unit that is configured to cool the radio frequency source.
The present invention relates to the use of compound (A) according to formula (I) having the chemical name: 3-chloro-5-(trifluoromethyl)pyridine-2-carboxylic acid) for inducing positive growth responses in plants, a composition comprising compound (A) and a new method of plant treatment wherein is compound (A) applied to a plant, a plant part, plant propagation material or the habitat the plant is growing in to induce positive growth responses.
A selectively adjustable and lockable utility mount is used to mount a device to a stable structure. The utility mount includes a hydraulic lock that applies the locking force that maintains the locked condition of the utility mount. Mounting brackets for utility mounts have spaced-apart mount elements that engage a surface of a stable structure. Some configurations of mounting bracket include mount elements that are movable between stored conditions and deployed conditions. The stored conditions reduce the size of the device to make it more convenient to pack. A climbing stick uses the storable mount elements.
The invention provides genetically modified non-human animals that express chimeric human/non-human T cell co-receptor polypeptides (e.g., CD4, CD8α, CD8β), as well as embryos, cells, and tissues comprising the same. Also provided are constructs for making said genetically modified animals and methods of making the same.
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
This application provides: a non-human animal that comprises a mouse artificial chromosome comprising a human antibody heavy chain gene or gene locus, a human antibody light chain κ gene or gene locus, and/or a human antibody light chain λ gene or gene locus, and in which endogenous antibody genes or gene loci corresponding to at least 2 human antibody genes or gene loci have been knocked out, wherein the animal can be stably retained through generations and can produce human antibodies; a method for producing the non-human animal; and a method for producing human antibodies using the non-human animal.
An aquarium with a digital display including a fish tank assembly, a screen assembly and a fastening assembly. Container assembly has a cuboid shape with a top opening and has a watertight seal. The container is configured to hold water. Screen assembly includes a digital display removably attached to a rear side of the container, wherein the digital display is capable of projecting elements of multimedia. Digital display is further configured to be operatively connected to a wireless device, thereby the digital display is actuated by means of the wireless device. Fastening assembly includes top clamps and bottom clamps, wherein are configured to attach the digital display to the rear side of the container by means of adjustable apertures of the top clamps and bottom clamps.
A novel maize variety designated X15R410 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X15R410 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X15R410 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X15R410, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X15R410 are provided. Methods for producing maize varieties derived from maize variety X15R410 and methods of using maize variety X15R410 are disclosed.
A crop baler with a stuffer flywheel mass for baling a crop, the baler comprising: a supporting frame that can be moved across a field; a crop pick-up configured to pick up the crop from a ground of the field; a conveyor configured to convey the crop picked up by the crop pick-up; a pressing chamber having a stuffer configured to compress the crop conveyed into the pressing chamber by the conveyor into a form of a bale; and a drive for producing a reciprocating movement of the stuffer, the drive further comprising a flywheel mass with a variable moment of inertia.
A hay bale fork assembly includes a pair of hydraulic cylinders that is each connected to a rear end of a tractor. A pair of mounting brackets is each pivotally coupled to a respective first lateral side and a second lateral side of the tractor having each of the mounting brackets extending away from the rear end of the tractor. Each of the mounting brackets is pivotally attached to a respective one of the hydraulic cylinders for urging the mounting brackets between a lifted position and a lowered position. A lifting fork is coupled between each of the mounting brackets. The lifting fork has a first tine that is disposed on the lifting fork to penetrate a first hay bale. The lifting fork has a pair of second tines each being disposed on the lifting fork to penetrate a second hay bale.
Electronic soil coping system applied to a grain harvesting platform, able to adjust working height parameters during the collection process, adapting itself to soil irregularities and to those generated by uprooting, increasing the efficiency and reducing loss, enabling to combine belt collection at any time, individually, in pairs, or all of them jointly, generating different physical states, which will vary according to the number of belts of the device, also allowing the platform to perform tailpieces at street ends, not collecting undesired materials, and also allowing to increase the width of collection belts.
A self-propelled picking vehicle for pineapples based on scraper transportation is provided and includes a baseplate, a driving mechanism, and a propelling mechanism. The driving mechanism is disposed on the baseplate, the propelling mechanism is disposed at a lower end of the baseplate, and the driving mechanism is connected to the propelling mechanism. A front end of the horizontal chain conveyor is provided with a cutting plate. The cutting plate is provided with two disk blades, outer sides of the two disk blades are provided with dividers, and a fruit protector is disposed between the two disk blades. A fruit picking mechanism is disposed on an upper end of the fruit protector. The entire process has achieved automated pineapple picking, efficiency of picking and transportation is improved, and labor intensity of fruit farmers is greatly reduced.
One or more information maps are obtained by an agricultural work machine. The one or more information maps map one or more agricultural characteristic values at different geographic locations of a field. An in-situ sensor on the agricultural work machine senses an agricultural characteristic as the agricultural work machine moves through the field. A predictive map generator generates a predictive map that predicts a predictive agricultural characteristic at different locations in the field based on a relationship between the values in the one or more information maps and the agricultural characteristic sensed by the in-situ sensor. The predictive map can be output and used in automated machine control.
In a riding mower having a frame, a mower deck supported beneath the frame, a chair on said frame and a source of motive power also supported on said frame and including two hydraulic transaxles depending beneath the frame to each selectively rotate a drive wheel. The frame is supported on forward and rear wheel assemblies with a supporting wheel. The transaxles are supported beneath the frame and pivotally secured thereto by a flange captivating vibration pillows and proximate the driven wheel and an inner pivot rod secured to the frame by apertures in downwardly depending tabs.
A MRAM device includes a substrate, a first bottom electrode, a first MTJ stack, a first spacer, a topography-smoothing layer and a second ILD layer. The substrate includes a first ILD layer having a metal line. The first MTJ stack is over the first bottom electrode. The first spacer surrounds sidewalls of the first MTJ stack. The topography-smoothing layer extends over a top surface of the first ILD layer, along sidewalls of the first bottom electrode the first spacer. The topography-smoothing layer has a top portion over the first MTJ stack and a first side portion laterally surrounding the first spacer. The first side portion has a maximal lateral thickness greater than a maximal vertical thickness of the top portion. The second ILD layer is over the topography-smoothing layer and has a material different from a material of the topography-smoothing layer.
A magnetic memory according to an embodiment includes: a first wiring and a second wiring; a nonmagnetic conductor extending in a first direction; a first magnetic member including a first portion electrically connected to the first wiring and a second portion electrically connected to the second wiring, the first magnetic member extending in the first direction from the first portion to the second portion to surround the nonmagnetic conductor; an insulation portion disposed between the nonmagnetic conductor and the first magnetic member; and a controller electrically connected to the nonmagnetic conductor, the first wiring, and the second wiring.
Compounds that are organic radicals that can have a dual function. The compounds can be fluorescent emitters that emit in the near-IR. The compounds can also facilitate reverse intersystem crossing (RISC) to convert triplet excitons in an OLED to singlet excited states to maximize utilization of generated excitons in the OLED and approach 100% internal quantum efficiency.
An organic light emitting device including a first electrode; a second electrode provided to face the first electrode; and an organic material layer having one, two or more layers provided between the first electrode and the second electrode, wherein the organic material layer includes a first organic material layer including a compound of Chemical Formula 1 and a second organic material layer including a compound of Chemical Formula 2.
The present invention relates to a compound represented by the formula (1):
wherein R1 to R4 and L1 to L4 are those defined in the specification, and Ar is the following formula (A) or (B):
wherein R11 to R18 and R20 to R29 are those defined in the specification, and Ar is one defined in the specification.
The present invention concerns a method for deposition layers of an electronic device by slot-die deposition. Preferably, the method comprises slot-die deposition of formulation for providing compact inorganic layers, mesoporous inorganic layers, a carbon layer and a layer comprising organic-inorganic perovskite. In a preferred embodiment, the layers of a monolithic perovskite solar cell are entirely deposited by slot-die deposition. The method renders the manufacturing process of such electronic devices more efficient.
A display module includes a display panel including a plurality of pixels, a carrier panel on a rear surface of the display panel, and an adhesive layer disposed between the display panel and the carrier panel, where the adhesive layer is in contact with the carrier panel. Lateral surfaces of the adhesive layer are recessed from lateral surfaces of the carrier panel.
A method of manufacturing a display device includes forming a light emitting structure on a substrate and forming a thin film encapsulation layer on the light emitting structure by chemical vapor deposition equipment. The forming the thin film encapsulation layer includes forming a first inorganic layer and performing a first plasma treatment on a first portion of the first inorganic layer which is opposite to a second portion of the first inorganic layer facing the light emitting structure. A first raw material in the forming the first inorganic layer includes hydrogen. A second raw material in the performing the first plasma treatment exclusively consists of hydrogen.
An organic light emitting diode (OLED) automatic production equipment is provided. The OLED automatic production equipment includes a vapor deposition device, a printing device, a sputtering device, a flexible packaging device, and a thin film packaging device. The thin film packaging device is in communication with the vapor deposition device, the printing device, the sputtering device, the flexible packaging device, and the like. Processors of the vapor deposition device, the printing device, the sputtering device, and the flexible packaging device are configured to perform two-way communication with a processor of the thin film packaging device.
An electronic device includes a display panel that includes a plurality of light emitting elements, and an input sensor disposed on the display panel and that includes a plurality of mesh patterns. The mesh patterns include a plurality of openings formed therein and spaced apart from each other in a first direction and a second direction that crosses the first direction. The mesh patterns include a plurality of conductive patterns spaced apart from each other in a direction that cross the first and second directions, where a center opening of the plurality of openings is disposed therebetween, and a plurality of mesh lines disposed along an edge of the center opening and connected to the conductive patterns. Each of the conductive patterns includes at least one cut-away portion opened toward one of the openings.
A touch display device can include a touch electrode implemented using a material and disposed on a transmissive area of a subpixel. The touch electrode can be disposed easily in a display panel which a transmittance is high. Furthermore, a short circuit prevention electrode can be disposed between a second electrode of a light-emitting element and the touch electrode to reduce a defect occurrence of the touch electrode in a process, and various types of touch sensing function can be provided or a performance of a touch sensing can be improved by using the short circuit prevention electrode as an electrode performing a certain function.
A light emitting display device includes a substrate, a pixel area having an emission area and a non-emission area on the substrate, a light emitting diode disposed in the pixel area, and a pixel driving circuit electrically connected with the light emitting diode and having a driving thin film transistor disposed in the emission area, wherein light emitted from the light emitting diode can be emitted to the outside of the substrate by passing through the substrate.
A light emitting diode display apparatus includes: a substrate; a driving element region which is formed on the substrate and in which a plurality of driving elements are arranged in a matrix form; and an emitting element region in which a plurality of emitting elements are arranged in a matrix form, wherein the emitting element includes a first electrode which corresponds to each driving element and is electrically connected to each driving element, a second electrode corresponding to the first electrode, and an emitting layer located between the first electrode and the second electrode, wherein an area of the emitting element region is greater than an area of the driving element region.
A display device includes a plurality of first electrodes electrically connected to pixel circuits disposed on a substrate; a pixel defining layer defining a plurality of opening regions, each of the opening regions exposing a portion of each of the first electrodes; a plurality of light emitting layers respectively disposed on the first electrodes in the opening regions; a second electrode covering the light emitting layers and the pixel defining layer; an encapsulation layer disposed on the second electrode; and a plurality of light blocking patterns disposed on the encapsulation layer between the opening regions adjacent to each other in a first direction.
The present disclosure provides a display panel, a manufacturing method thereof and a display device. The display panel includes a base substrate, a TFT array, a pixel definition layer, and a plurality of light-emitting units. The display panel further includes a plurality of spacers arranged on a surface of the pixel definition layer away from the base substrate, the plurality of spacers is formed integrally with the pixel definition layer, a surface of each spacer away from the base substrate includes a first portion and a second portion, a distance between the second portion and the base substrate is smaller than a distance between the first portion and the base substrate, and a ratio of a sum of areas of the first portions of the plurality of spacers to an area of a display region of the display panel is not smaller than a preset threshold.
An organic light-emitting diode display is disclosed. In one aspect, a semiconductor layer is on a substrate, and the semiconductor layer is non-linear. A gate metal line is on the semiconductor layer, and an insulating layer covering the semiconductor layer and the gate metal line and having a plurality of contact holes connected to the semiconductor layer. A data metal line is on the insulating layer and electrically connected to the semiconductor layer via a selected one of the contact holes. An OLED is electrically connected to the gate metal line and the data metal line, and the semiconductor layer includes a narrow semiconductor layer having a first width and an expansion semiconductor layer formed adjacent to the selected contact hole and having a second width greater than the first width.
A display panel includes a substrate including a first opening and a second opening that are spaced apart from each other, a plurality of pixels located in a display area around the first opening and the second opening, each of the plurality of pixels including a pixel circuit including a first thin-film transistor, and a display element connected to the pixel circuit, a bottom metal layer located between the substrate and the first thin-film transistor, emission control lines located on the substrate, extending in a first direction and spaced apart from each other by the first opening and the second opening, and a first conductive layer located in an intermediate area surrounding each of the first opening and the second opening to bypass the first opening and the second opening.
An electronic device is provided. The electronic device includes a substrate having an edge, an active region located on the substrate, a convex portion disposed between the edge and the active region, a first inorganic layer disposed on the substrate and the convex portion, a second inorganic layer disposed on the first inorganic layer, wherein the first inorganic layer directly contacts the second inorganic layer at an end which is located between the convex portion and the edge, and an organic layer disposed between the first inorganic layer and the second inorganic layer, and between the end and the convex portion.
A memory device includes: a first interconnect; a second interconnect; a first string and a second string whose first ends are coupled to the first interconnect; a third string and a fourth string whose second ends are coupled to the second interconnect; a third interconnect; and driver. The third interconnect is coupled to second ends of the first and second strings and to first ends of the third and fourth strings. Each of the first, second, third, and fourth strings includes a first switch element and a memory cell coupled in series. The memory cell includes a second switch element and a resistance change element coupled in parallel. The third interconnect is coupled to the driver via the first interconnect or the second interconnect.
A novel memory device is provided. Over a driver circuit layer, N memory layers (N is a natural number greater than or equal to 2) including a plurality of memory cells provided in a matrix are stacked. The memory cell includes two transistors and one capacitor. An oxide semiconductor is used as a semiconductor included in the transistor. The memory cell is electrically connected to a write word line, a selection line, a capacitor line, a write bit line, and a read bit line. The write bit line and the read bit line extend in the stacking direction, whereby the signal propagation distance from the memory cell to the driver circuit layer is shortened.
Provided is a conformal electromagnetic interference (EMI) shielding film including a thermal-forming film layer and an electrically conductive film layer. The thermal-forming film layer is configured to conformally coat over one or more electronic components mounted on a substrate with application of heat. The electrically conductive film layer is formed on an opposite side of the thermal-forming film layer from the substrate and has a plurality of voids that are configured to deform during the application of heat and allow the electrically conductive film layer to conform together with the thermal-forming film layer.
The device consists of a container manufactured from a metamaterial with the property of transparency to visible light, for the holding of electrical or electronic devices, which electromagnetically protects the same and renders them electromagnetically undetectable. The purpose of the device is to guarantee user confidentiality in the use of the electromagnetic waves associated with telecommunications, by means of the use of a type of container that encloses any type of telecommunication device or appliance, with the potentiality that the insertion thereof into said container prevents the detection by means of electromagnetic waves of said appliance, and therefore makes impossible the tracing of said appliance by electromagnetic remote sensing means, including mobile telephony, radiofrequencies, or satellite telecommunication means such as GPS, Galileo, or other systems, without it being necessary to switch off said appliance beforehand.
A window includes a base layer and a hard coating layer on the base layer. The hard coating layer includes a first layer on the base layer and of a first thickness, and a second layer on the first layer and of a second thickness. The second layer includes an antistatic agent. The hard coating layer has a hardness reduction rate of 50 percent (%) or less expressed as follows.
H
=
(
1
-
D
1
D
2
)
×
100
In the equation above, H is a hardness reduction rate (%) of a target layer, D1 is a hardness reduction rate measured from the target layer at a temperature of 60 degrees Celsius (° C.) with a relative humidity of 93%, and D2 is a hardness reduction rate measured from the target layer at a room temperature with a relative humidity of 30%.
A display apparatus including display panel, a rear case to cover a rear of the display panel and the rear case including a cable fixing hole to which a cable is fixed, a connector connected to the cable and fastened to the rear case so that the cable is connected to the rear case, a cable holder to surround a part of the cable and fixed to the cable fixing hole so that the cable is fixed to the rear case, and a clamp to fix the cable holder to the cable fixing hole, wherein the clamp includes a first hook to be fixed to the cable fixing hole, and a second hook having a different shape than a shape of the first hook and to be fixed to the cable fixing hole to have a greater fixing force than a fixing force of the first hook.
A sliding display apparatus comprises a display panel including first to fourth side surfaces, a case configured to accommodate the display panel, a cover configured to cover an opened upper surface of the case and including a hole provided at one side thereof, a wire driving part connected to at least one wire connected to a lower surface of the display panel, and a sliding controlling part configured to control the wire driving part, and an upper portion of the display panel is exposed through the hole provided at the cover.
A rollable display device according to one aspect of the present invention comprises: a roller; a display unit which is rolled around the roller, and which comprises a display panel and a module cover that is laminated on the display panel so as to face same; a link assembly for moving the display unit upward and downward; and a motor assembly for driving the link assembly, wherein the module cover can comprise: a module cover having a yield strain of 0.5% or higher; and a film part which is laminated on the module cover and which has an elongation rate higher than that of the module cover.
Provided is a power conversion device, including: a casing that has a front surface with an opening; an insertion component including an insertion portion; and a gasket. The casing has an inner wall surface being in contact with the gasket and a casing-side guide surface. The insertion portion has an outer peripheral surface being in contact with the gasket and an insertion component-side guide surface. When a distance in the insertion direction between the front surface and an end of the casing-side guide surface, which is closer to the front surface in the insertion direction, is represented by L1 and a distance between an inner surface of the gasket in the insertion direction and a distal end of the insertion component-side guide surface in the insertion direction is represented by L2, the distance L2 is set larger than the distance L1.
A bonding apparatus includes a vacuum holder and a thermal head. The vacuum holder is configured to attach a non-bonding area of a printed circuit board. A side of the vacuum holder has a first lower sidewall, a first upper sidewall, and a first connection surface adjoining the first lower sidewall and the first upper sidewall. The thermal head is adjacent to the vacuum holder and configured to hot press a bonding area of the printed circuit board. A side of the thermal head proximal to the vacuum holder has a second lower sidewall, a second upper sidewall, and a second connection surface adjoining the second lower sidewall and the second upper sidewall. The second connection surface overlaps at least a portion of the first connection surface, and a height of the second lower sidewall is greater than a height of the first lower sidewall.
Method for forming a metal film includes forming an oxide layer on a to-be-treated surface of a to-be-treated object by bringing the to-be-treated surface into contact with a reaction solution containing fluorine and an oxide precursor, removing fluorine in the oxide layer, supporting a catalyst on the oxide layer by bringing the oxide layer into contact with a catalyst solution, and depositing a metal film on the oxide layer by bringing the oxide layer into contact with an electroless plating liquid.
An example electronic device includes a housing, a first board and a second board disposed in an interior of the housing and disposed to face each other in a first direction, an interposer extending to surround an interior space between the first board and the second board, a first conductive layer disposed to face the first board and including a first conductive area, a second conductive layer disposed to face the second board and including a second conductive area, an insulation layer disposed between the first conductive layer and the second conductive layer, a first insulation part disposed between the first conductive layer and the first board and covering the first conductive area, a second insulation part disposed between the second conductive layer and the second board and covering the second conductive area, a first plating area extending from the first conductive layer to the second conductive layer, on a first side surface of the insulation layer, and a second plating area extending from the first conductive layer to the second conductive layer, on a second side surface of the insulation layer.
The present disclosure provides a circuit board arrangement comprising a main board comprising at least one longitudinal cutout, at least one reinforcing plate arranged in the at least one longitudinal cutout and mechanically coupled to the main board, wherein the plane of main extension of the main board is arranged perpendicular to the plane of main extension of the at least one reinforcing plate. Further, the present disclosure provides a differential probe circuit and a respective method.
Enhanced components and assemblies for connector-less radio frequency (RF) interconnect systems are provided. One example includes two circuit boards each with a broadside coupling feature comprising a tapered circuit board trace having a terminal portion. The circuit boards are positioned in close proximity to establish a desired gap, and a dielectric material is positioned within the gap between circuit boards. The broadside coupling features of the circuit boards are then configured to convey RF signals over the gap without electrical contact.
Disclosed are aspects of apparatuses and methods of fitting a cooling device to a circuit board for cooling a high-power electronic component mounted on the circuit board. Cooling apparatuses, and arrangement thereof, are also described. The method provides the cooling device with a cooling surface having a cooling area for thermally connecting to a to-be-cooled surface of the electronic component. Fixing elements are provided for moving the cooling surface towards the circuit board. A distance position “d” of the to-be-cooled surface from the circuit board is determined, and on this basis spacer elements are selected to be interposed between the cooling device and the circuit board to limit the movement by the fixing elements to a position where the cooling area is in proximity to the to-be-cooled surface.
The present invention discloses that a plasma aerosol device includes a gas tunnel, a dielectric barrier discharge module, and a liquid tunnel. The invention uses a mechanism similar to a dielectric barrier discharge (DBD) electrode system, thus to enable generating a plasma active water mist which riches in free radicals such as reactive nitrogen species (RNS) and reactive oxygen species (ROS). Therefore, this invention is able to be used in medical, sterilization, agriculture and preservation industries.
Apparatuses, methods, systems, and techniques for providing special effects wirelessly using a device plugged into a standard electrical outlet are provided. Example embodiments provide an apparatus and associated software applications for remote and live control of special effects (hereinafter a “Remote Special Effects System,” or “RSES”) using special effect (SE) devices such as individually addressable LEDs, LED strips, fog and smoke machines, and the like. The example RSES described herein comprises one or more SE controller devices that each plug into a standard electrical outlet and are each connected to one or more SE devices. Each SE controller is wirelessly connected to the Internet (or other wide area network) so that it can respond to DMX (or other protocol) commands sent by a remote application by issuing corresponding commands specific to the connected SE device to cause synchronized special effects to occur to an ad-hoc created zone of SE controllers.
This LED driving device comprises: a DC/DC controller which controls an output stage for supplying an output voltage to an LED; and a current driver which generates an output current of the LED, wherein the current driver performs PWM dimming by turning on the output current in accordance with an LED-current-on period of a PWM dimming signal and turning off the output current in accordance with an LED-current-off period of the PWM dimming signal, and the DC/DC controller includes a feedback control unit which performs feedback control for outputting a switching pulse to the output stage so as to make a cathode voltage of the LED equal to a reference voltage, and a pulse addition control unit which performs pulse addition control for adding a predetermined pulse number of additional switching pulses at a time of switching between the LED-current-on period and the LED-current-off period.
The LED electronic display board system according to the present invention comprises first to Mth sub-controllers 2-1, 2-2, . . . , 2-M (here, N and M are a natural number), each of which comprises first to Nth LED modules 1-1, 1-2, . . . , 1-N, to control the first to Nth LED modules 1-1, 1-2, . . . , 1-N; and a main controller 3 which is connected to the first to Mth sub-controllers 2-1, 2-2, . . . , 2-M to control the first to Mth sub-controllers 2-1, 2-2, . . . , 2-M, wherein the first to Mth sub-controllers 2-1, 2-2, . . . , 2-M each further comprise a constant current roller 20 and a variable resistance block 21, and the constant current controller 20 adjusts a resistance value of the variable resistance block 21 according to a signal of the main controller 3 to adjust the size of current.
A lighting fixture includes a fixture housing. A circuit board is positioned in the fixture housing. The circuit board includes a driver circuit. A plurality of light emitters are disposed on the circuit board. The light emitters are operatively connected to the driver circuit to produce a light output. A temperature sensor is disposed on the circuit board, the temperature sensor configured to measure a temperature of the circuit board and output a signal. The driver circuit is configured to reduce the light output in response to the signal from the temperature sensor.
A remote follow spot system includes a remote controller that has separately movable parts that are movable in two orthogonal directions, and a display attached to one of said two separately movable parts. The display receives a video feed from a controlled light, that is controlled to move in the same directions as remote controller. The display hence shows the field of view where the light is pointing. In this way, an operator of the follow spot can control the light without physically being near the light.
A data collection system includes a cart to carry one or more data collection devices, the cart having a body with a top surface; a first compartment cut through a thickness of the body, the first compartment to receive a first data collection device; and an opening to receive a handle, the handle can be used to maneuver the cart; a computing device in wireless communication with the first data collection device; the computing device receives data from the first data collection device, the data related to a floor surface.
In an aspect of the disclosure, a method, a computer-readable medium, and an apparatus are provided. The apparatus may be a UE. The apparatus may be configured to receive a request for UE capability information from a network. The apparatus may be further configured to transmit, in response to the request, UE capability information indicating a first set of value pairs associated with monitoring occasions for a control channel of at least one first component carrier and a second set of value pairs associated with monitoring occasions for a control channel of at least one second component carrier, and each of the first and second sets of value pairs may include a first value corresponding to a minimum time separation between consecutive spans for the monitoring occasions and a second value corresponding to a span length for the monitoring occasions.
Techniques for establishing communication channels between user devices experiencing network connectivity issues and remote communication systems are described herein. The techniques include the use of a secondary device to act as a proxy, or a “middle man,” to facilitate the communications with the user device. A user device may detect lack of network connectivity, and begin broadcasting advertisement messages that indicate the lack of connectivity. A secondary device may detect the advertisement message, and send a discovery message to a connectivity system indicating that it detected the advertisement message. The connectivity system can provide this information to a remote communication system, and the remote communication system can establish a connection with the secondary device and instruct the secondary device to establish a connection with the user device. The remote communication system then has a communication channel with the user device, using the secondary device, to troubleshoot the user device.
A method for configuring radio resources distributed in communication nodes of a communication network is provided. Each communication node includes radio resources. The method includes collection, for each of said radio resources, of configuration parameters, and of at least one parameter representing a level of reception by this radio resource; detection, from said radio-resource configuration parameters collected and from at least one of the parameters representing a reception level, of a common configuration parameter value and a proximity between a radio resource of a first communication node and a radio resource of a second communication node from the communication nodes, of such a nature as to cause interference in communications between and first and second communication nodes, and then a configuration of at least one radio resource of the second communication node with a new configuration. The value of the common configuration parameter is absent from the new configuration.
The present disclosure relates to the field of communications and provides a data transmission method for sidelink communication and a device. The method can include a first Internet-of-vehicle device that determines a destination reception geographical location of a user data packet and generates a MAC PDU corresponding to the user data packet. The MAC PDU can carry the destination reception geographical location. The first Internet-of-vehicle device encodes and modulates the MAC PDU to obtain physical layer data, and sends the physical layer data on a target time-frequency resource. A second Internet-of-vehicle device compares the destination reception geographical location carried by the MAC PDU to determine whether to receive the user data packet.
A communication system for a vehicle includes a controller adapted to selectively execute an alternative periodic connectivity mode for communication between a user of the vehicle and a remote assistance unit. The vehicle is not connected to a wireless plan. The controller has a processor and tangible, non-transitory memory on which instructions are recorded. The alternative periodic connectivity mode is activated based in part on at least one automatic trigger and/or a request from the user. The controller is adapted to assign a distinct identifier to the vehicle during execution of the alternative periodic connectivity mode. The distinct identifier is defined by a plurality of parameters, including a connection time interval, an internet protocol address range and a host port. The internet protocol address range and the host port may be dynamically configured to remain disengaged unless given a system clearance.
This present disclosure discloses example random access resource configuration methods, mediums, and apparatuses. One example method includes receiving, by a first network device, configuration information of a first physical random access channel (PRACH) resource. Location adjustment information is received by the first network device, where the location adjustment information is used to indicate to adjust a location of at least a part of the first PRACH resource. A second PRACH resource is determined by the first network device based on the configuration information of the first PRACH resource and the location adjustment information. A random access request is sent by the first network device to a second network device on the second PRACH resource.
Methods, systems, and devices for generating preambles in mobile communication technology are described. An exemplary method for wireless communication includes transmitting, by a network node, a configuration for random access comprising a value indicative of a number of Zadoff-Chu (ZC) sequence roots (M) and a number of repetitions (N), and receiving, from a wireless device, a random access preamble, wherein the random access preamble comprises M concatenated ZC sequences with different roots, and wherein each of the M concatenated ZC sequences is repeated based on N.
A method for random access in a communication network may include detecting a first candidate beam at a UE, detecting a second candidate beam at the UE, transmitting, from the UE, one or more first messages of a random access procedure, and indicating, by the one or more first messages, the first candidate beam and the second candidate beam. Another method for random access in a communication network may include detecting a first candidate beam at a UE, detecting a second candidate beam at the UE, receiving, at the UE, traffic information for the first candidate beam and the second candidate beam, selecting the first candidate beam based on the traffic information, and transmitting, based on the selecting, a first message of a random access procedure using the first candidate beam. The traffic information comprises load information.
Systems, devices, and techniques for wideband operations in unlicensed spectrum are described. A described technique receiving, by a user equipment (UE), a schedule for transmitting on a Physical uplink shared channel (PUSCH) over at least a portion of a plurality of listen-before-talk (LBT) subbands of a bandwidth part (BWP) in an unlicensed spectrum. The scheduled PUSCH bandwidth indicated by the schedule can be greater than a unit bandwidth of a LBT subband. The technique includes performing, by the UE, a LBT procedure on each scheduled LBT subband of the plurality of LBT subbands, each of the scheduled LBT subbands being associated with the scheduled PUSCH bandwidth. The technique includes performing, by the UE, a PUSCH transmission in accordance with the schedule that uses one or more of the scheduled LBT subbands that have passed the LBT procedure.
A network node (206) and a method for transmitting uplink grants to a communications device (208), wherein the communications device operates in a service area (206a) served by the network node. The network node determines, based on a load measure on a Physical Random Access Channel, PRACH, between the network node and the communications device in relation to a load threshold, a number of uplink grants that are to be associated with a Random Access Preamble Identity, RAPID, of a PRACH preamble transmission received from the communications device. Further, the network node indicates the determined number to the communications device; and transmits the determined number of uplink grants to the communications device.
Provided is a method for a user equipment (UE). The UE obtains a physical uplink control channel (PUCCH) secondary cell (SCell) activation command from a primary cell (PCell) or primary secondary-cell-group cell (PSCell). The PUCCH SCell activation command is used for an PUCCH SCell activation of a target PUCCH SCell for the UE. The UE performs PUCCH SCell activation operations associated with a valid timing advance (TA) and the PUCCH SCell activation command. TA is considered to be a valid TA when the TA meets a preset criterion. The UE generates a channel state information (CSI) report for transmission to at least one of the PCell, PSCell and the target PUCCH SCell. The CSI report indicates that the PUCCH SCell activation is completed.
Described are a method for transmitting a signal, a network device and a terminal device. The method includes: sending, by a first terminal device, second indication information to a second network device, wherein the second indication information is used for indicating a capability of the first terminal device to receive a signal through a first frequency band and/or interference information of interference caused by a second frequency band to a first frequency band; wherein the first frequency band is a new radio (NR) carrier, and the second frequency band is a long term evolution (LTE) carrier; and receiving, by the first terminal device, signals sent by a first network device within the first frequency band.
Disclosed herein are new radio (NR) Data link architecture options including, for example, NR radio bearer models, NR logical channel models, and MAC and HARQ models. Further described are packet flows mapping to data radio bearers (DRBs), and a new flow encapsulation protocol in the user plane. In some embodiments, DRBs with different quality of service (QOS) are pre-established, but not activated. This allows a given user equipment (UE) to use these DRBs for packet data network (PDN) flows without a large overhead. Pre-established DRBs can be an extension to default bearer concept with the decision of pre-establishment of DRBs based on UE capability, subscription profile, operation policy, installed apps, etc.
A wireless device may be instructed to activate a cell. The wireless device may activate a cell and start a timer. The wireless device may receive downlink control information (DCI). The DCI may indicate monitoring of a downlink control channel or may indicate a resource grant. The wireless device may monitor the downlink control channel and start another timer. The wireless device may receive the resource grant while one or more timers are running.
Methods, systems, and devices for a downlink control signaling in wireless communication are described. A wireless communication method is provided to comprise transmitting, by a network device, to a user device, a control signaling including N data blocks that indicate T triggering states of M user devices, and wherein N, T, and M are natural numbers and the triggering states indicate configuration information of the M user devices.
A method and a device for transmitting data are provided. The method includes that a user equipment (UE) detects at least two target Physical Downlink Control Channels (PDCCHs), where each PDCCH carries target Downlink Control Information (DCI) for scheduling a target UE. Additionally, when the target DCI is detected on a target PDCCH, the UE receives downlink data sent by access network equipment to the target UE as scheduled by the target DCI.
Methods and apparatuses are described herein for Intra-UE Prioritization in uplink (UL) transmissions. In an example, an apparatus may receive first information indicating a first uplink grant associated with a first transmission and second information indicating a second uplink grant associated with a second transmission. The apparatus may determine, based on the first information and the second information, that the first transmission and the second transmission overlap at least partially in time. The apparatus may determine a first priority associated with the first transmission and a second priority associated with the second transmission. The apparatus may then cause, based at least in part on the first priority and the second priority, at least one of: prioritization of one transmission over another transmission, or preemption of the first transmission by the second transmission.
A method and apparatus for transmitting and receiving a signal in a wireless communication system, according to an embodiment of the present invention, comprise the steps of: receiving an SIB including information on a PUCCH resource; transmitting a PUCCH on the basis of the information on the PUCCH resource in a state in which user equipment does not have dedicated PUCCH resource configuration; and after an RRC connection is established, monitoring the PDCCH on the basis of a configured DRX operation. The information on the PUCCH resource may include information on the number of PRBs of the PUCCH resource.
A user equipment (UE) is described. The UE includes a higher layer processor configured to determine a multiplexing location of an ultra-reliable low-latency communication (URLLC) uplink control information (UCI) on an enhanced mobile broadband (eMBB) physical uplink shared channel (PUSCH). The UE also includes transmitting circuitry configured to perform multiplexing of the URLLC UCI on the eMBB PUSCH.
Methods, systems, and devices for wireless communications are described. A first user equipment (UE) may be configured to transmit a first sidelink control information (SCI) message associated with a first sidelink transmission from the first UE, the first SCI including a first indication of a first set of resources reserved for retransmissions of the first sidelink transmission at one or more retransmission occasions. The UE may identify a second SCI message associated with the first SCI message, where the second SCI provides a release of at least a first subset of the first set of resources reserved for the retransmissions of the first sidelink transmission. The UE may then perform retransmissions of the first sidelink transmission in accordance with the release.
Downlink data scheduling HARQ-ACK codebook feedback and generation methods and devices, and a medium are provided. The method comprises: determining whether a first HARQ-ACK codebook transmitted by a user terminal is detected; when the first HARQ-ACK codebook is not detected, delivering DCI for triggering retransmission of the first HARQ-ACK codebook to the user terminal, wherein the DCI for triggering retransmission of the first HARQ-ACK codebook comprises a first trigger group number field, the first trigger group number field is the same as a first scheduling group number field, the first trigger group number field is used for indicating a number of the first trigger group, and the first scheduling group number field is used for indicating a number of the first scheduling group; and receiving the first HARQ-ACK codebook retransmitted by the user terminal. The solution can indicate HARQ-ACK codebook feedback of a discontinuous downlink data scheduling group.
Systems and techniques related to allocating resources for a user equipment (UE) via downlink control information (DCI) in a wireless communication system. Specifically, a UE receives, from a base station, a radio resource control (RRC) message including list information associated with a plurality of time-domain resource allocation (TDRA) tables, and receives, from the base station, a DCI in order to be allocated a resource on a time domain. Here, the resource in the time-domain is allocated according to one TDRA table among the plurality of TDRA tables, based on the DCI and the one TDRA table is selected among the plurality of TDRA tables, based on a configuration of the DCI or a field included in the DCI.
The present disclosure discloses a method by a terminal transmits an uplink (UL) signal in a wireless communication system. In particular, the method comprises: determining an energy detection (ED) threshold value on the basis of maximum effective isotropic radiated power (EIRP) from among at least one of pieces of first EIRP for at least one first UL signal; acquiring channel occupancy on the basis of the ED threshold value; and, within the channel occupancy, (i) transmitting the at least one first UL signal on the basis of each of at least one of pieces of first EIRP for each of the at least one first UL signal, and (ii) transmitting a second UL signal on the basis of second EIRP, wherein the second EIRP is less than or equal to the maximum EIRP.
Methods and apparatuses for determining an assignment of frequency channels to radios of a spectrum access system are provided and which result in at least one of: (a) an enhanced transmit power-bandwidth product or an enhanced probable transmit power-bandwidth product for all radios, (b) diminished interference between radios of different nodes, and (c) diminishing changes to frequency channels either requested by or previously assigned to radios.
Provided are a resource indication method, a resource indication apparatus, a data receiving method and a data receiving apparatus. The resource indication method includes transmitting first indication signaling to a terminal; where the first indication signaling includes reserved time domain resource information used for indicating that reserved time domain resource are not allowed to be used for transmission.
Methods, systems, and devices for wireless communications are described. A user equipment (UE) may transmit a first safety message associated with the UE. The first safety message may be transmitted according to a first periodicity of a set of transmission periodicities for safety message transmissions. The UE may select a second periodicity of the set of transmission periodicities based on one or more environmental conditions associated with the UE. The UE may transmit a second safety message associated with the UE according to the second periodicity of the set of transmission periodicities based at least in part on selecting the second periodicity. The one or more environmental conditions may include topological information, road information, or visibility information. The UE may select the second periodicity based on one or more parameters associated with the UE.
The present application relates to devices and components including apparatus, systems, and methods to identify resources for body position sensing and utilize the resources for body position sensing operations via user equipment of a wireless communication system.
Disclosed is a 5G or pre-5G communication system for supporting a data transmission rate higher than that of a 4G communication system such as LTE. According to an embodiment of the present invention, a method of a terminal in a wireless mobile communication system comprises the steps of: receiving data network information including data network access permission region information and data network identification information; checking whether the terminal enters a data network access permission region, on the basis of the data network information; and performing a data network access procedure on the basis of the checking result.
Handling of asynchronous multi-carrier is discussed. In new radio (NR) fifth generation (5G) networks, the potential for provision of multi-carrier operations (e.g., carrier aggregation (CA), dual connectivity (DC), etc.) that include asynchronous component carriers (CCs) has been proposed. However, because of the asynchronous relationship network entities, such as base stations and user equipments (UEs) will manage the asynchronous CCs by obtaining timing offset information, either through derivation or direct signaling, and determining a subframe correspondence based on the timing offset relative to a reference CC. By determining the subframe correspondence to the reference CC, the base stations and UEs can accurately map communications over the asynchronous CCs to the appropriate subframes across CCs.
A system, method and apparatus for configuring a node in a sensor network. A sensor service can enable sensor applications to customize the collection and processing of sensor data from a monitoring location. In one embodiment, sensor applications can customize the operation of nodes in the sensor network via a sensor data control system.
An optimizable beacon and method of using the same. The beacon has an onboard power source with a finite capacity. The system uses a capacitor bank to adjust the capacitance of the beacon, thereby maximizing the signal provided considering conditions, rather than simply using a theoretical value. With the specified capacitance being used, the beacon may be optimized in both a high and low power mode by driving the current to ensure the measured power is greater than or equal to a target. The system may also have a motion sensor to toggle the power off, or to a low-power mode, when the beacon is moving, and location measurements are not taking place. The optimization process may also consider the chemistry of the battery being utilized.
Presented herein are techniques for using mobile client density to compensate for variations in path loss between neighboring access points. In one example, a device (e.g., wireless controller) determines one or more mobile client density variation trends in a wireless network location and determines one or more neighbor message power variation trends between at least first and second access points within the wireless network location over a time period. The device generates one or more correlation bias factors using the mobile client density variation trends and the neighbor message power variation trends over the time period. The device determines a path loss between at least the first and second access points using the correlation bias factor.
A method, a User Equipment, a computer program and a computer readable medium for determining a transmission power of an uplink transmission. The method includes: determining, by a User Equipment (UE), a Reference Signal (RS) resource index providing a periodic RS resource; calculating, by the UE, a downlink pathloss estimate using the RS resource index; determining, by the UE, the transmission power of the uplink transmission based on the downlink pathloss estimate.
Systems and methods for high power uplink transmission are disclosed. In one aspect, a mobile device includes an antenna configured to transmit radio frequency signals to a base station via an uplink and receive radio frequency signals from the base station via a downlink and a front end system coupled to the antenna. The front end system is configured to transmit and receive the radio frequency signals from the antenna, and duplex the radio frequency signals via frequency division duplexing. The front end system is further configured to transmit data on the uplink at a first power level that is higher than a predetermined level and at a finite duty cycle.
A communications device configured to receive signals from an infrastructure equipment of a wireless communications network is provided. The communications device is configured to periodically switch, in accordance with a first periodic rate, between a primary active operating mode and a primary reduced power operating mode in accordance with a primary discontinuous reception, DRX, operation. In some embodiments, the communications device is configured in combination with the receiver to monitor for signals transmitted by the infrastructure equipment to the communications device during the primary active operating mode, to switch off the receiver during the primary reduced power operating mode, and to start, during an instance of the primary active operating mode upon detection of a first downlink transmission from the infrastructure equipment to the communications device, an inactivity timer specifying an inactivity period during which the communications device does not switch into the primary reduced power operating mode.
This disclosure provides a method for reporting interface availability, a method for indicating interface availability, and a device. The reporting method includes: reporting, by an access AS layer, availability information of a target interface of a first terminal device to an upper layer; where the availability information includes at least one of first information, second information, third information, fourth information, and fifth information; the first information includes availability of the target interface; the second information includes link information that the availability of the target interface is applicable to; the third information includes time information that the availability of the target interface is applicable to; the fourth information includes information about a sidelink resource selection mode the availability of the target interface is applicable to; and the fifth information includes information about a current sidelink resource selection mode of the first terminal device.
Methods for email-based e-commerce using SMS and social media and for an e-commerce stock management system are disclosed. A method for email-based e-commerce using SMS includes receiving, via a social media network, a request from a customer to make a payment via email; generating a first email message that includes a mailto hyperlink and solicits payment in a predetermined amount; transmitting the first email message to the customer; and receiving an email message from the customer confirming payment in the predetermined amount. A method for an email-based financial management system includes storing user based settings, based on stock market events and a plurality of predetermined actions; determining when a stock market event occurs; transmitting a confirmation email to a customer requesting confirmation to perform a predetermined action; receiving a confirmation email from the customer to perform the predetermined action; and performing the predetermined action.
A method performed by a user equipment (UE) in a wireless communication system is provided. The method comprises receiving configuration information on a multicast broadcast service (MBS), and receiving, based on the configuration information, MBS data in a radio resource control (RRC)_Connected mode. The MBS data is transmitted to plurality of UEs including the UE for multicast transmission, or to the UE for unicast transmission. A Hybrid Automatic Repeat and request (HARQ) retransmission is applied to a transmission of the MBS data.
For uplink-based positioning, a transmission of an uplink reference signal via a transmit beam at a user equipment (UE) (100) is coordinated with a respective receive beams at one or more receivers (110). A positioning computation node (105) sends configuration information to the UE (100) and to the one or more receivers (110). The configuration information enables the receivers (110) to configure receive beams (111) to receive the uplink reference signal transmission from the UE (100). The receivers (110) perform various measurements of the uplink reference signal and report the measurements as well as beam information to the positioning computation node (105), which generates a position estimate.
A first device executing an application determines data indicative of conditions associated with the first device during use of the application. Based on correspondence between this data and threshold data that indicates conditions in which frames representing a display output of the first device should be stored, the first device is caused to send data indicative of these frames to a second device. The second device generates user interface data based in part on the received frames and may send the user interface data to other devices. To reduce the amount of data sent and the computational resources used, the first device may store only changed frames of display output, and may send data to the second device at times when a communication interface of the first device is active for other purposes.
An intelligent precursory systematized approach for verifying the identity (i.e., authentication) of a resource recipient when conducting an online or mobile application resource event. Machine learning (ML) models are used to determine whether the resource provider has been in contact with the resource provider and, if so, the currency and frequency of such contacts. Contacts are determined from accessing the resource providers call history as well as comparing GPS data obtained from both the resource provider's and resource recipient's mobile communication device. Based on the contact determination the ML models can determine whether to authenticate the resource recipient, require further authentication or provide the resource provider options to authenticate the resource recipient or require further authentication. Further authentication may come in the form of determining that the resource provider and resource recipient match in terms of a purpose for a pending resource event and/or a resource provider-generated OTP.
A method, apparatus and computer program product are provided herein to provide service continuity between a Stand-alone Non-Public Network (SNPN) and a Public Land Mobile Network (PLMN). For example, a method is provided that comprises after determining that the user equipment (UE) with the first protocol data unit (PDU) session established in the first SNPN is or will be leaving the coverage area of the first SNPN, causing a request message to be transmitted to the UE, wherein the request message comprises a request to initiate a second PDU session establishment procedure towards a PLMN. The method also includes causing the UE to establish the second PDU session with an internet protocol anchor function of a user plane function in the PLMN via the first SNPN radio access network (RAN) or via the PLMN RAN, wherein the second PDU session is established prior to release of the first PDU session.
An access network can allocate a bearer for a network service associated with a quality-of-service (QoS) value (QV) and a retention-priority value (RPV), and determine a bearer ID for the service based on the QV, the RPV, and a supplemental priority value (SPV) different from the QV and from the RPV. Upon handover of a terminal, session(s) carried by a bearer allocated by the terminal can be terminated. That bearer can be selected using IDs of the bearers and a comparison function that, given two bearer IDs, determines which respective bearer should be terminated before the other. Upon handover of a terminal to an access network supporting fewer bearers per terminal than the terminal has allocated, a network node can select a bearer based on respective QVs and RPVs of a set of allocated bearers. The network node can deallocate the selected bearer.
Aspects of the present invention pertain to a method, comprising receiving a preparatory handover request pertaining to at least one or more physical resources, respectively associated to a particular communication service, preliminarily deciding on the feasibility of such preparatory handover request for each of said at least one or more physical resources associated to the particular communication service dependent on at least one feasibility criterion, and validating the preliminary decision on the feasibility of the preparatory handover request dependent on at least one validation criterion. Likewise, corresponding apparatus and computer program products are addressed, both from network entity perspective such as a gNB, as well as from a terminal's perspective, e.g. from a UE perspective.
In a method for resolving PCT conflicts in a new radio (NR) network, synchronization signal and PBCH (Physical Broadcast Channel) blocks (SSB) and corresponding physical cell identifiers (PCIs) are utilized. In the method, a first PCI corresponds to a first SSB and a second PCI corresponds to a second SSB. An access network device determines, based on the first PCI and the second PCT, that the first PCI conflicts with the second PCI. In this way, PCI conflicts in an NR system can be detected to improve the success rate and to reduce the call drop rate in a terminal handover.
Techniques for managing access combinations for multiple access protocol data unit (PDU) sessions are described. A communication device may receive control signaling indicating a configuration for a multiple access PDU session associated with a plurality of access links. The plurality of access links may be associated with a first type of access, a second type of access, or a combination thereof. The communication device may select a mode for allocation of a data flow associated with the multiple access PDU session to the plurality of access links based at least in part on the received control signaling. The communication device may allocate the data flow associated with the multiple access PDU session to the plurality of access links based at least in part on the selected mode, and transmit the allocated data flow over the plurality of access links associated with the two types of access.
A host device establishes a wireless communication link with a client device, and implements a wired communication standard on the link to transfer a first data stream. To increase data throughput while complying with the standard, the host device replaces synchronizing information in a packet to be sent during a first synchronizing frame with configuration information indicating that packet exchange data of a second data stream is to be sent or received during a second synchronizing frame. The host device sends or receives the packet exchange data of the second data stream to or from the client device during the second synchronizing frame via the wireless communication link. The host device may send or receive the packet exchange data of the second data stream during delays or idle periods between sending and/or receiving packets of the first data stream via the wireless communication link according to the wired communication standard.
A method, a device, and a non-transitory storage medium are described in which an admission and congestion control service is provided. The service may dynamically reconfigure admission control information of an end device. The admission control information may include one or multiple types of access class values of the end device or an application of the end device.
Disclosed are a method and an apparatus for transmitting and receiving protocol data unit (PDU)-related information in a wireless LAN system. The method by which a first station (STA) transmits an aggregate-medium access control (MAC) protocol data unit (PDU) (A-MPDU) in a wireless LAN system, according to an embodiment of the present disclosure, may comprise the steps of: receiving, from a second STA, one or more of first information, second information, and third information related to the maximum length for the A-MPDU; and transmitting, to the second STA, an A-MPDU having a length less than or equal to the maximum length for the A-MPDU, which is derived from a first type physical layer PDU (PPDU) on the basis of the first information, the second information, and the third information.
Certain aspects of the present disclosure provide techniques for performing measurement reporting. One aspect is a method for performing measurement reporting at a user equipment, including: receiving, from a master node, a message comprising a measurement configuration for a secondary node; entering an inactive state; performing measurements according to the measurement configuration for the secondary node immediately after entering the inactive state; generating a measurement report based on the measurements; transmitting, to the master node, a radio resource control (RRC) resume request message; receiving, from the master node, an RRC resume message comprising a request for measurement reporting; and transmitting, to the master node, an RRC resume complete message comprising the measurement report; and receiving data from the secondary node.
Some embodiments of this disclosure provide a measurement method and a device. The method includes: performing neighboring cell and/or inter-frequency measurement when a specific cell and/or a specific frequency satisfies a measurement condition, to obtain a measurement result; and reporting part or all content of the measurement result to a network side.
A network of mobile nodes is described that use directional antennas in the mm wave region to communicate. The nodes form a self-healing network that is capable of forming new links between nodes to avoid interference. The network can also identify emitters that are emitting and locate them in space. The directional antennas can be electrically steered with narrow beams that allow for accurate measurement of position when combined with inertial or satellite location for at least one node in the network. The network can then adapt to the detected emitter.
The present disclosure provides a method (200) at a network device (120; 1210). The method (200) includes: determining (210) a first time period (325) corresponding to a subframe (320) in a frame (310) of a first radio access technology (RAT) and transmitting (220) a downlink system signal (340) of a second RAT in the first time period (325). The first RAT operates in time division duplex (TDD) mode and a first frequency band, and the second RAT operates in a second frequency band that at least partially overlaps with the first frequency band. The subframe (320) includes a guard period (GP) (330) used for switching between downlink and uplink in the frame (310) of the first RAT.
The present disclosure distributes processing capabilities throughout different nodes in a wireless network. Methods and apparatus consistent with the present disclosure increase the efficiency of communications in a wireless network because they help minimize the need to forward communications to other nodes in the network by allowing different wireless nodes to receive and store content ratings regarding requested content in caches associated with respective wireless nodes. Apparatus and methods consistent with the present disclosure perform a load balancing function because they distribute content ratings to different nodes in a wireless network without increasing messaging traffic. As response messages regarding access requests are passed back to a requestor, cache memories at nodes along a communication path are updated to include information that cross-references data identifiers with received content ratings. The cross-referenced data identifiers and content ratings allow each respective wireless node along the communication path to block requests to bad content.
Secure channel training to enhance the confidentiality level of a power domain non-orthogonal multiple access (NOMA) communication system when impaired by eavesdropping attacks coming from inside and outside of the network. In a first scenario, a cooperative jammer available in the system defines an external source of entropy that is independent of the channel variation rate. While the jammer provides secrecy inside the network, the proposed invention is configured to secure the network from outside, encoding the system information, which is exchanged during the training phase, using only the channel state. In a second scenario, the cooperative jammer is not available; with the secrecy inside and outside of the network ensured through a different parameterization. That parameterization is done in a way that the required system information is encoded using not only the channels, but also a random phase defined in the data communication phase.
A system and a corresponding method for assisting selective hearing are provided. The system includes a detector for detecting an audio source signal portion of one or more audio sources by using at least two received microphone signals of a hearing environment. In addition, the system includes a position determiner for allocating position information to each of the one or more audio sources. In addition, the system includes an audio type classifier for assigning an audio source signal type to the audio source signal portion of each of the one or more audio sources. In addition, the system includes a signal portion modifier for varying the audio source signal portion of at least one audio source of the one or more audio sources depending on the audio signal type of the audio source signal portion of the at least one audio source so as to obtain a modified audio signal portion of the at least one audio source. In addition, the system includes a signal generator.
Embodiments are disclosed for head dimension estimation for spatial audio applications. In an embodiment, a method comprises: obtaining, using one or more processors of an audio headset worn on a user's head, acceleration samples and rotation rate samples over a specified time window while the user rotates their head, the acceleration samples and rotation rate samples measured using motion sensors in the headset; determining a function that relates the acceleration samples to the rotation rate samples; comparing the function to a plurality of reference functions, where each reference function corresponds to a different head dimension in a nominal range of head dimensions; and estimating a dimension of the user's head based on the comparing.
Embodiments relate to audio processing for opposite facing speaker configurations that results in multiple optimal listening regions around the speakers. A system includes a left speaker and a right speaker in an opposite facing speaker configuration, and a crosstalk cancellation processor connected with the left speaker and the right speaker. The crosstalk cancellation processor applies a crosstalk cancellation to an input audio signal to generate left and right output channels. The left output channel is provided to the left speaker and the right output channel is provided to the right speaker to generate sound including multiple crosstalk cancelled listening regions that are spaced apart.
Embodiments of this application provide a user hearing protection method, apparatus, and electronic device. In the method, after an electronic device enables a hearing protection mode, when an audio output mode is a headset output, sound pressure output by the headset is obtained based on current-frame sound source data; when the sound pressure is greater than a predetermined sound pressure threshold, an instantaneous sound pressure over-standard warning is performed, and an instantaneous sound pressure over-standard protection operation is performed on the electronic device. In addition, after the output sound pressure is obtained, the sound pressure may be stored, and a sound dose accumulated to a current moment may be determined based on the stored historical sound pressure data; when the sound dose is greater than a predetermined sound dose standard value, sound dose over-standard warning and a sound dose over-standard protection operation are performed.
A method is disclosed, the method comprising obtaining at least one first information indicative of audio data gathered by at least one first microphone, and at least one second information indicative of audio data gathered by at least one second microphone; determining a differential information indicative of one or more differences between at least two pieces of information, wherein the differential information is determined based, at least in part, on the at least one first information and the at least one second information; and compensating of an impact onto the audio data, wherein audio data of the first information and/or the second information is compensated based, at least in part, on the determined differential information. Further, an apparatus, and a system are disclosed.
An image capture device with beamforming for wind noise optimized microphone placements is described. The image capture device includes a front facing microphone configured to capture an audio signal. The front facing microphone co-located with at least one optical component. The image capture device further includes at least one non-front facing microphone configured to capture an audio signal. The image capture device further includes a processor configured to generate a forward facing beam using the audio signal captured by the front facing microphone and the audio signal captured by the at least one non-front facing microphone, generate an omni beam using the audio signal captured by the at least one non-front facing microphone, and output an audio signal based on the forward facing beam and the omni beam.
The present disclosure illustrates an audio processing circuit, a car-mounted player, and a wireless playback system. The audio processing circuit includes: a signal acquisition module including a wireless input module and/or a wired input module, where the wireless input module is configured to receive an audio signal based on a wireless technology, and the wired input module is configured to receive the audio signal based on a wired technology; an audio processing module, configured to process the audio signal received by the signal acquisition module to improve sound quality of the audio signal; a frequency modulation (FM) transmitter module, configured to perform FM transmission on the audio signal output by the audio processing module; and a power supply module, configured to supply power to the signal acquisition module, the audio processing module and the FM transmitter module.
Devices, systems, and methods for public address system action auditing are described herein. In some examples, one or more embodiments include a computing device comprising a memory and a processor to execute instructions stored in the memory to access an event log associated with an event in a facility, compare the event log with a predefined configuration file associated with a public address system of the facility, and generate a report about the event based on the comparison.
A method of configuring a custom insert of a charger, wherein the custom insert is for aligning a first charging element of a hearing device and a transmitter charging element of a charger, includes: obtaining a digital three-dimensional hearing device model comprising a representation of the first charging element; obtaining a digital three-dimensional charger model comprising a representation of the transmitter charging element; obtaining a digital three-dimensional insert model; obtaining a digital cavity representing a cavity in the custom insert; and creating a custom digital three-dimensional insert model based on the digital cavity and the digital three-dimensional insert model, such that the representation of the first charging element in the digital three-dimensional hearing device model and the representation of the transmitter charging element in the three-dimensional charger model, are aligned.
An ear-worn electronic device comprises a microphone arrangement configured to sense sound in an acoustic environment, an acoustic transducer, and a non-volatile memory configured to store parameter value sets each associated with a different acoustic environment, at least one of which is associated with an acoustic environment with muffled speech. A control input of the device is configured to receive a control input signal produced by a user-actuatable control, a sensor or an external electronic device. A processor is configured to classify the acoustic environment as one with muffled speech using the sensed sound and, in response to a signal received from the control input, apply one or more of the parameter value sets appropriate for the classification to enhance intelligibility of muffled speech.
An optical microphone assembly including a substrate, an interferometric arrangement, a light source, and at least one photo detector. The interferometric arrangement includes a membrane and at least one diffractive optical element spaced from the membrane. The diffractive optical element(s) include a plurality of lines formed in or disposed on a surface of the substrate and arranged in a first pattern. The substrate includes one or more holes extending fully therethrough, the hole(s) arranged in a second pattern that is different from the first pattern. The light source is arranged to provide light to the interferometric arrangement such that first and second portions of the light propagate along respective, different first and second optical paths via the interferometric arrangement. An optical path difference between the first and second optical paths depends on a distance between the membrane and the diffractive optical element(s). The hole(s) are positioned such that at least one of the first and second optical paths at least partly overlaps with the hole(s). The photo detector(s) are arranged to detect at least part of an interference pattern generated by said first and second portions of light dependent on the optical path difference.
A vibration apparatus may include a vibration plate, a vibration generator at the vibration plate, and a connection member between the vibration plate and the vibration generator. The vibration generator may include a vibration structure. The connection member may include a first connection member between the vibration plate and the vibration structure and overlapping the vibration structure. The connection member may also include a second connection member surrounding the first connection member. A modulus of the first connection member may be greater than a modulus of the second connection member.
An audio system includes a speaker having a transducer, where the speaker is positioned within an enclosure that forms a front volume and a rear volume on opposite sides of the transducer. The rear part of the enclosure defining the rear volume is formed of an acoustic metamaterial that defines a plurality of channels within the rear volume, where the number and dimensions of the channels is configured to virtual increase the rear volume to amplify a bass portion of sound produced by the speaker. In addition, the channels may be configured to match an impedance of the front volume to serve as an absorber for high frequency audio.
A head-mounted wearable device (HMWD) uses temples as housing for a transducer, maximizing the available space within the temples for other components, such as a battery. The exteriors of the temples act as housings so that separate transducer housings do not consume space within the temples. The temples may include openings that direct emitted sound toward the ear of a user of the HMWD. Sound generated by the transducer exits the openings and provides audio to the user's ear having a suitable volume. Each temple may include two microphones to facilitate use of a beamforming algorithm. When voice input is received, the HMWD may determine a particular set of microphones for use based on a charge level of power storage devices in each temple, a noise level associated with the microphones, or other factors.
Aspects of the present disclosure involve a system for capturing infrared (IR) images using an RGB camera. The system captures, by a camera of a client device, a first image comprising a visible light representing a real-world environment. The system receives a strobe signal for capturing an infrared (IR) image by the camera. In response to receiving the strobe signal, the system switches a filter associated with a lens of the camera to pass IR light to an image sensor of the camera, captures a second image comprising IR illumination of the real-world environment, and switches the filter after the second image is captured to allow visible light to pass through to the image sensor of the camera.
Provided are an image sensor and an image output method and application thereof. The image sensor includes an input circuit, configured to perform a first photoelectric conversion on incident light to generate a photoelectric current in an EVS mode working period, and performs s second photoelectric conversion on the incident light to generate photoelectric charges in an APS mode working period; an EVS circuit configured to output a corresponding event signal according to a difference value between a first voltage corresponding to a photoelectric current and a reference voltage; an APS circuit configured to output a corresponding grayscale signal according to a second voltage corresponding to photoelectric charges; and a control circuit configured to output a corresponding APS image according to the grayscale signal and output a corresponding EVS image according to the event signal.
A pixel circuit includes a photodiode configured to photogenerate charge in response to reflected modulated light incident upon the photodiode. A first floating diffusion is configured to store a first portion of charge photogenerated in the photodiode. A first transfer transistor is configured to transfer the first portion of charge from the photodiode to the first floating diffusion in response to a first phase signal. A first storage node is configured to store the first portion of charge from the first floating diffusion. A first decoupling circuit has a first output responsive to a first input. The first input is coupled to the first floating diffusion and the first output is coupled to first storage node. A voltage swing at the first output is greater than a voltage swing at the first input.
An image sensor is disclosed. The image sensor includes a photo detector and a readout structure electronically coupled to the photodetector. The photodetector is configured to accumulate one or more photo charges responsive to one or more incident photons during an integration period. The readout structure is configured to repeatedly and nondestructively assess an amount of minority carrier photo charges accumulated at the photodetector during the integration period.
An imaging apparatus includes: an imaging device in which photoelectric conversion elements are arranged in an array; a wiring component in which the imaging device is mounted and a power source wiring is provided; connection wirings that connects the power source wiring and the imaging device each other; at least two power supply sources connected to the power source wiring; and at least one power supply source connected to the power source wiring, the power supply sources supply power to the imaging device via the power source wiring and the connection wirings, at a horizontal synchronization frequency of the imaging device, the two power supply sources have lower impedances than the one power supply source, and at least one of the connection wirings is connected to a wiring path connecting the two power supply sources in the power source wiring.
A solid-state imaging device (10) includes an imager (11) that acquires image data, a processing unit (14) that performs a process based on a neural network calculation model for data based on the image data acquired from the imager, and a control unit (12) that switches between a first process mode of performing a first process at a first frame rate and, based on a result of the first process, a second process mode of performing a second process at a second frame rate.
Embodiments of the disclosure relate to the technical field of gimbal control, and disclose a gimbal control method and apparatus, a control terminal and an aircraft system. The gimbal control method is applicable to a control terminal. A gimbal carries a photographing device. The method includes: acquiring photographing parameter information of the photographing device, where the photographing parameter information includes a field of view of the photographing device and a resolution of a captured image of the photographing device; acquiring image coordinates of a target object in the captured image that is selected by a user; and controlling an attitude of the gimbal according to the photographing parameter information and the image coordinates of the target object, so that the target object is at a preset position in the captured image.
The embodiments are an image processing method and apparatus, an aerial camera and a storage medium. The method includes: receiving an image mode switching instruction, wherein the image mode switching instruction is configured to indicate to switch a current image mode into a target image mode, and the image mode switching instruction carries the target image mode; and processing a collected image according to the target image mode. Therefore, the image can be flexibly processed based on the target image mode in the image mode switching instruction, such that the image display requirements in different scenarios are met.
According to various embodiments of the disclosure, a camera module may comprise a first lens, a second lens, a third lens, a fourth lens, a fifth lens, a sixth lens, a seventh lens, and an eighth lens arranged in order from a subject. The first lens may have positive (+) refractive power and include a 1-1th surface convex toward the subject. The seventh lens may include a 7-1th surface facing the subject and including at least one inflection point. The eighth lens may have negative (−) refractive power, include an 8-1th surface facing the subject and formed as an aspherical surface, and include an 8-2th surface opposite to the 8-1th surface, the 8-2th surface including at least one inflection point and is formed as an aspherical surface. Other various embodiments are also possible.
A system and method operable to facilitate preparing of an advertising project are disclosed herein. The method, in an embodiment, includes a plurality of steps related to preparing an advertising project before any ads are published based on the advertising project. The steps include processing rule data associated with at least one rule; processing goal data associated with at least one goal factor; determining a plurality of ad spot sets depending at least partially on the at least one rule; determining which ones of the eligible ad spot sets either reaches the at least one goal factor or reaches a designated proximity to the at least one goal factor, resulting in a plurality of spot set candidates; and processing heuristic logic that includes at least one control setting and a plurality of optimization steps. The method also includes identifying at least one of the modified sets that results from the optimization steps. The advertising project is deployable as a launched advertising project in which the at least one identified modified set is publishable within different markets of a territory. The markets can include geographic areas, such as city areas, within a territory, such as any country.
Methods, apparatus, systems and articles of manufacture are disclosed to estimate an audience population. An example apparatus includes at least one memory; instructions in the apparatus; and processor circuitry to execute the instructions to: determine whether respective ones of respondents are associated with a characteristic; detect unique instances of the respective ones of the respondents; in response to the respective ones of the respondents being associated with the characteristic, increase a sample capture count by one; in response to detecting the unique instances of the respective ones of the respondents exhibiting the characteristic, increase a unique capture count by one; determine a seed population estimate based on the unique capture count; and determine a population estimate having the characteristic based on the sample capture count, the unique capture count, the seed population estimate, and a number of available samples.
Disclosed are a video data processing method and apparatus, an electronic device and a computer-readable storage medium. The method includes acquiring a to-be-processed TS file; by means of a created stream, reading data in the to-be-processed TS file in sequence according to a set byte length, and converting data of each read in the to-be-processed TS file into a memory stream; and when the first memory stream is obtained through conversion, parsing memory streams in sequence according to a read order, and obtaining a video parameter corresponding to the memory streams.
The synthetic broadcast system and method according to the present invention contemplates a system of interactive devices within a wireless personal area network, near-me area network, or local area network, and at least one of which devices is configured to enable the user to generate audiovisual content and contribute the user-generated content to one or more virtual watch parties or synthetic broadcasts. A smart television and a mobile device together operate over a local area network or short-range wireless communication channel(s) to generate or parse the playback and routing instructions of state-of-the-art synthetic rebroadcast mechanisms. The system according to the present invention adds a novel mechanism for displaying real-time user generated video and audio content within the virtual watch parties attending to or consuming the content of the watch parties by way of the smart television and mobile device components.
A system and method for signaling changes in aspect ratio of media content is provided. The system acquires a video stream to be transmitted to an electronic device and determines aspect ratio information associated with content included in the video stream. The system further determines a change in an aspect ratio of the content based on the aspect ratio information. The change in the aspect ratio may be from a first value at a first timestamp to a second value at a second timestamp for a duration of the content. The system signals information indicative of the determined change to the electronic device.
Aspects of the disclosure provide methods and apparatuses for video data processing. In some examples, an apparatus for video data processing includes processing circuitry. The processing circuitry determines that profile information of a bitstream is indicative of a profile for operation range extension with a bitdepth higher than a predetermined value. Then, then the processing circuity checks at least a syntax element of the bitstream to determine whether the syntax element of the bitstream satisfies a constraint that is indicative of a single layer for outputting at a decoder for decoding the bitstream.
This invention provides an apparatus comprising an acquisition unit which acquires information representing optical compression ratios in a horizontal direction and in a vertical direction at a time of image capturing by an image capturing unit; a transform unit which wavelet transforms the image data to generate a plurality of sub-band data; a determination unit which determines quantization parameters for transform coefficients in a plurality of sub-bands obtained by the transform unit; and an encoding unit which quantizes the transform coefficients in the sub-band data obtained by the transform unit in accordance with the quantization parameters determined by the determination unit and to encode the quantized transform coefficients, wherein the determination unit performs weighting for each sub-band based on the information representing the compression ratios acquired by the acquisition unit to determine the quantization parameters.
An encoder calculates an indication to a previous reference picture having temporal identity of zero. The encoder creates a first set of indicators to the previous reference picture, to all reference pictures in a first reference picture set of the previous reference picture, and to all pictures following the previous reference picture in decoding order and precede the current picture in decoding order. The encoder sets a flag for picture order count cycle, when a long term reference picture (LTRP) has least significant bits (LSBs) of a picture order count, for which more than one picture in the first set share same value of the LSBs of picture order count as the LTRP. The decoder obtains LSB of a picture order count for a LTRP in a reference picture set of the current picture. The decoder concludes non-compliant bitstream based on indications provided by the flag.
A method comprises: receiving, by a video decoder, a video bitstream comprising an RPL flag, wherein the RPL flag equal to a first value specifies that RPL signaling is present in a PH, and wherein the RPL flag equal to a second value specifies that RPL signaling is not present in the PH and may be present in slice headers; and decoding, by the video decoder using the RPL flag, a coded picture to obtain a decoded picture. A comprises: receiving, by a video decoder, a video bitstream comprising an SAO flag, wherein the SAO flag specifies that SAO information may be present or is not present in a PH or specifies that the SAO information may be present or is not present in slice headers; and decoding, by the video decoder using the SAO flag, a coded picture to obtain a decoded picture.
Disclosed is a video decoding method that decodes a bitstream, the method including receiving a picture parameter set (PPS) comprising at least one of first information indicating whether the same reference picture list is applied to slices comprised in a picture and second information indicating whether additional information on modification of the reference picture list is present, and deriving a construction of the reference picture list based on the PPS. Accordingly, there are provided a method and an apparatus for signaling by a picture whether the construction of the reference picture list is modified when constructing the reference picture list.
A method, computer program, and computer system are provided for video coding. The video coding includes decoding one or more previously encoded frames of a video source that are designated as reference frames for the video source, searching the reference frames for one or more candidate pixel blocks for an input frame of the video source, and encoding the input frame based on the one or more candidate pixel blocks.
A video decoder and a video encoder include a noise reduction operation including at least two denoising operations and adapting the second denoising operation in dependence of the difference before and after the first denoising operation, thus correcting the quality reduction occurred due to the application of the first denoising operation. Corresponding methods serve to encode and decode video signals.
An image encoding/decoding method and apparatus are provided. An image decoding method according to the present disclosure may comprise obtaining a reconstructed picture, determining a target boundary of deblocking filtering in the reconstructed picture, determining a boundary strength for the target boundary, and applying deblocking filtering to the target boundary based on the boundary strength. Based on the target boundary being a transform block boundary and a color component of the reconstructed picture being a chroma component, the boundary strength may be determined based on whether joint CbCr residual coding is performed on at least one of two blocks adjacent to the target boundary, and the joint CbCr residual coding may correspond to encoding residual samples for a chroma Cb component and a chroma Cr component as a single transform block.
The present disclosure intends to provide a video encoding/decoding method of performing intra prediction for a current block by using luma reference samples derived based on a luma mapping function in order to enhance performance of intra prediction for a case where restored samples around the current block to be predicted cannot be used.
A system comprising a plurality of capture devices and a calibration device. The capture devices may each comprise a warp table. The calibration device may be configured to store a plurality of configured warp tables in a warp table pool, perform a full calibration for one of the capture devices to generate the configured warp tables, initiate a quick calibration for the capture devices and apply one of the configured warp tables to the capture devices as the warp table. The calibration device may apply one of the configured warp tables to the capture devices by selecting one of the configured warp tables from the warp table pool in response to the quick calibration. If the quick calibration fails, the calibration device may generate a new configured warp table for the warp table pool in response to the full calibration and select the new configured warp table.
A method of maintaining a time measurement stored on an electronic device. The method comprises: receiving, by the electronic device, a supply item manufacturing time stamp from a supply item connected to the electronic device, comparing the supply item manufacturing time stamp with the time measurement of the electronic device, and updating, by the electronic device, the time measurement of the electronic device, based on the supply item manufacturing time stamp. An electronic device comprising a memory, the memory storing a time measurement, wherein the electronic device is configured to maintain the time measurement by: receiving a supply item manufacturing time stamp from a supply item connected to the electronic device, and updating the time measurement of the electronic device, based on the supply item manufacturing time stamp. An electronic device supply item, the supply item comprising a memory, the memory storing a supply item manufacturing time stamp, and the supply item being configured to send the supply item manufacturing time stamp to an electronic device.
A method for adjusting a parameter of an audio service and a terminal includes obtaining, by the terminal, first information, where the first information includes at least one of a first battery level or a first temperature, and adjusting, by the terminal, a parameter of an audio service of the terminal when a first condition is met, where the first condition includes one or more of the first battery level is less than a first preset threshold or greater than a second preset threshold, or the first temperature is less than a third preset threshold or greater than a fourth preset threshold.
A display panel and an electronic device are provided. The electronic device includes a display panel. The display panel includes a display module, a housing, a first sensor, a first plane mirror, and a second plane mirror. Light from a via hole is reflected by the first plane mirror, is incident on the second plane mirror, and enters the camera opening of the first sensor after being reflected by the second plane mirror.
A system, node and wireless device are provided. An intermediate node is provided that includes processing circuitry configured to: receive a packet where the packet includes metadata associated with first input data of a first node, first output data of the first node, a first PC signature and a public cryptographic key associated with the first node, verify that the first PC signature corresponds to a process that led from the first input data to the first output data using the public cryptographic key, verify a link between first node and the intermediate node by comparing the received packet and the first output data, and determine whether to perform at least one service function on the packet based at least in part on the verification of the first PC signature and the verification of the link between the first node and the intermediate node.
A system for protecting personal information uses a challenge and an encrypted copy of the challenge in the form of a message authentication code (MAC) to provide authentication among multiple parties. The challenge is received by a first party from a second party. The challenge is encrypted by the first party to form the MAC and then both the challenge and the MAC are returned to the second party. The second party authenticates the first party by confirming the challenge. The second party sends the MAC and challenge to the third party. The third party decrypts the MAC using a key shared with the first party. When the decrypted MAC matches the challenge, the first party is authenticated to the third party. The process is applicable to transaction processing to limit compromise of payment instrument details.
A secure chain data structure is stored by grouping source data into blocks of data, calculating a hash value of an immediate prior block for each block of said blocks of data and a hash value of a non-immediate prior block for at least some blocks of said blocks of data, associating the hash value or values of each block with each block of said blocks of data, and storing said blocks of data and their associated hash values to form a secure chain data structure. Trust can be provided to blocks in the secure chain data structure by later blocks containing valid hash values of prior blocks including valid ones of the hash values of non-immediate prior blocks.
A multi-party privacy computing method and device based on semi-trusted hardware, wherein the method applied to semi-trusted hardware comprises the following steps: acquiring random number masks and random seeds of all user terminals; generating a garbled circuit seed according to the random seeds; generating a garbled circuit according to a predetermined circuit description and the garbled circuit seed, wherein the garbled circuit comprises garbled tables, wire labels and decoding information; sending the wire labels corresponding to the inputs of all user terminals to a user terminal corresponding to the semi-trusted hardware by using an oblivious transfer protocol; and sending the garbled table and the decoding information to the user terminal corresponding to the semi-trusted hardware, so that the user terminal can compute an output value according to the garbled tables, the decoding information and the wire label corresponding to the inputs of all user terminals.
Systems and methods for generating min-increment counting bloom filters to determine count and frequency of device identifiers and attributes in a networking environment are disclosed. The system can maintain a set of data records including device identifiers and attributes associated with device in a network. The system can generate a vector comprising coordinates corresponding to counter registers. The system can identify hash functions to update a counting bloom filter. The system can hash the data records to extract index values pointing to a set of counter registers. The system can increment the positions in the min-increment counting bloom filter corresponding to the minimum values of the counter registers. The system can obtain an aggregated public key comprising a public key. The system can encrypt the counter registers using the aggregated shared key to generate an encrypted vector. The system can transmit the encrypted vector to a networked worker computing device.
Methods and systems may include processes that may implement abbreviated header communications. In some implementations, a method may include generating a packet including an abbreviated header, where the abbreviated header may include a pointer corresponding to values for multiple parameters associated with a physical layer of communication rather than the values for the multiple parameters. The method may also include transmitting the packet to a client device according to the values for the multiple parameters.
A method for fetching a content from a web server to a client device is disclosed, using tunnel devices serving as intermediate devices. The client device accesses an acceleration server to receive a list of available tunnel devices. The requested content is partitioned into slices, and the client device sends a request for the slices to the available tunnel devices. The tunnel devices in turn fetch the slices from the data server, and send the slices to the client device, where the content is reconstructed from the received slices. A client device may also serve as a tunnel device, serving as an intermediate device to other client devices. Similarly, a tunnel device may also serve as a client device for fetching content from a data server. The selection of tunnel devices to be used by a client device may be in the acceleration server, in the client device, or in both. The partition into slices may be overlapping or non-overlapping, and the same slice (or the whole content) may be fetched via multiple tunnel devices.
Methods, systems, and computer-readable media for customizable event-triggered computation at edge locations are disclosed. A request for content is received at an edge server from a client device. The content is sought from a content cache at the edge server or from an origin server coupled to the edge server. Processing of the request is initiated, comprising encountering an event. The event is associated with a function specified by a customer. The function associated with the event is executed at the edge server using process isolation. The content is generated based at least in part on execution of the function. The content is sent from the edge server to the client device.
Management services for distributed computing architectures using rolling changes are provided herein. An example system includes clusters of nodes providing services and a plurality of management servers, each of the plurality of management servers including: at least a distributed coordination service for the clusters of nodes, the distributed coordination service being a datastore; and a constructor that manages allocation and life cycle deployments of the nodes of the clusters, the constructor further configured to manage topological changes to nodes of the clusters by implementing rolling attribute changes for the nodes.
The present disclosure relates to systems and methods for determining an engagement profile of a participant by associating electronic activities to a profile. It may generate the engagement profile based on analysis of the electronic activity level. An example implementation may contain the following steps. The system may access for a first record object a plurality of electronic activities linked with the first record object. The system may identify for a participant from the plurality of electronic activities a set of electronic activities including the participant. The system may determine an engagement profile of the participant based on a first number of electronic activities of the set of electronic activities sent by the participant, a second number of the set of electronic activities received by the participant and a temporal distribution of the set of electronic activities. The system may store the engagement profile in one or more data structures.
The present disclosure relates to methods, systems, and storage media for detecting events based on updates to node profiles from electronic activities. Exemplary implementations may access an electronic activity transmitted or received via an electronic account associated with a data source provider; generate a plurality of activity field-value pairs; maintain a plurality of node profiles; identify a first state of a first node profile of the plurality of node profiles; update the first node profile using the electronic activity; identify a second state of the first node profile subsequent to updating the first node profile using the electronic activity; detect a state change of the first node profile based on the first state and the second state; determine that the state change satisfies an event condition; and store an association between the first node profile and an event type corresponding to the event condition.
A needs-matching navigator system and social network facilitator appurtenances including, for a large user plurality, software driven modules residing on electronic communications enabled platforms and devices. Beyond altruistically enhancing flourishing life horizons and life quality metrics, the modules facilitate (A) knowing respective user bias, profile, perspective, wellbeing orientation, and privacy preference; (B) understanding user needs description and wellbeing criteria; (C) finding answer and solutions to the needs by user biased projecting the description onto electronically stored knowledge-bases; (D) matching the user to the answers and solutions; and preferably (E) creating an instant electronic communications interactive community for the respective user, by inverse projecting large subsets of the answers and solutions back onto the large plurality of users; according to said users' profiles and needs descriptions. This navigable community may be classified into spontaneous castes; having various degrees of relevant understanding, expertise, experience, and/or curiosity about these answer and/or solution projections.
A method for managing Quality of Experience (QoE) for video streaming traffic flow on a network, the method including: collecting data associated with a plurality of video streaming traffic flows; creating a model based on the collected data; determining factors associated with a new video streaming traffic flow; analyzing the factors based on the model; determining a QoE score based on the analysis. A system for managing QoE for video streaming traffic flow on a network, the system including: a factor determination module configured to collect data associated with a plurality of video streaming traffic flows; a model module configured to create a model based on the collected data; an analysis module configured to determine factors associated with a new video streaming traffic flow and analyze the factors based on the model; and a QoE engine configured to determine a QoE score based on the analysis.
Media, methods, and systems are disclosed for adaptively adjusting video quality in a virtual event hosted by a virtual event hosting platform. A plurality of presenter video streams may be received at a video server. A change of state associated with a presenter video stream of the plurality of presenter video streams may be detected. In response to detecting the change of state, a change to a video display parameter for the presenter video stream may be requested by the video server. The video server may receive the updated presenter video stream from a presenter computing device associated with the presenter video stream. The video server may send updated presenter video stream to a plurality of presenter computing devices associated with the plurality of presenter video streams.
A video processing method and an apparatus are provided in embodiments of the present disclosure. The method includes: detecting an operation instruction of a first user; in response to the operation instruction, displaying an image collected by a camera of the first terminal on a chat page of the first user with a second user in real time, superposing and displaying remaining information except the image within a preset area on the image; and sending the image collected by the camera of the first terminal to a second terminal in real time as a video frame, so that the second terminal displays the image on a chat page of the second user with the first user in real time, and superposes and displays remaining information except the image within a preset area on the image; where the first terminal is a terminal corresponding to the first user.
A system includes a common display, a display computer to run collaboration software connected to the common display that drives the common display, the display computer being on a first network, a first mobile device to run a sharing application and a streaming application, the first mobile device being on a second network, separate from the first network, the streaming application to convert a display of the mobile device into stream data, a control channel between the mobile device and the display computer, and a stream channel between the display computer and the mobile device. The mobile device sends stream data directly to the display computer, wherein the display computer is to display the stream data on the common display. The stream channel may be directly between the mobile device and the display computer or may be over a relay server.
A networked communications system that facilitates real-time interaction with persons-of-interest. The real-time communications system includes a pre-connection workflow that allows for efficient utilization of human resources and/or more precise control of the interaction and engagement time intervals allotted to users of the system. The real-time communications system transmits event status information to users while waiting for respective communications sessions to begin.
A system and method for monitoring and modifying the security configurations of multiple devices is disclosed. The method includes monitoring multiple devices for security triggers and taking action in response to the triggers. The triggers include changes in security configurations, known security issues and pending updates. The devices may be any connected devices, including Internet of Things devices.
A method includes determining that access permissions associated with a service of a computing system have been revoked, identifying one or more access policy sets including access policy rules associated with the service, removing the access policy rules associated with the service from the one or more access policy sets, and marking one or more decision execution paths of a policy decision point associated with the service with a feature flag.
Context-aware security policies and incident identification, via automated cloud graph building with security overlays, are determined and performed by systems and platforms. Graph nodes, of a graph associated with a computing system, that represent resources associated with the computing system and entities associated with the computing system that have respective associations to the resources are generated. Security attributes are determined and assigned to the graph nodes that represent the entities and resources, and static and dynamic connections between the graph nodes are added to the graph. Additionally, possible connections in the graph between the graph nodes are added based on heuristic relational determinations of the graph nodes. From the graph, security incidents and kill chains are identified, context-aware security policies are generated and validated, and scopes and relationships of applications are identified. Accordingly, security actions are taken for the computing system.
Techniques for analyzing traffic originating from a host device in a wireless network to identify one or more virtual machines (VMs) running on the host device and connected to the network via the host device in bridge mode. When a VM is created in bridge mode behind a host device, the traffic originated by the VM will have the source Media Access Layer (MAC) address of the host device. According to techniques described herein, devices and/or components associated with the network may profile the traffic to identify an address of the VM, such as by analyzing dynamic host configuration protocol (DHCP) packets to determine the Internet Protocol (IP) address of the VM. Once the IP address and the MAC address of the VM is known, the components and/or devices may apply security policies to the VM that may be different than security policies applied to the host device.
An endpoint security system having a Secured Authentication For Enterprise (SAFE) server is enhanced with an auxiliary service. The auxiliary service receives a request to run a job on an endpoint of an enterprise computer network, queues up the job in a central job store, and monitors whether an agent on the endpoint has checked in with the SAFE server. Responsive to the agent on the endpoint checking in with the SAFE server, the auxiliary service establishes, through a secure connection with the SAFE server, a connection with the agent on the endpoint and determines whether the agent has any jobs queued up in the central job store. If so, the auxiliary service dispatches the job from the central job store to the agent on the endpoint through the secure connection with the SAFE server and starts the job by the agent on the endpoint.
Presented is a network security system (NSS) that reliably detects malleable C2 traffic. The NSS intercepts outgoing transactions from user devices associated with user accounts. The NSS filters out transactions to known benign servers and analyzes remaining transactions for indicators of malleable command and control (C2) including heuristic, anomalous, and pattern-based detections. The NSS lowers the user confidence score associated with the user account or the user device based on the severity and number of detected indicators for each impacted outgoing transaction. When the user confidence score decreases below a threshold, the NSS implements a restricted security protocol for future outgoing transactions. Based on the detected indications, the NSS can identify malleable C2 attacker servers and add them to a blacklist of destination servers to further identify infected user accounts and devices.
Detection and notification of malware at a user device may be performed by a validation server. The user device may hash elements associated with a document object model of a webpage and send generated hash values to the validation server. The validation server may validate the hash values. Based on detection of hash values corresponding to elements maliciously-injected by malware, the validation server may send one or more notifications to other servers that may communicate with the user device.
An anomaly detection system is disclosed capable of reporting anomalous processes or hosts in a computer network using machine learning models trained using unsupervised training techniques. In embodiments, the system assigns observed processes to a set of process categories based on the file system path of the program executed by the process. The system extracts a feature vector for each process or host from the observation records and applies the machine learning models to the feature vectors to determine an outlier metric each process or host. The processes or hosts with the highest outlier metrics are reported as detected anomalies to be further examined by security analysts. In embodiments, the machine learnings models may be periodically retrained based on new observation records using unsupervised machine learning techniques. Accordingly, the system allows the models to learn from newly observed data without requiring the new data to be manually labeled by humans.
There are provided systems and methods for an authorization and access control system for access rights using relationship graphs. A service provider may provide an authorization and access control system that allows users within the service provider and/or customer entities to assign and change access rights or permissions to computing resources. When providing control of these access rights, the service provider may utilize relationship graphs, queried and generated using a graph database, to visualize and determine access rights that are inherited through different relationships and policies defining these access rights. The relationship graph may show edges for nodes that correspond to related objects, such as actors, groups, and resources. Paths over the relationship graph may be used to determine access rights that may be inherited by users. Once determined, these access rights may be established and/or updated with computing systems.
An apparatus comprising a processor comprising a trusted execution environment (TEE) to be attested by a plurality of service provider servers on behalf of a plurality of endpoint devices in a network environment and provision kernels for the plurality of service provider servers requesting to access one or more of the plurality of endpoint devices.
The present disclosure is related to virtual spaces, such as channels, of a communication platform. In some cases, a channel may be designated as a private channel, which may permit access to the private channel by only users joined to the channel and may restrict/prevent access by all other users. The present disclosure is related to solutions for changing the private channel to a public channel, which may allow additional user accounts that were not associated with the private channel to discover and/or access the converted channel.
A method for processing telegrams in an automation network provides a master subscriber to at least partially encrypt and output telegrams, respectively, to another subscriber. The other subscriber comprises an input port, a receiving logic connected to the input port, a decryption unit connected to the receiving logic, and a processing unit connected to the decryption unit and the receiving logic. The receiving logic is configured, when a telegram at least partially encrypted by the master subscriber is present at the input port, to forward an encrypted portion of the telegram to the decryption unit. The decryption unit is configured to decrypt the encrypted portion of the telegram with a key, and to forward the encrypted portion to the processing unit for processing. If an unencrypted telegram is present at the input port, the receiving logic is configured to forward the unencrypted telegram to the processing unit for processing.
A secure executable container executed by an endpoint device receives a request by an originating entity for initiating a secure peer-to-peer transfer of a data object to at least a second network entity via a second network device in a secure data network. The secure executable container establishes a two-way trusted relationship between the originating entity and the endpoint device, and between the endpoint device and the second network device. The secure executable container generates a root data object containing metadata identifying the data object and comprising a list identifying message objects containing respective data chunks of the data object, and causes the second network device to execute a secure autonomic synchronization of the root data object via the secure data network, enabling the second network entity to execute the secure peer-to-peer transfer of at least a selected portion of the data object as a hyperlinked hypercontent object.
The disclosure is generally directed towards a client device agent (e.g., a network agent) learning that a service domain is authenticated via a corresponding suffix proxy domain. The network agent may then direct a service domain request to the suffix proxy domain. The learning process generally involves evaluating headers in URL redirection communications between the client device and an authentication service, such as an identity provider (IDP). Based on a session control policy, the IDP may “bounce” the user to a proxy service (e.g., a suffix proxy). Accordingly, the IDP may include a “bouncer”. The network agent generally learns from the headers that a request to a service domain gets redirected (e.g., bounced) to a suffix proxy domain. The agent intercepts subsequent requests to the service domain, updates the request URL, and sends the updated request to the suffix proxy domain.
This disclosure provides systems, methods and apparatus, including computer programs encoded on computer storage media, to mitigate a denial of service attack to a power line communication (PLC) network. A first node of the PLC network may activate a countermeasure that enables the PLC network (including the first node and a second node) to continue to communicate when one or more transmissions associated with a denial of service attack are injected onto the communication medium. This disclosure includes several techniques to detect a denial of service attack and several countermeasures that may be implemented. For example, a countermeasure may include the use of a custom preamble or a custom priority resolution symbol that is specific to the PLC network. The first node and the second node may disregard transmissions that do not conform to the custom preamble or custom priority resolution symbol.
A DNS server comprises: a receiver configured to receive a registration request comprising a domain name, a local address, and a scope, the registration request requests registration of the domain name; a processor coupled to the receiver and configured to execute computer instructions that cause the processor to: assign an address to the domain name based on the local address and the scope, and generate a registration response comprising the address; and a transmitter coupled to the processor and configured to transmit the registration response towards an endpoint. The processor may be further configured to cache a correspondence among the domain name, the address, and the scope.
There is provided an apparatus for managing a group mention based on a user behavior condition by mention type. The apparatus includes: a user-designated mention reception portion that receives a user-designated mention including a user-designated identifier and user-designated information about one or more users forming a user group; an unread count calculation portion that identifies the user-designated identifier, distinguishes the mention type of the user-designated mention, and calculates an unread count of the user-designated mention that has not yet been read by a corresponding user based on the user-designated information; and an unread count processing portion that determines the user behavior condition for subtracting the unread count according to the mention type and determines whether to subtract the unread count by detecting a user behavior associated with the user-designated mention.
A communication management system manages the exchange of messages between devices using different communication networks and/or protocols. A sender device may transmit a message (e.g., a short message service “SMS” message) to a destination associated with a traditional “landline” phone number. The message may be delivered over a traditional landline phone network. The communication management system can receive the message via the phone network, process the message, and provide the message to one or more electronic devices over a packet switched network, such as a local area network or the Internet. The electronic devices may use chat-based application software to process and display the message, provide robust message handline functionality, and facilitate responses to the message.
An extendable augmented reality (AR) system for recognizing user-selected objects in different contexts. A user may select certain entities (text, objects, etc.) that are viewed on an electronic device and create notes or additional content associated with the selected entities. The AR system may remember those entities and indicate to the user when those entities are encountered by the user in a different context, such as in a different application, on a different device, etc. The AR system offers the user the ability to access the user created note or content when the entities are encountered in the new context.
An apparatus and mechanism to subscribe to a single address and or session management service from multiple devices (such as e.g. tablets, smart phones, netbooks or other types of communication terminals or client devices) with a single account and password through the automatic assignment of a dynamic opaque service profile to each device a user uses to sign in to the service. After sign-in transparent call management services are provided to the user and allow the user to control sessions on any signed-in device from any signed-in device without revealing the distinct dynamic opaque service profiles to the user.
Systems and methods for time division duplex (TDD) synchronizing in distributed communication systems (DCSs) synchronize remote units operating with 5G signals by initially connecting these remote units to a 4G TDD source, and once the remote units are synchronized, switching back to a 5G TDD source. By using the downlink synchronization process of 4G instead of the normal synchronization process of 5G, the synchronization of the remote units using 5G is expedited. Further, the 5G receiver is not compressed or otherwise negatively impacted.
Provided in the present invention are a method performed by user equipment, and user equipment, which can reliably perform processing related to a beam failure recovery request/beam failure report (BFR) and/or scheduling request (SR). The method comprises: detecting a measurement result of a measurement reference signal corresponding to a serving cell; if the measurement result indicates that a beam failure has occurred, utilizing a counter to count the number of beam failures; and when the count value of the counter is above a given threshold, performing processing related to a beam failure recovery request/beam failure report (BFR) and/or scheduling request (SR).
A method, computer program product, and computer system for dividing a physical Ethernet port is provided. The method may include dividing, by a computing device, a first physical Ethernet port of a plurality of physical Ethernet ports into a plurality of partitions. A first partition of the plurality of partitions for the first Ethernet port may be assigned to a N-virtual distributed switch. A second partition of the plurality of partitions for the first Ethernet port may be assigned with a plurality of functions. Ethernet packets may be switched between the plurality of functions in the second partition.
A data migration method and an apparatus are applied to a scenario in which a user plane gateway communicating with a terminal is changed from a source user plane gateway to a target user plane gateway. The target user plane gateway receives an address of the terminal from a control plane gateway, obtains an Ethernet data packet based on the address of the terminal, and sends the Ethernet data packet to an Ethernet interface, so that a switch obtains the Ethernet data packet through the Ethernet interface, and updates a MAC address table based on the Ethernet data packet.
In one embodiments, data communication system include a communication apparatus, which is configured to receive data from different user equipment devices a schedule of time periods, and packetize the data from respective ones of the user equipment devices for respective ones of the time periods into packets, a memory including a plurality of buffers, and a network interface controller configured to receive the packets from the communication apparatus, and scatter respective portions of the data belonging to respective groups of successive ones of the time periods to the buffers, responsively to a static set of steering rules, and timing information of respective ones of the packets, and wherein each respective portion of the data is scattered to the buffers a same scatter pattern.
A system and method for autonomous data and signalling traffic management in a distributed infrastructure is disclosed. The method includes a distributed multi-cloud computing system with machine learning based intelligence across heterogenous computing platforms hosting mobile network functions, capable of leveraging AI based distribution across all the resources to creates autonomous network operations and intelligently work around any impairments. The method includes determining one or more service nodes by using a trained traffic management based ML model and establishing one or more cloud mesh links between the one or more service nodes at multiple levels of hierarchy based on the system, environment and network parameters and the current network demand. Further, the method includes processing the request by providing access of the one or more services hosted on the one or more external devices to the one or more electronic devices via the one or more cloud mesh links.
Aspects of the disclosure provide methods and apparatuses for service offloading. In some examples, a processing circuitry of an electronic device detects that received information associated with a service flow satisfies a preset rule, and generates an offloading strategy that uses a first network address in the received information associated with the service flow as an offloading address. Then, the processing circuitry offloads a first uplink data packet associated with the service flow from a terminal device to an edge network according to the offloading strategy in response to a destination address of the first uplink data packet matching the offloading address. Non-transitory computer-readable storage medium counterpart embodiments are also contemplated.
Aspects of the disclosure relate to a multipoint environment that enables a station (STA) to communicate with multiple access points (APs) and an AP to communicate with multiple STAs in a single wireless protocol stack. For example, a STA can authenticate simultaneously with multiple APs and decode any data packet that includes in a header a destination address that matches an address of the STA, irrespective of the source address included in the header of the data packet. Similarly, an AP can decode any data packet that includes in a header a source address that matches an address of an authenticated STA, irrespective of the destination address included in the header of the data packet.
An example method may include blocks to initiate a network performance analysis on the enterprise network; and receive a translated recording from a backend computing device to be executed as part of the network performance analysis. Additional blocks may add the translated recording to a set of tests in a queue to be executed on the enterprise network; and execute a primary set of low-level instructions of the translated recording using a headless browser. Further blocks may in response to a failed result of the primary set of low-level instructions, execute an alternative set of low-level instructions using the headless browser. Furthermore, blocks may, record, in an activity log, results of executing the translated recording, including at least a total execution time of the executed low-level instructions; and upload the activity log to the backend computing device.
Presented herein are embodiments for quickly identifying and recommending key performance indicators (KPIs) for network devices based on the type of network device and/or role of the device. The type or configuration of the network device may be obtained and compared to the capabilities of the network device. Operational or performance information of the network device, represented by strings, may be obtained based on the configuration information. Operational information that is not relevant to the configuration of the network device may be filtered out. The remaining operational information may be ranked as KPIs based on a relevance of the operational information with respect to the configuration information.
Disclosed are approaches for a launcher application with connectivity detection for shared mobile devices. In some examples, among others, a management service component, a client device component, an enterprise environment component, or other connectivity endpoints associated with a plurality of applications can be identified. At least one response to requests transmitted to the connectivity endpoints can be received. A mode of connectivity can be determined based on the response. An application which is launchable in the mode of connectivity can be launched in an instance in which a selectable representation for the application is selected in a user interface.
Systems and methods for performing connectivity checks, such as Seamless Bidirectional Forwarding Detection (S-BFD), are provided. A method, according to one implementation, includes receiving, at a responding node, an entry configured to call for a modification of an identification element (from an old identifier value to a new identifier value) used for identifying the responding node with respect to other nodes of a network. The old and new identifier values are cached in a memory device. Also, the method includes providing a reply packet back to an initiating node in response to receipt of a request packet from the initiating node. The request packet is related to a connectivity check for testing the connectivity between the initiating node and the responding node. In addition, the request packet is able to identify the responding node by either the old identifier value or the new identifier value.
In embodiments of the present disclosure, a method for deploying an Edge Device Network (EDN) is provided. The method comprises: receiving, by an Edge Computing Management Service Provider (ECMSP), an Edge Data Network (EDN) deployment request for creating an EDN instance associated with an EDNFunction class, wherein the EDN deployment request comprises one or more requirements associated with the EDN; identifying an EDNfunction Information Object Class (IOC) based on the one or more requirements included in the EDN deployment request; and deploying the EDN based on the identified EDNfunction IOC and the one or more requirements.
In a first embodiment, a method is disclosed of providing Stream Control Transmission Protocol (SCTP) high availability in a cloud, the method comprising: keeping track, by an internal controller of an internal service discover framework, internal changes in a cluster; determining, by the internal controller, if any SCTP pods crash; informing, by the internal controller, remaining SCTP pods about changes in the environment; determining, by the controller, to distribute a number of connections in each remaining SCTP pod; and initiating, by the remaining pods, SCTP connection reestablishment. In a second embodiment, a Stream Control Transmission Protocol (SCTP) microservice system is disclosed comprising: an internal controller; a plurality of SCTP pods in communication with the internal controller; wherein the internal controller keeps track of internal changes in a cluster, determines if any SCTP pods crash; informs remaining SCTP pods about changes in the environment, and determines distribution of a number of connections in each remaining SCTP pod; and wherein the remaining pods initiate SCTP connection reestablishment.
Examples of the present disclosure describe a testing framework for adaptive virtual services. In an example, a function vendor provides a network function having stated specifications to a service provider. A derived signature is generated for the network function (e.g., based on associated metadata, an image associated with the network function, and/or a network signature for the network function), which is used to classify the network function. The testing framework is used to test the network function according to its classification, thereby determining a set of capabilities. In examples, a network function having the same or similar signature as a previously tested network function may be categorized according to the previously tested network function. The network function is categorized according to its determined capabilities and added to an inventory of network functions for the service provider. Network functions in the inventory can then be selected to form a computer network.
Dependencies between services are determined based on the relationships between entities responsible for the services. The relationships are found based on past interactions between the entities. A relationship network graph having nodes representing entities and edges is built representing interactions between respective entities. The relationship network graph is analyzed to identify pairs of nodes having a relationship based on an evaluation between edge paths between the pairs of nodes compared to edge paths between other pairs of nodes. Associations are built between services owned by entities represented by the nodes of a pair of nodes identifying that nodes are dependent on one another.
Embodiments of this application provide a data transmission method and apparatus. A method at a transmit end includes: obtaining a first sequence, where the first sequence includes a first sub-sequence and a second sub-sequence; mapping the first sub-sequence into K third sub-sequences based on a preset sequence group; performing differential coding and phase modulation on the second sub-sequence to obtain a fourth sequence whose length is K′; obtaining K fifth sub-sequences based on the K third sub-sequences and the K′ fourth sub-sequences; and outputting a second sequence including the K fifth sub-sequences. A method at a receive end includes: obtaining a second sequence including K fifth sub-sequences, and detecting the K fifth sub-sequences based on a preset sequence group to obtain a first sub-sequence; and performing differential demodulation based on the first sub-sequence to obtain a second sub-sequence, so that a first sequence is determined.
Provided is a system and method for a multi-tenant datacenter with layer 2 cloud interconnection and cloud storage. More specifically, the datacenter providing cloud storage, includes a plurality of Client Systems coupled to a first datacenter each Client System having a set of infrastructure resources and an initial networking configuration; and a first cloud computing environment established in the first datacenter, and coupled to the Client Systems by OSI Layer 2 as a data link layer for the transfer of data frames, each frame having a plurality of OSI Layer 2 tags, the first cloud computing environment providing storage resources for allocation to at least two Client Systems, the plurality of OSI Layer 2 tags permitting the at least two Client Systems to have overlapping network configurations. An associated method of providing a multi-tenant datacenter with layer 2 cloud interconnection and cloud storage is also provided.
In one embodiment, a method includes acquiring an Internet Protocol version 6 (IPv6) address for a physical interface of a first network element. The method also includes configuring an Internet Protocol version 4 (IPv4) over IPv6 tunnel between the first network element and a second network element using the physical interface of the first network element. The method also includes acquiring an updated IPv6 address for the physical interface of the first network element and using an IPv6 Service Level Agreement (SLA) Hypertext Transfer Protocol (HTTP) operation to notify the second network element of the updated IPv6 address to establish a bidirectional IPv4 over IPv6 tunnel. The method further includes establishing a control connection with an IPv4 SD-WAN controller and automatically building an SD-WAN overlay tunnel with the bidirectional IPv4 over IPv6 tunnel as a transport.
A method for a multichannel geophysical data acquisition system is provided in the field of electrical resistivity tomography. Individual and autonomous node operating systems are provided. Separate communication channels for upstream and downstream data transfer, high voltage transfer and synchronization signals are provided. A novel use of high voltage isolation barriers is also provided. A direct memory access data transfer process is provided.
Aspects of the disclosure provide for a method implemented by a computing device executing an artificial intelligence electronic assistant application. In some examples, the method includes searching a local area network for smart home devices to determine an identifier associated with a smart home device, provisioning the smart home device to an ecosystem of devices that is managed by the computing device, and automatically arbitrating communication of the smart home device based on the provisioning.
A centralized document system integrates online document execution and conferencing to control access to precipitant information. Precipitant information includes access codes, personal identification numbers, sensitive information, or any other secured information for which execution of an online document is a prerequisite for access to the secured information. The centralized document system detects precipitant information that is presented during a conference and controls access to the detected precipitant information (e.g., by generating permission rules that specify a type of online document to be executed to gain access). The centralized document system may determine whether a user has executed one or more online documents and thus, has authorization to access the detected precipitant information. Responsive to determining that the user has not executed the online documents, the centralized document system can control access to the precipitant information by modifying the conference (e.g., using censors or breakout rooms).
The present invention relates to fast start-up of powered devices (22) connected to a power sourcing equipment (10′) in a Power over Ethernet system (100). A stored voltage-current profile of an initial powering phase of a powered device (22) is provided. A voltage level provided to the powered device (22) in a subsequent initial powering phase of the powered device (22) is adjusted as long as a value corresponding to a current voltage level of a voltage-current profile of the subsequent initial powering phase deviates less than a predetermined threshold level from its corresponding value of the stored voltage-current profile of the initial powering phase of the powered device (22) and until a predetermined voltage level is reached. This can allow detecting whether a previously connected powered device (22) was replaced by another powered device (22) and to immediately start-up an unchanged powered device (22) with previously used operation parameters.
Methods, systems, and devices for wireless communications are described. A user equipment (UE) receives a first control message indicating a codeblock group (CBG) scheduling configuration for scheduling CBG-based uplink communications, where the CBG scheduling configuration includes a first mapping configuration associated with uplink communications including a single codeword and a second mapping configuration associated with uplink communications including multiple codewords. The UE receives a second control message scheduling an uplink message including a set of CBGs, where the uplink message is associated with a first codeword, a second codeword, or both. The UE then transmits the uplink message in accordance with the CBG scheduling configuration, where the set of CBGs are mapped to one of the first or second codeword in accordance with the first mapping configuration, or where the set of CBGs are mapped to the first and second codewords in accordance with the second mapping configuration.
The present application relates to devices and components including apparatus, systems, and methods for determining and acknowledging transmission configuration indicator states.
Provided are a repeated transmission method and apparatus, a network device, and a storage medium. The method includes: determining a plurality of transmission occasions (TOs) for uplink data to be repeatedly transmitted; and in condition that at least one TO, among the plurality of TOs for the uplink data to be repeatedly transmitted, does not conflict with a transmission direction of a slot configuration, repeatedly transmitting the uplink data on the at least one TO.
There is disclosed a method of operating a feedback radio node in a radio access network. The feedback radio node being is configured with a plurality of sets of transmission resources for transmission of control information. Different of the sets are associated with different size classes of control information and/or different transmission formats for control information to be transmitted. The method includes transmitting control information having a number A of bits of acknowledgement information, and a number M of bits of measurement information, wherein the control information is transmitted on a resource of one of the sets based on a reference size for the measurement information. The disclosure also pertains to related methods and devices.
A system and method for transmission and receipt of signals within a distributed system are disclosed. In the distributed system there may be a plurality of digital and radio frequency (RF) electronics. The plurality of digital electronics may be coupled to the plurality of radio frequency electronics with at least one fiber optic cable. The at least one fiber optic cable may support wavelength division multiplexing (WDM). Further, the digital electronics may combine a time-at-the-tone signal, a pulse per second signal, and a standard frequency reference signal via amplitude modulation to produce a single complex wave. The single complex wave and other signals may be simultaneously transmitted along the at least one fiber optic cable to the plurality of RF electronics via WDM.
An optical module for transmitting data from a data center via a dense wavelength division multiplex (DWDM) grid includes an optical modulator, a multiplexer, and a transmitter. The optical modulator modulates first and second optical signals pulse amplitude modulation for transmission over first and second wavelengths, respectively. The first wavelength is separated from the second wavelength according to a spacing of the DWDM grid for transmitting data at a selected baud rate. The multiplexer multiplexes the modulated first and second optical signals into a multiplexed optical signal, which includes the modulated first optical signal having the first wavelength and the modulated second optical signal having the second wavelength, and outputs the multiplexed optical signal. A transmitter transmits the multiplexed optical signal via the DWDM grid at the selected baud rate.
Presented herein is a pre-5th-Generation (5G) or 5G communication system that supports higher data rates beyond 4th-Generation (4G) communication systems. In particular, methods and systems for performing cell search in a millimeter wave (mmWave) based communication network are presented. A method disclosed herein includes selecting a subset of receive (Rx) beams from a plurality of Rx beams and scheduling a scan order for the selected subset of Rx beams, upon receiving a plurality of signals from a Base Station. The method also includes performing a cell search using the selected subset of Rx beams individually in the determined scan order. The method further includes combining two or more of the selected Rx beams, upon failing the cell search using the selected subset of Rx beams individually. The method further includes performing the cell search using the combined Rx beams.
A communication system uses skywave propagation to transmit data between communication nodes over a data transmission path. An atmospheric sensor is configured to collect atmospheric data at the reflection point of the data transmission path where the transmission path is redirected from the atmosphere toward the surface of the Earth. Data collected by the atmospheric sensor may be used to predict future ionospheric conditions and determine optimum working frequencies for transmission of data between the communication nodes.
Methods, systems, and devices for wireless communications are described. In some systems, a repeater may receive a first signal from a transmitting device and determine an amplified version of the signal may not be successfully received by a receiving device. The repeater may transmit a mode switch message to the transmitting device to indicate a request for the transmitting device to switch to a transmission mode associated with one or more different transmission parameters based on detecting that the amplified version of the signal may not be received by the receiving device. The transmitting device may adjust one or more transmission parameters according to the mode switch message and may transmit a second signal to the repeater based on the adjusted transmission parameters. The repeater, operating according to the mode switch message, may receive the second signal and transmit an amplified version of the second signal to the receiving device.
Techniques to enable and provide beam failure recovery (BFR) operation for discontinuous reception (DRX) modes with wakeup signal (WUS) monitoring are described. DRX mode operation may be altered based on a BFR procedure implemented by a user equipment (UE). DRX mode operation may be altered for allowing a UE to start a DRX active time after transmitting a BFR request signal of a BFR procedure. Additionally or alternatively, DRX mode operation may be altered for allowing a UE to start an ON duration timer for a next DRX cycle after transmitting a BFR request signal of a BFR procedure. In another example, DRX mode operation may be altered for allowing a UE to monitor a BFR search space set regardless of DRX status, after transmitting a BFR request signal for a BFR procedure. Other aspects and features are also claimed and described.
An apparatus (e.g., a UE) may be configured to configure a plurality of orthogonal scrambling codes corresponding to a plurality of antenna panels of the UE and perform, for a first SSB transmission, a beam sweeping operation over a set of first beams for each antenna panel in the plurality of antenna panels, where, for a transmitted first signal in each symbol of the first SSB transmission, each antenna panel in the plurality of antenna panels receives the transmitted first signal via a beam in the set of first beams using an orthogonal scrambling code in the plurality of orthogonal scrambling codes corresponding to the antenna panel.
A codebook information processing method includes that: a reporting parameter is determined respectively for each of at least one terminal device, different terminal devices corresponding to different reporting parameters, the same terminal device corresponding to different reporting parameters under different conditions, and the reporting parameter including at least one of following information: the number of spatial bases, the number of frequency bases, and a maximum number of non-zero elements; and the reporting parameter respectively for each of the at least one terminal device is configured to different respectively.
An apparatus, method and computer program is described comprising: receiving antenna panel switching rate configuration parameters; determining an antenna panel switching rate at a user device of a communication system, wherein the antenna panel switching rate is based on a number of antenna panel switching events within a moving averaging window, wherein the window has a size defined by said configuration parameters; and providing a panel switching rate report to a network node of the communication system, wherein the panel switching rate report includes the determined antenna panel switching rate.
An apparatus for wireless communication communicates with a wireless device based on an adaptive beam weight hybrid beamforming for wireless communication and provides a request from a first network node for one or more additional network nodes to measure interference caused by the wireless communication with the adaptive beam weight hybrid beamforming. The apparatus receives a report of the interference caused to the one or more additional network nodes by the wireless communication with the adaptive beam weight hybrid beamforming.
Methods, systems, and devices for wireless communications are described. A first wireless device may be configured to transmit one or more reference signals to a second wireless device using a first antenna array at the first wireless device and in accordance with a first precoder matrix. The first wireless device may receive, from the second wireless device based on the one or more reference signals, a feedback message indicating an estimated rotational misalignment, an estimated spatial misalignment, or both, between the first antenna array at the first wireless device and a second antenna array at the second wireless device. The first wireless device may then transmit a message to the second wireless device in accordance with a second precoder matrix that is modified relative to the first precoder matrix based at least in part on the estimated rotational misalignment, the estimated spatial misalignment, or both.
An antenna system having an antenna array including at least first and second phased array antennas, and a method for field-calibrating the antenna array. Before and after a handover period, communication with respective first and second external satellites or other communication systems is performed using both the first and second antennas. A first beam is formed prior to the handover period. During a first portion of the handover period: a second beam is formed for the communication with the first satellite using the first antenna; the second antenna is deactivated for external communication; and the second antenna is calibrated. During a second portion of the handover period, the second antenna is reactivated for a handed over communication with the second satellite by forming a third beam using the second antenna, while the first antenna maintains its communication with the first satellite via the second beam.
A network device is provided with excessive interference mitigation. In one implementation, the network device transmits a notification of the excessive interference to a network entity. In another implementation, the network device changes a receive beam or begins to acquire a new cell in response to a detection of the excessive interference. In yet another implementation, the network device alerts a user in response to a detection of the excessive interference.
Path-loss measurements are determined for a test client device moving along a path in a field test environment in which field Wi-Fi mesh network nodes are distributed. The path-loss measurements are reproduced in a field-to-lab test environment that includes a test client device disposed in an electromagnetically-isolated chamber and field test Wi-Fi mesh network nodes disposed in respective electromagnetically-isolated chambers. The test client device and the field test Wi-Fi mesh network nodes are in wired or wireless communication with each other via signal lines. A programmable attenuator is electrically coupled to each signal line. The attenuation of each programmable attenuator is varied to reproduce the path-loss measurements from the field test environment. Path-loss measurements at the location of each field Wi-Fi mesh network node are also reproduced with the programmable attenuators to reproduce the field Wi-Fi mesh network node configuration.
A method in which a plurality of transmit signals are generated at data rates that are offset from each other by inserting an idle data block into a data stream for one or more transmit signals of the plurality of transmit signals to increase a data rate for the one or more transmit signals, thereby minimizing detectable electromagnetic interference at a particular frequency. The method further includes converting each transmit signal of the plurality of transmit signals to a corresponding optical transmit signal of a plurality of optical transmit signals for transmission via a corresponding channel of a plurality of channels of an optical network device and transmitting the plurality of optical transmit signals via respective ones of the plurality of channels for transmission on respective optical fibers.
A free-space optical communication system includes a transmitter and a receiver, the transmitter being configured to transmit an encrypted message to the receiver at the mid-infrared domain, the transmitter comprising a master mid-infrared optical source configured to generate a mid-infrared signal and a chaos generator configured to generate a chaotic signal by applying external optical feedback to the master mid-infrared optical source, the transmitter being configured to determine an encrypted message from an original message by applying a message encryption technique to the original message and to send the encrypted message to the receiver through an optical isolator, the receiver comprising a slave mid-infrared optical source similar to the master mid-infrared optical source the slave mid-infrared optical source being configured to recover the chaotic signal from the encrypted message by applying chaos synchronization, the receiver further comprising a first detector configured to detect the encrypted message, a second detector configured to detect the chaotic signal, and a message recovery unit configured to recover the original message from the encrypted message detected by the first detector and the chaotic signal detected by the second detector.
An on-chip wavefront sensor, an optical chip, and a communication device are disclosed. The on-chip wavefront sensor includes an antenna array configured for separating received spatial light to obtain a plurality of sub-light spots; a reference light source module configured for generating a plurality of intrinsic light beams; a phase shifter array configured for performing phase shifting processing on the intrinsic light beams to obtain reference light; and an optical detection module configured for performing coherent balanced detection according to the reference light and the sub-light spots to obtain a photocurrent corresponding to each of the sub-light spots.
A modular control device for a vehicle comprises: a base frame mounted on the vehicle; and an upgrade frame detachably mounted on the base frame. A first printed circuit board (PCB), on which a base block for providing an interface with devices in the vehicle is implemented, is mounted on the base frame. A second PCB having a memory and a main processor is mounted on the upgrade frame.
Systems, devices, and methods related to performing digital predistortion in radio frequency (RF) systems are provided. A digital predistortion (DPD) arrangement includes a DPD actuator circuit to predistort, using DPD coefficients, at least a portion of an input signal, the DPD coefficients associated with a characteristic of a nonlinear component. The DPD arrangement further includes a DPD capture circuit to perform, based on a capture cycle timing, multiple captures of a feedback signal, the feedback signal indicative of an output of the nonlinear component; compute, based on one or more characteristics of the multiple captures, one or more criteria for a subsequent capture of the feedback signal; and perform, based on the one or more criteria, the subsequent capture of the feedback signal. The DPD arrangement circuit further includes a DPD adaptation circuit to update the DPD coefficients based at least in part on the subsequent capture.
A radio frequency module includes: a module substrate having a main surface; a conductive member to partition the main surface into regions in a plan view of the main surface, and being set to ground electric potential; a switch disposed in one of the regions and connected to an antenna connection terminal; a power amplifier disposed in one of the regions and connected to the antenna connection terminal via the switch; and a low-noise amplifier disposed in one of the regions and connected to the antenna connection terminal via the switch.
Systems, methods and devices to generate tailored antenna radiation patterns for particular purposes are provided. The software-defined communication devices and systems dynamically reconfigure an antenna in a controlled and reversible manner, transmit and receive signals to a plurality of endpoints simultaneously without requiring moving elements, and control radiation patterns, making them useful and more versatile for many applications, especially in implementations concerning satellite communications. Communication links may be established with multiple endpoints simultaneously, and the position of the endpoints may be learned without knowing it in advance. The configurations described in the embodiments provide great versatility due to the possibility of processing the signal at each antenna element of the antenna.
An input stage for an analog/digital converter, an analog/digital converter and a method for testing analog/digital converters with successive approximation are disclosed. At an input stage, an input signal is supplied via a first transistor arrangement of a sampling capacitor arrangement. The sampling capacitor arrangement can be optionally connected to ground or to a reference voltage by way of a second transistor arrangement and a switch apparatus.
A clock data recovery circuit includes a bang bang phase detector receiving data and a clock signal and determining whether a phase of the clock signal leads or lags a phase of the data, a digital loop filter receiving an output of the bang bang phase detector and filtering input jitter, an accumulator accumulating an output from the digital loop filter, an encoder encoding an output of the accumulator to generate a phase interpolation code, and a phase interpolator configured to generate the clock signal with an output phase in accordance with the phase interpolation code. The digital loop filter comprises a first sigma delta modulation (SDM) arithmetic block circuit connected to the bang bang phase detector.
A bootstrapped switch includes a first transistor, a second transistor, a first capacitor, three switches, and a switch circuit. The switch circuit includes a first switch, a second switch, a third switch, a fourth switch, a fifth switch, a sixth switch, and a second capacitor. The first transistor receives the input voltage and outputs the output voltage. The first terminal of the second transistor receives the input voltage, and the second terminal of the second transistor is coupled to the first capacitor. The control terminal of the first switch receives a clock. The second switch is coupled between the control terminal of the first transistor and the first switch. The second capacitor is coupled to a reference voltage through the third switch and the sixth switch, coupled to the input voltage through the fifth switch, and coupled to the control terminal of the first transistor through the fourth switch.
Aspects of this disclosure relate to a bulk acoustic wave device with a floating raised frame structure. The bulk acoustic wave device includes a first electrode, a second electrode, a piezoelectric layer positioned between the first electrode and the second electrode, and a floating raised frame structure positioned on a same side of the piezoelectric layer as the first electrode and spaced apart from the first electrode. The floating raised frame structure is at a floating potential. The bulk acoustic wave device can suppress a raised frame mode. Related methods, filters, multiplexers, radio frequency front ends, radio frequency modules, and wireless communication devices are disclosed.
A non-isolated power supply. A positive power and a negative power are respectively formed by charging a +VCC1 energy storage filter and a −VCC2 energy storage filter connected in series and discharging the +VCC1 energy storage filter 102 and the −VCC2 energy storage filter. The output positive and negative power may be differently combined by changing the capacities of the +VCC1 energy storage filter and the −VCC2 energy storage filter and may be equal or unequal.
A switched capacitor modulator (SCM) includes a RF power amplifier. The RF power amplifier receives a rectified voltage and a RF drive signal and modulates an input signal in accordance with the rectified voltage to generate a RF output signal to an output terminal. A reactance in parallel with the output terminal is configured to vary in response to a control signal to vary an equivalent reactance in parallel with the output terminal. A controller generates the control signal and a commanded phase. The commanded phase controls the RF drive signal. The reactance is at least one of a capacitance or an inductance, and the capacitance or the inductance varies in accordance with the control signal.
Monolithic microwave integrated circuits (MMICs) tolerant to electrical overstress are provided. In certain embodiments, a MMIC includes a signal pad that receives a radio frequency (RF) signal, and an RF circuit coupled to the RF signal pad. The RF circuit includes a transistor layout, an input field-effect transistor (FET) implemented using a first portion of a plurality of gate fingers of the transistor layout, and an embedded protection device electrically connected between a gate and a source of the input FET and implemented using a second portion of the plurality of gate fingers. The MMIC is tolerant to electrical overstress events, such as field-induced charged-device model (FICDM) events.
An anti-torsion device of a solar tracker with a rotation axis, and solar tracker comprising the anti-torsion device, the device having a coupling part fixedly attached rotationally with respect to the rotation axis of the solar tracker; an extension element arranged mechanically and fixedly attached to the coupling part, further extending radially and externally with respect to the coupling part; and, an actuator and a counter-actuator arranged in a locked position, where they are in contact with the extension element, and a released position, where they are separated with respect to the extension element, when the anti-torsion device is fixedly arranged with respect to the rotation axis and in accordance with the locked position, the extension element is rotationally immobilized so that the rotation of the coupling part is further prevented.
A sensorless commutation error compensation system for a brushless motor, comprises: a brushless motor (200) and a commutation logic module circuit (100). The commutation logic module circuit (100) is connected to three virtual Hall signal output ends of the brushless motor (200), and used for receiving three virtual Hall signals output by the brushless motor (200), obtaining three error compensation angle signals on the basis of the three virtual Hall signals, respectively superimposing the three error compensation angle signals and the three virtual Hall signals to form superposition results, and controlling the brushless motor (200) to adjust commutation timing on the basis of the superposition results, so as to achieve commutation error compensation. The system controls commutation errors on the basis of currents and counter-electromotive forces of three phases, instead of controlling the commutation errors on the basis of the current and the counter-electromotive force of one of the three phases, so that a torque ripple of a brushless direct-current motor can be reduced and a working efficiency of the motor can be improved.
An abnormality diagnosis system configured to diagnose an abnormality of an electric drive system mounted on a mobile body to drive a motor for moving the mobile body, includes: an information acquisition unit configured to acquire a motor output information which is information related to an output state of the motor; an output state determination unit configured to determine whether the output state of the motor is in a low output state that does not contribute to a movement of the mobile body by using the motor output information; and a diagnosis execution unit configured to diagnose an abnormality of the electric drive system when it is determined that the motor is in the low output state.
An electrical circuit arrangement includes an inverter, a driver circuit and a protective circuit. The inverter includes a plurality of inverter switching elements each having a drive connection. The drive connection of at least one inverter switching element is connected to the driver circuit via a first switching element of the protective circuit (6). A drive connection of the first switching element is connected to a circuit node, which is connected to a first potential via a resistor and to a second potential via a second switching element. The protective circuit comprises a comparison device, an input of which is connected to an operating voltage and a reference voltage and an output of which is connected to a drive connection of the second switching element so that, if the operating voltage deviates from the reference voltage, the second switching element is switched and the first switching element is switched due to one of the first potential or the second potential being applied to the circuit node as a result of the switching of the second switching element.
A control device is provided which controls an electric drive system, which has a motor that rotates a rotor blade and an inverter circuit that has a switching element and controls the motor and which is installed in a flying body. The control device includes an abnormality occurrence detection unit that detects occurrence of a predetermined abnormality accompanied with an abnormality of temperature of the switching element, and a switching element control unit that controls, when the occurrence of the predetermined abnormality is detected, the switching element so as to reduce loss in the switching element.
An apparatus and a method for inverter control are disclosed. A method according to an embodiment of the present disclosure comprises: discretizing, in a continuous time domain, a voltage equation for a motor in a stationary coordinate system in which a zero-order hold and time delay is reflected; and determining a voltage equation for the motor in a synchronous coordinate system in a discrete time domain by reflecting the position and speed of a rotor of the motor.
In an electric motor control device which controls rotation of an AC electric motor having two sets of three-phase windings and provided with a resolver having two systems by calculating voltage command values on dq axes, dq conversion of currents of first three-phase windings is performed using a first angle calculated from output of the first system of the resolver, and dq conversion of currents of second three-phase windings is performed using a second angle calculated from output of the second system of the resolver. With both d-axis current command values set at the same value, respective voltage command values on dq axes are calculated and respectively converted into voltage command values for voltage application to the first three-phase windings, using the first angle, and converted into voltage command values for voltage application to the second three-phase windings, using the second angle.
Piezoelectric vibrational energy harvesters (PVEHs) include a Macro Fiber Composite (MFC)) piezoelectric transducer coupled to a cantilever to harvest vibrational energy. One or more Ionic Polymer Metal Composite (IPMC) strips are situated to provide device tuning over a wide frequency range by applying variable contact force to the cantilever. Power consumption for tuning is sufficiently low that the tuning actuator (IPMCs) can be powered using harvested energy.
In an example, a rectifier circuit includes first and second capacitors, first and second current control devices, and a switch. The first current control device is configured to provide an input current to the first capacitor during a positive cycle of an alternating current (AC) input voltage. The second capacitor is configured to store a charge and the switch is configured to couple the second capacitor to a ground terminal so the second capacitor discharges a capacitor current during the positive cycle of the input voltage responsive to the stored charge in the second capacitor. The second current control device is configured to provide the capacitor current to the first capacitor during the positive cycle of the input voltage. The first capacitor is configured to store a charge responsive to the input current and the capacitor current.
Control circuitry for controlling a current through an inductor of a power converter, the control circuitry comprising: comparison circuitry configured to compare a measurement signal, indicative of a current through the inductor during a charging phase of the power converter, to a signal indicative of a target average current through the inductor for the charging phase and to output a comparison signal based on said comparison; detection circuitry configured to detect, based on the comparison signal, a crossing time indicative of a time at which the current through the inductor during the charging phase is equal to the target average current for the charging phase; and current control circuitry configured to control a current through the inductor during a subsequent charging phase based on the crossing time.
A control circuit used in a switching converter having a switch and an inductor. The control circuit has an error amplifying circuit, a current comparing circuit, a clock generator and a constant OFF time generator. The error amplifying circuit receives a voltage reference signal and a voltage feedback signal indicative of an output voltage signal, and provides an error signal. The current comparing circuit compares the error signal with a current sensing signal indicative of a current flowing through the inductor, and provides a comparing signal to turn the switch OFF. When the switching converter is coupled to a filtering capacitor, the clock generator provides a clock signal to turn the switch ON, and when the switching converter is coupled to a super capacitor, the clock generator is disabled and the constant OFF time generator provides a constant OFF time signal to turn the switch ON.
An objective of the disclosure is to provide a power supply cell of a power supply system and a power supply system using the same. The power supply cell includes a first power conversion circuit operative to output a first DC voltage across its first positive terminal and first negative terminal, a second power conversion circuit operative to output a second DC voltage across its second positive terminal and second negative terminal, a first controllable unidirectional semiconductor switch operative to generate a first conduction path from the first positive terminal of the first power conversion circuit to the second negative terminal of the second power conversion circuit, a first unidirectional semiconductor switch operative to generate a second conduction path from the first positive terminal of the first power conversion circuit to the second positive terminal of the second power conversion circuit, a second unidirectional semiconductor switch operative to generate a third conduction path from the first negative terminal of the first power conversion circuit to the second negative terminal of the second power conversion circuit, a first low-pass filter, a second low-pass filter, a third low-pass filter and a controlling unit. The controlling unit is operative to: issue turn-on signal to the first controllable unidirectional semiconductor switch so that the first power conversion circuit and the second power conversion circuit supply current to the first low-pass filter via the first conduction path, the second low-pass filter and the third low-pass filter; or issue turn-off signal to the first controllable unidirectional semiconductor switch so that the first power conversion circuit and the second power conversion circuit supply currents to the first low-pass filter in parallel via the second conduction path and the second low-pass filter together with the third conduction path and the third low-pass filter. The first low-pass filter can help smooth an output voltage and current in order to achieve a relatively wide linearly constant output power range.
Embodiments disclosed herein include inductor arrays. In an embodiment, an inductor array comprises a first inductor with a first inductance. In an embodiment, the first inductor is switched at a first frequency. In an embodiment, the inductor array further comprises a second inductor with a second inductance that is different than the first inductance. In an embodiment, the second inductor is switched at a second frequency that is different than the first frequency.
A switching control circuit configured to control a switching device. The switching control circuit includes a detection circuit configured to detect whether a current flowing through the switching device is in an overcurrent state, a first signal output circuit configured to output a first signal indicating whether a time period of the overcurrent state is longer than a first time period, and a driving circuit. The driving circuit turns on the switching device based on a first input signal. The driving circuit turns off the switching device through a first switch based on a second input signal when the time period of the overcurrent state is shorter than the first time period, and through a second switch, having a greater on-resistance than the first switch, based on the second input signal and the first signal when the time period of the overcurrent state is longer than the first time period.
Energy generating system that generates energy from an external source includes a frame having two vertically spaced apart supports and at least one rod extending therebetween. An electromagnetic power generating arrangement is between the supports and includes a movable power generating coil, a first stationary power generating coil that interacts with the movable coil at an upper position in an upward path of movement of the movable coil, and a second stationary power generating coil that interacts with the movable coil at a lower position in a downward path of movement of the movable coil to generate electricity which is conveyed through a cable to an electricity processing system. The movable coil is connected to each rod, and the movable coil is lifted from the lower position to the upper position along each rod, ideally through energy from an external source.
Example generator brush adapters include a plate configured to mount to a static support structure and to couple to a brush assembly, such that the brush assembly is mounted to the static support structure along a single degree of freedom.
There is provided motor, including: a stator including a plurality of laminated plates; and a rotor arranged inside the stator with a gap between the rotor and the stator, wherein the stator further includes an annular yoke located outside of the stator and a plurality of teeth protruding from an inner peripheral surface of the yoke toward the rotor, wherein slots in which coils wound around the teeth are arranged are formed between the teeth that are adjacently arranged, wherein gaps to which a cooling medium is supplied are formed between bottom portions of the slots and the coils, and wherein the stator further includes end plate members arranged so as to face the laminated plates.
A rotor and a method of making such a rotor, wherein the rotor has a shaft, a longitudinal axis, and a rotor packet connected to the shaft at least in torsion-resistant manner. The rotor packet is assembled from individual sheet lamellae, wherein the rotor packet has an opening for receiving the shaft. The shaft is a hollow shaft with a wall, wherein the wall of the shaft has, on its side facing toward the opening, recesses extending in the longitudinal direction. An electric motor, in particular a synchronous or hybrid synchronous machine, including a rotor and a stator, has such a rotor. The recesses are produced by cutting methods, in particular milling, or reshaping methods, in particular pressing.
A power system includes a base module including a system management controller (SMC) and a power distribution unit (PDU), an uninterruptible power supply (UPS) module including a UPS, and a battery module including a battery. The base module includes a first edge, and the battery module is detachable from UPS module in a direction perpendicular to the first edge.
Networked electric vehicle charging stations for charging electric vehicles are coupled with an electric vehicle charging station network server that performs authorization for charging session requests while the communication connection between the charging stations and the server are operating correctly. When the communication connection is not operating correctly, the networked electric vehicle charging stations enter into a local authorization mode to perform a local authorization process for incoming charging session requests.
A contactless power supply system includes: a power transmitter including a first capacitor and a power transmission coil, and having a first resonant frequency; a power receiver including a second capacitor and a power reception coil, and having a second resonant frequency; and a repeater that transmits, to the power reception coil, AC power received from the power transmission coil. The repeater may include: a relay power reception coil unit that receives AC power and includes at least one coil that defines a first stray capacitance for forming a first self-resonant frequency having a frequency identical to the first resonant frequency; and a relay power transmission coil unit that transmits AC power and includes at least one coil that defines a second stray capacitance for forming a second self-resonant frequency having a frequency identical to the second resonant frequency.
In the wireless charging receive apparatus of the electronic device, a first communication circuit receives charging data, where the charging data is used to indicate a charging type. A first controller identifies, based on the charging data, that the charging type is a first charging type, and outputs a first rectifier control signal to control a first rectifier circuit to operate in a half-bridge mode. Alternatively, a first controller identifies, based on the charging data, that the charging type is a second charging type, and outputs a second rectifier control signal to control a first rectifier circuit to operate in a full-bridge mode. A first receive coil receives an alternating magnetic field and outputs a first induced voltage.
A wireless power transfer device may include a first circuit configured to be connected in series with a coil, a second circuit, and a switch, where switching a state of the switch may selectively couple the second circuit to the first circuit. The switch may be driven by a pulse width modulation (PWM) signal. The device may further include a PWM controller to receive measurements indicative of wireless power transferred through the coil, generate the PWM signal, and adjust the PWM signal to provide the wireless power transferred through the coil according to a selected metric.
Various embodiments of the disclosure relate to an electronic device and method that increases the efficiency of power supplying of a wireless charging circuit. The processor may perform a wireless power sharing function, may identify the type of an external device aligned with a coil of the electronic device, may supply a designated first power to a wireless charging integrated circuit of the electronic device in the case in which the external device is a first device, the first device being a device that requests a voltage higher than a reference voltage level, may control the wireless charging IC to generate a current of the coil based on the first power, may activate a path that directly connects a battery of the electronic device and the wireless charging IC, and may supply a second power lower than the first power to the wireless charging IC via the path.
A system and method for automatically tuning/configuring a power system stabilizer (PSS) in a power system digital excitation control system having an automatic voltage regulator (AVR) that includes providing a control input to the AVR as a function of generating a set of tuning PSS lead-lag phase compensation time constants as a function of received generated terminal voltages, generating an uncompensated frequency response as a function of the received set of generated terminal voltages and using particle swarm optimization (PSO) as a function of the generated uncompensated frequency response, generating a tuning PSS gain value as a function of a determined open loop frequency response of the power system, determining a PSS gain margin, determining a tuning PSS gain; and transmitting the determined set of tuning phase compensation time constants and the determined tuning PSS gain value to the control interface of the PSS.
The present disclosure provides a power clamp device. The power clamp device includes a delay element, a first transistor, a second transistor, and a gate control circuit. The delay element has an input terminal and an output terminal. The first transistor has a gate electrically connected to the output terminal of the delay element. The second transistor has a source electrically connected to a drain of the first transistor. The gate control circuit has a first terminal electrically connected to the input terminal of the delay element, a second terminal electrically connected to the output terminal of the delay element, and a third terminal electrically connected to a gate of the second transistor.
An example busway system is provided that includes a first busway, a second busway, and a joint seal coupling the first busway to the second busway. The first busway includes a first end and an opposing second end, and the second busway includes a third end and an opposing fourth end. The joint seal includes panels configured to at least partially slide over the first or the opposing second end of the first busway, and at least partially slide over the third or the opposing fourth end of the second busway to couple the first busway to the second busway. The joint seal creates a seal at a joint formed by the first busway, the second busway, and the joint seal.
A pushing tool for propelling cable into a duct. The pushing tool includes a drive wheel that is coupled with a base and a rotatable handle. A first cable guide and a second cable guide are configured to hold the cable. A duct guide is configured to hold the duct. Furthermore, a tension wheel is configured to interact with the drive wheel such that an orifice is formed between the tension wheel and the drive wheel, the orifice being configured to receive the cable. Upon rotation of the rotatable handle, the drive wheel interacts with the tension wheel to propel the cable into the duct.
A structure for connecting an aluminum cable and a terminal includes an aluminum cable and a terminal. The aluminum cable includes a cable core. The cable core is constructed with a cable welding portion. The terminal is welded to the cable welding portion. A nominal cross-sectional area of the cable core is M, and a welding area S between the cable welding portion and the terminal meets 5*M≤S≤6*M.
Methods and systems for monitoring a brush holder assembly and/or detecting wear of a brush in a brush holder assembly are disclosed. One method includes sending data from a plurality of remote monitoring locations to a central control unit, where the data may be evaluated in order to monitor states of brushes at a plurality of remote electrical facilities. For example, multiple images of a marker tracking longitudinal movement of the brush may be acquired. A comparison of the images, for example, a comparative imaging technique, such as pixel-by-pixel comparison, may then be performed in order to evaluate a condition of the brush, such as the wear rate, wear state, or life expectancy of the brush.
Disclosed is a cable adaptor which is connected to a cable including an outer conductor. The adaptor includes a contact pin which comes into contact with a signal pin of the cable, a first member which is conductive and disposed inside and coupled to the contact pin, a second member disposed outside and coupled to the contact pin, and a third member which is conductive and disposed outside the second member. Here, the contact pin includes a first body coupled to the second member, a first contact portion which is conductive and extends from one side of the first body to come into contact with the signal pin, and a second contact portion which extends from the other side of the first body and comes into contact with an object being tested. The third member includes a second body coupled to the second member and a third contact portion.
A coradial connector is disclosed. The coradial connector system includes a plug and socket. The plug has a plug housing, a plug process conductor, a plug signal conductor disposed coaxially with the plug process conductor, and a plug insulator disposed coaxially with the plug process conductor, between the plug process conductor and signal conductor. The socket includes a socket housing, a socket process conductor, a socket signal conductor disposed coaxially with the socket process conductor, and a socket insulator disposed coaxially with the socket process conductor, between the socket process conductor and signal conductor.
It is aimed to provide a connector capable of satisfactorily holding a board even in a high-temperature and high-humidity atmosphere. A connector is provided with a connector housing including a board accommodation space, a terminal fitting mounted in the connector housing to face the board accommodation space, and a retainer for sandwiching and holding a flexible board arranged in the board accommodation space between the terminal fitting and the retainer. A state of the retainer changes to a pressing state for pressing the flexible board toward the terminal fitting and a non-pressing state for releasing pressing to the flexible board. The retainer is made of metal.
A cable connector and a connector assembly including the cable connector are provided. The cable connector includes a plastic main body, a contact body and a cable. A cavity is formed in the plastic main body. The contact body is fixed on the plastic main body and extends into the cavity. The cable is fixed on the plastic main body. One end of the cable is inserted into the plastic main body and is electrically connected to the contact body in the cavity, and an electrically connected portion is exposed in the cavity. The electrically connected portion between the cable and the contact body is exposed in the cavity, so that a clearance is formed at the welding spots between the cable and the contact body and is not injection-moulded by the internal mould, which reduces the attenuation of the cable and greatly improves the signal integrity of the product.
A circuit board including a through-hole into which a press-fit terminal portion is inserted in a depth direction; an inner wall land provided on an inner wall of the through-hole; and a plurality of inner layer lands which are provided in an inner layer of the circuit board, are planes substantially parallel to a mounting surface of the circuit board, and are in contact with the inner wall land. The inner wall land has a first region that is in contact with the press-fit terminal portion and a second region that is not in contact with the press-fit terminal portion. Among the plurality of inner layer lands, a first inner layer land, which is an inner layer land disposed on an identical surface with the first region of the inner wall land, is wider than a second inner layer land which is an inner layer land disposed on an identical surface with the second region of the inner wall land.
A sensor configured to determine a condition of an electrical device may include an antenna, a receiver and a controller designed to implement a method. The method of determining a condition of an electrical device may include selecting a plurality of singular dimensional components of a multi-dimensional signal of a radio frequency (RF) emission from an electrical device, extracting singular dimensional components individually or as a combination, inputting each individual extracted singular dimensional component or the combination of the components into a neural network (NN), and analyzing, with NN, outputs from the inputted singular dimensional component (s). Singular-spectrum analysis (SSA) and/or wavelet transform may be used to select components.
A multi-core connector used for 5G communication repeater, in which as a 5-core connector, with respect to prior art, an overall diameter is reduced from 32-35 mm to about 24.10 mm; the maximum external diameter is reduced from about 39.73 mm to about 27.70 mm, increasing an adaptive frequency from DC-20 GHz to DC-40 GHz to meet a demand of mmWave; an outer conductor of a female connector and that of a male connector abut against each other, so a gap possibly existed in the prior art is cancelled in a contacting interface, so as to enhance a shielding effect; in order to improve a push-on accuracy and avoid a traditional blind mate, right orientation indicating marks are set on a cylindrical surface of the male connector and that of the female connector, respectively; at least two bayonets are arranged circumferentially on an outer insert guiding surface of a male connector shell, and grooves matched with the bayonets are arranged circumferentially on an inner receptacle guiding surface of a female connector shell; a cylinder surface of a coupling nut is provided with spiral grooves, thus after the bayonets enter the spiral grooves, once the coupling nut is rotated up to an angle, the plug and socket can be clicked.
An antenna structure includes a first antenna element connected to a first port, and a second antenna element connected to a second port. The antenna structure is operable to simultaneously transceive: a first signal via electric or magnetic current flow through the first antenna element in a symmetrically excited mode in which current flows symmetrically through the first antenna element and/or an asymmetrically excited mode in which current flows asymmetrically through the first antenna element, the first antenna element resonates at a first resonant frequency; and a second signal via electric or magnetic current flow through the second antenna element in a symmetrically excited mode in which current flows symmetrically through the second antenna element and/or an asymmetrically excited mode in which current flows asymmetrically through the second antenna element, the second antenna element resonates at a second resonant frequency.
An antenna unit includes: a first substrate, a second substrate, and a third substrate which are stacked. The second substrate has a first slotted area. A liquid crystal layer is arranged in a cavity formed by the first substrate, the first slotted area of the second substrate, and the third substrate. The first substrate includes: a first base substrate, a ground layer on one side of the first base substrate close to the second substrate, and a feed structure layer on one side of the first base substrate away from the second substrate. Orthogonal projections of the ground layer and the feed structure layer on second substrate overlap with an orthogonal projection of first slotted area on the second substrate. The third substrate includes: a third base substrate, and a radiation structure layer on one side of the third base substrate close to the second substrate.
A wearable electronic device includes a front with a lens connected thereto, and includes a first metal portion. A first leg is connected to one end of the front through a first hinge, and includes a second metal portion. A second leg is connected to the other end of the front through a second hinge. A printed circuit board (PCB) includes a ground portion electrically connected to the first metal portion and/or the second metal portion. An antenna structure includes a radiating element and a feeder electrically connected to the radiating element. The antenna structure is electrically connected to the ground portion. A first switch circuit is configured to electrically connect or disconnect the first metal portion and the second metal portion and is also configured to change an impedance for connecting the first metal portion and the second metal portion. A controller controls the first switch circuit.
A directional coupler includes a main line, a secondary line, and a variable terminator. The variable terminator includes a variable inductor. The variable inductor includes a plurality of inductors coupled in series with each other between an end portion of the secondary line and the ground and switches configured to bypass at least one inductor of the plurality of inductors.
Waveguide filters comprising ridges disposed within a waveguide cavity for selecting electromagnetic signals within a frequency passband. An apparatus includes a waveguide filter comprising a waveguide cavity and a plurality of ridges disposed within the waveguide cavity. The apparatus is such that each of the plurality of ridges comprises a first side and a second side, and wherein the first side and the second side are disposed at a non-orthogonal angle relative to one other. The apparatus is optimized for fabrication using metal additive manufacturing techniques.
A radio frequency (RF) transmission line is described. The RF transmission line includes a first ground line, a second ground line, and a signal line disposed on a substrate and forming a coplanar waveguide. A plasma limiter feature is integrated into an internal surface of one or more of the first ground line, the second ground line, and the signal line. The plasma limiter decreases a gap distance between the signal line and the associated ground line. The gap distance is selected, together with a gas pressure, to control a voltage at which the gas within the gap breaks down, targeted at a breakdown power of 1 W across a wide bandwidth. The plasma limiter thus limits a power transmitted by way of the RF transmission line for protecting a sensitive integrated circuit.
A cell including: a body having a first end portion and a second end portion; a first electrode layer electrically connected to the body; a solid electrolyte layer located on the first electrode layer; and a second electrode layer located on the solid electrolyte layer, wherein the body includes a flared gas-flow passage passing through the body from the first end portion to second end portion; and diameters of opposing end portions of the flared gas-flow passage are greater than a diameter of the flared gas-flow passage at a central portion between the opposing end portions.
The present invention relates to a direct alcohol fuel cell comprising a housing containing a proton exchange membrane (PEM) separating an anode section from a cathode section, which anode section and which cathode section are contained in the housing, the cathode section comprising a cathode collection element having one or more ventilation holes, which cathode collection element is electrically connected to a cathode catalyst, which cathode catalyst is in diffusive communication with a gaseous oxidant, and the anode section comprising an anode collection element electrically connected to an anode catalyst, the DAFC comprising an oleophobic filter covering the ventilation hole(s). The oleophobic filter may be held in place using any appropriate means as desired. The fuel cell is suited for a microelectronic device.
Battery module includes: battery stack including a plurality of batteries that are stacked, each of the plurality of batteries having valve portion; duct plate configured to cover a first surface of battery stack on which a plurality of valve portions are disposed, duct plate having gas discharge duct that temporarily stores a gas blown off from valve portions of respective batteries; cover plate placed on duct plate; flow path portion defined by duct plate and cover plate, flow path portion being connected to gas discharge duct through opening, flow path portion extending in a first direction that intersects with stacking direction of the batteries, flow path portion allowing leaking of the gas in gas discharge duct to an outside of battery module; and gas restricting wall portion disposed in gas discharge duct between valve portion and opening.
The vehicle battery system includes a plurality of battery blocks including a plurality of battery cells and an exterior case that stores the plurality of battery blocks. The exterior case includes a tubular case in which the upper case is fixed to lower case, a pair of end face plates fixed to both ends of the tubular case to close the openings at both ends, and partition walls fixed to the middle portion of the tubular case. Lower case, the upper case, end face plates, and partition walls are made of pressed metal plates, lower case has a groove shape having side walls coupled to both sides of bottom plate, having coupling ribs coupled to an upper end edge of side walls, and having a same shape in a cross section at each portion separated in a longitudinal direction, the plurality of battery blocks are disposed in the longitudinal direction in an orientation extending in the longitudinal direction of the tubular case, and fixed to the exterior case, and the exterior case is further fixed to the vehicle via external fixing brackets.
The disclosure describes a battery pack including at least one battery cell, an outer housing that has at least one first housing element, and a cell holder configured to receive the at least one battery cell. In this case the first housing element is constituted by a two-component part that includes at least one first hard component element, one second hard component element and at least one soft component element, the first hard component element and the second hard component element fixedly connected to each other via the at least one soft component element.
Embodiments described herein relate to electrochemical cells with one or more current collectors divided into segments, and methods of producing the same. A current collector divided into segments comprises a substantially planar conductive material including a connection region and an electrode region. The electrode region includes one or more dividers defining a plurality of electron flow paths. The plurality of electron flow paths direct the flow of electrons from the electrode region to the connection region. In some embodiments, the current collector includes a fuse section disposed between the electrode region and the connection region. In some embodiments, the fuse section can include a thin strip of conductive material, such that the thin strip of conductive material melts at a melting temperature and substantially prevent electron movement between the electrode region and the connection region.
An electrode includes: an active material coating portion coated with an electrode active material on at least one surface of an electrode collector; an active material non-coating portion which is formed on one side of the active material coating portion and is not coated with the electrode active material; and an electrode coating portion which is coated between the active material coating portion and the active material non-coating portion and contains a flame retardant.
A method of forming a solid-state lithium ion rechargeable battery may include depositing a metal layer onto a top surface of a substrate, depositing a handle layer onto a top surface of the metal layer, wherein a portion of the handle layer overlaps the metal layer and the substrate, spalling a portion of the substrate thereby forming a spalled substrate layer, porosifying the spalled substrate layer thereby forming a porous substrate layer, depositing an electrolyte layer onto a top surface of the porous substrate layer, wherein the electrolyte layer is in direct contact with the porous substrate layer, and depositing a cathode onto a top surface of the electrolyte layer. The method may include depositing a cathode contact layer onto a top surface of the cathode, wherein the cathode contact layer is in direct contact with the cathode. The porous substrate layer may be made of silicon.
A method for the regeneration of cathode material from spent lithium-ion batteries is provided. The method includes dissolving a lithium precursor in a polyhydric alcohol to form a solution. Degraded cathode material containing lithium metal oxides are dispersed into the solution under mechanical stirring, forming a mixture. The mixture is heat treated within a reactor vessel or microwave oven. During this heat treatment, lithium is intercalated into the degraded cathode material. The relithiated electrode material is collected by filtration, washing with solvents, and drying. The relithiated electrode material is then ground with a lithium precursor and thermally treated at a relatively low temperature for a predetermined time period to obtain regenerated cathode material.
A secondary battery activation method includes a pre-aging step for aging, at room temperature, a secondary battery comprising a positive electrode comprising a positive electrode active material, a negative electrode comprising a negative electrode active material, a separator disposed between the positive electrode and the negative electrode, and an electrolyte; a charging step for primarily charging the pre-aged secondary battery to 60% or more of state of charge (SOC) of the secondary battery; a high-temperature aging step for aging the primarily charged secondary battery at a high temperature; and a room-temperature aging step for aging, at room temperature, the secondary battery which has been aged at a high temperature, wherein the high-temperature aging step is performed at a temperature of 60° C. or higher.
This application provides a lithium-ion battery, a battery module, a battery pack, and an apparatus. The lithium-ion battery includes a positive electrode plate, a negative electrode plate, a separator, and a nonaqueous electrolyte. The positive electrode plate includes Li1+xNiaCobMe(1−a−b)O2−cYc, where −0.1≤x≤0.2, 0.8≤a<1, 0
A solid electrolyte material according to the present disclosure consists essentially of Li, M, O, and X. M is at least one element selected from the group consisting of Nb and Ta, and X is at least one element selected from the group consisting of Cl, Br, and I.
The present invention relates to a lithium secondary battery which includes a non-aqueous electrolyte solution including lithium bis(fluorosulfonyl)imide (LiFSI) and a fluorobiphenyl compound, a positive electrode including a lithium-nickel-manganese-cobalt-based oxide as a positive electrode active material, a negative electrode, and a separator.
A light-emitting device according to one embodiment of the present disclosure includes: a reflective structure having a first surface and a second surface and having, on the first surface, an opening whose side surface is provided with a first reflective film; a semiconductor light-emitting element including a first conductivity-type layer, an active layer, and a second conductivity-type layer that are stacked, the opening of the reflective structure and the active layer being disposed to be opposed to each other; and a support member having a light-transmitting property and having a first surface and a second surface, the semiconductor light-emitting element being disposed on the first surface side, the reflective structure being disposed on the second surface side, the second surface being at least partially in contact with the first surface of the reflective structure.
A phosphor substrate having at least one light emitting element mounted on one surface, and includes an insulating substrate, an electrode layer disposed on one surface of the insulating substrate and bonded to the light emitting element, and a phosphor layer which is disposed on one surface of the insulating substrate and includes a phosphor in which a light emission peak wavelength, in a case where light emitted by the light emitting element is used as excitation light, is in a visible light region, in which a surface of the electrode layer facing an outer side in a thickness direction of the insulating substrate is a flat surface, and at least a part of the phosphor layer is disposed around a bonded portion of the electrode layer with the light emitting element.
A single-photon source includes a substrate of a wide-bandgap semiconductor provided with a light-emission region including only one target point detect, a cover mask arranged on a main surface of the substrate and having an opening to which the light-emission region in the substrate is exposed, and an excitation system configured to shift an electron in a defect-ground state to an excited state at the point defect in the light-emission region. A single photon released from the point defect in the light-emission region when the electron in the excited state is shifted to the ground state is output through the opening in the cover mask.
A method for manufacturing a light-emitting element, includes: introducing a gas comprising gallium, an ammonia gas, and a gas comprising a p-type impurity to a reactor and forming a first p-type nitride semiconductor layer on a first light-emitting layer in a state in which the reactor has been heated to a first temperature; introducing an ammonia gas at a first flow rate and a nitrogen gas to the reactor in a state in which the reactor is held at the first temperature; and subsequently introducing a gas comprising gallium, an ammonia gas at a second flow rate, and a gas comprising an n-type impurity to the reactor, and forming a second n-type nitride semiconductor layer on the first p-type nitride semiconductor layer. The first flow rate is less than the second flow rate.
A vertical current mode solid state device comprising a connection pad and side walls comprising a metal-insulator-semiconductor (MIS) structure, wherein leakage current effect of the vertical device is limited through the side walls by biasing the MIS structure.
A package includes: a bottom portion having a mounting surface; and a lateral wall portion having a top surface and including: a lateral wall having a rectangular outer shape in a top view and surrounding the mounting surface, and a stepped portion formed along the lateral wall below the top surface. In the top view, the stepped portion includes a wide portion and a narrow portion that are two regions having different widths. The narrow portion is formed on a portion along a one side of an entire circumference of the lateral wall.
Device structures, apparatuses, and methods are disclosed for photovoltaic cells that may be a single-junction or multijunction solar cells, with at least a first layer comprising a group-IV semiconductor in which part of the cell comprises a second layer comprising a III-V semiconductor or group-IV semiconductor having a different composition than the group-IV semiconductor of the first layer, such that a heterostructure is formed between the first and second layers.
A semiconductor device having favorable electrical characteristics is provided. The semiconductor device in which first to third conductors are placed over a first oxide; first and second oxide insulators are placed respectively over the second and third conductors; a second oxide is placed in contact with a side surface of the first oxide insulator, a side surface of the second oxide insulator, and a top surface of the first oxide; a first insulator is placed between the first conductor and the second oxide; and the first oxide insulator and the second oxide insulator are not in contact with the first to third conductors, the first insulator, and the first oxide.
A thin film transistor and a manufacturing method thereof are provided. The thin film transistor includes a composite electrode including a barrier layer and an electrode layer. The barrier layer has a protruding part relative to the electrode layer, an orthographic projection of the protruding part on the composite electrode protrudes beyond an orthographic projection of the electrode layer on the composite electrode, and a length of the protruding part ranges from 0.3 um to 0.5 um. The thin film transistor and the manufacturing method thereof of the present disclosure can relieve light leakage, thereby improving a contrast ratio of products.
A compact vertical semiconductor device and a manufacturing method thereof, and an electronic apparatus including the semiconductor device are provided. According to the embodiments, the vertical semiconductor device may include: a plurality of vertical unit devices stacked on each other, in which the unit devices include respective gate stacks extending in a lateral direction, and each of the gate stacks includes a main body, an end portion, and a connection portion located between the main body and the end portion, and in a top view, a periphery of the connection portion is recessed relative to peripheries of the main body and the end portion; and a contact portion located on the end portion of each of the gate stacks, in which the contact portion is in contact with the end portion.
A semiconductor power device includes a substrate; a buffer structure formed on the substrate; a barrier structure formed on the buffer structure; a channel layer formed on the barrier structure; and a barrier layer formed on the channel layer; wherein the barrier structure includes a first functional layer on the buffer structure, a second functional layer formed between the first functional layer and the buffer structure, a first back-barrier layer on the first functional layer, and an interlayer between the first back-barrier layer and the first functional layer; wherein a material of the first back-barrier layer includes Alx1Ga1-x1N, a material of the first functional layer includes Alx2Ga1-x2N, a material of the interlayer includes Alx3Ga1-x3N, a material of the second functional layer includes Alx4Ga1-x4N, wherein 0
Disclosed are a semiconductor structure and a manufacturing method therefor, solving the problem that it is difficult for an existing semiconductor structure to deplete a carrier concentration of a channel under a gate so as to achieve an enhancement-mode device. The semiconductor structure comprises: a channel layer and a barrier layer stacked in sequence. A gate region is defined on a surface of the barrier layer; a plurality of trenches formed in the gate region. The plurality of trenches are extended into the channel layer; and a stress applying material filled in the plurality of trenches. A lattice constant of the stress applying material is greater than that of the channel layer.
In an embodiment, a HEMT is formed to have a main transistor having a main active area and a sense transistor having a sense active area. An embodiment may include that the main active area is isolated from the sense active area.
A method includes forming a semiconductor fin protruding higher than a top surface of an isolation region. The semiconductor fin overlaps a semiconductor strip, and the semiconductor strip contacts the isolation region. The method further includes forming a gate stack on a sidewall and a top surface of a first portion of the semiconductor fin, and etching the semiconductor fin and the semiconductor strip to form a trench. The trench has an upper portion in the semiconductor fin and a lower portion in the semiconductor strip. A semiconductor region is grown in the lower portion of the trench. Process gases used for growing the semiconductor region are free from both of n-type dopant-containing gases and p-type dopant-containing gases. A source/drain region is grown in the upper portion of the trench, wherein the source/drain region includes a p-type or an n-type dopant.
A semiconductor device including a gaseous spacer and a method for forming the same are disclosed. In an embodiment, a method includes forming a gate stack over a substrate; forming a first gate spacer on sidewalls of the gate stack; forming a second gate spacer over the first gate spacer; removing a portion of the second gate spacer, at least a portion of the second gate spacer remaining; removing the first gate spacer to form a first opening; and after removing the first gate spacer, removing the remaining portion of the second gate spacer through the first opening.
In an embodiment, a device includes: a first channel region; a second channel region; and a gate structure around the first channel region and the second channel region, the gate structure including: a gate dielectric layer; a first p-type work function metal on the gate dielectric layer, the first p-type work function metal including fluorine and aluminum; a second p-type work function metal on the first p-type work function metal, the second p-type work function metal having a lower concentration of fluorine and a lower concentration of aluminum than the first p-type work function metal; and a fill layer on the second p-type work function metal.
Gate fingers extending symmetrically from both sides of gate connecting portions, drain electrodes adjacent to both the gate fingers extending from both the sides of the gate connecting portions, and source electrodes respectively adjacent to the gate fingers extending from both the sides of the gate connecting portions are included. Gate air bridges connect the gate connecting portions and a gate routing line while straddling the source electrodes.
Semiconductor structures and methods of forming the same are provided. A semiconductor structure includes gate electrodes and first insulation patterns laterally disposed and alternately arranged on a substrate, a gate dielectric layer disposed on the gate electrodes and the first insulation patterns, at least one channel pattern disposed on the gate dielectric layer, source electrodes and drain electrodes laterally disposed and alternately arranged on the channel pattern, and second insulation patterns disposed on the channel pattern between the source and drain electrodes. Besides, from a top view, each of the drain electrodes is overlapped with one of the first insulation patterns.
a transistor and an interconnect structure disposed over the transistor. The interconnect structure includes a first dielectric layer, a first conductive feature in the first dielectric layer, a first etch stop layer (ESL) disposed over the first dielectric layer and the first conductive feature, a dielectric feature disposed in the first ESL, an electrode disposed over the dielectric feature, and a second ESL disposed on the first ESL and the electrode.
A semiconductor device structure, along with methods of forming such, are described. In one embodiment, a semiconductor device structure is provided. The semiconductor device structure includes a substrate having a front side and a back side opposing the front side, a gate stack disposed on the front side of the substrate, and a first source/drain feature and a second source/drain feature disposed in opposing sides of the gate stack. Each first source/drain feature and second source/drain feature comprises a first side and a second side, and a portion of the back side of the substrate is exposed to an air gap.
A method of forming a semiconductor device includes forming a first semiconductor strip protruding above a first region of a substrate and a second semiconductor strip protruding above a second region of the substrate, forming an isolation region between the first semiconductor strip and the second semiconductor strip, forming a gate stack over and along sidewalls of the first semiconductor strip and the second semiconductor strip, etching a trench extending into the gate stack and isolation regions, the trench exposing the first region of the substrate and the second region of the substrate, forming a dielectric layer on sidewalls and a bottom surface of the trench and filling a conductive material over the dielectric layer and in the trench to form a contact, where the contact extends below a bottommost surface of the isolation region.
A semiconductor device includes a substrate; a guard ring disposed on the substrate and adjacent to an edge of the substrate; an integrated circuit structure surrounded by the guard ring and disposed on the substrate; and an insulating material structure disposed on a side surface of the guard ring, and wherein the guard ring includes a plurality of guard active structures on the substrate, a plurality of guard contact structures disposed on each of the plurality of guard active structures, and a guard interconnection structure disposed on a pair of guard contact structures adjacent to each other, among the plurality of guard contact structures, wherein each of the plurality of guard active structures includes a plurality of guard active fins spaced apart from each other.
The present disclosure relates to a semiconductor device and a manufacturing method, and more particularly to a MIM dual capacitor structure with an increased capacitance per unit area in a semiconductor structure. Without using additional mask layers, a second parallel plate capacitor can be formed over a first parallel plate capacitor, and both capacitors share a common capacitor plate. The two parallel plate capacitors can be connected in parallel to increase the capacitance per unit area.
A scan needle includes a substrate, a first color light emitting pixel array comprising a plurality of first color light emitting pixels formed on the substrate, a second color light emitting pixel array comprising a plurality of second color light emitting pixels formed on the substrate, and a third color light emitting pixel array comprising a plurality of third color light emitting pixels formed on the substrate.
Disclosed are a light emitting diode and a method for manufacturing a light emitting diode. The light emitting diode includes a first-type layer, a light emitting layer, a second-type layer and an electrode layer; the first-type layer includes a first-type gallium nitride; the light emitting layer is located on the first-type layer; the light emitting layer includes a quantum point; the second-type layer is located on the light emitting layer; the second-type layer includes a second-type gallium nitride; and the electrode layer is located on the second-type layer.
Provided is a photoelectric conversion device including: a photoelectric conversion unit including one microlens and a plurality of photoelectric conversion elements, a readout circuit unit configured to read out a first signal based on charges accumulated by a first photoelectric conversion element of the plurality of photoelectric conversion elements and a second signal based on charges accumulated by a second photoelectric conversion element of the plurality of photoelectric conversion elements, and a signal processing unit configured to, according to a determination result based on at least one of the first signal and the second signal, output a third signal obtained by adding the first signal and the second signal or output a fourth signal by replacing the third signal with the fourth signal different from the third signal.
Imaging device comprising: a substrate; a pinned photodiode formed on the substrate, wherein the pinned photodiode generates charge that is representative of incident radiation, wherein the imaging device further comprises: circuitry defining a first path for measuring charge and configured to non-destructively produce a signal representative of the charge generated in the pinned photodiode; circuitry defining a subsequent second path for measuring charge and configured to produce a signal representative of the charge generated in the pinned photodiode, and wherein the first and second paths have different conversion gain.
According to an aspect, an image sensor package includes a substrate, an image sensor die coupled to the substrate, and a transparent member including a first surface and a second surface, where the second surface of the transparent member is coupled to the image sensor die via one or more dam members such that an empty space exists between an active area of the image sensor die and the second surface of the transparent member. The image sensor package includes a light blocking member coupled to or defined by the transparent member.
An imaging device with reduced power consumption is provided.
The imaging device includes an imaging portion and an encoder. First image data obtained by the imaging portion is transmitted to the encoder. The encoder includes a first circuit that forms a neural network, and the first circuit conducts feature extraction by the neural network on a first image to generate second image data. Note that since the first circuit has a function of performing convolution processing using a weight filter, the encoder can perform computation with a convolutional neural network.
Semiconductor structures and methods are provided. A method according to the present disclosure includes providing a workpiece that includes a plurality of active regions including channel regions and source/drain regions, and a plurality of dummy gate stacks intersecting the plurality of active regions at the channel regions, the plurality of dummy gate stacks including a device portion and a terminal end portion. The method further includes depositing a gate spacer layer over the workpiece, anisotropically etching the workpiece to recess the source/drain regions and to form a gate spacer from the gate spacer layer, forming a patterned photoresist layer over the workpiece to expose the device portion and the recessed source/drain regions while the terminal end portion is covered, and after the forming of the patterned photoresist layer, epitaxially forming source/drain features over the recessed source/drain regions.
Gate-all-around integrated circuit structures having adjacent island structures are described. For example, an integrated circuit structure includes a semiconductor island on a semiconductor substrate. A first vertical arrangement of horizontal nanowires is above a first fin protruding from the semiconductor substrate. A channel region of the first vertical arrangement of horizontal nanowires is electrically isolated from the fin. A second vertical arrangement of horizontal nanowires is above a second fin protruding from the semiconductor substrate. A channel region of the second vertical arrangement of horizontal nanowires is electrically isolated from the second fin. The semiconductor island is between the first vertical arrangement of horizontal nanowires and the second vertical arrangement of horizontal nanowires.
A reverse conducting insulated gate power semiconductor device is provided which comprises a plurality of active unit cells (40) and a pilot diode unit cell (50) comprising a second conductivity type anode region (51) in direct contact with a first main electrode (21) and extending from a first main side (11) to a first depth (d1). Each active unit cell (40) comprises a first conductivity type first source layer (41a) in direct contact with the first main electrode (21), a second conductivity type base layer (42) and a first gate electrode (47a), which is separated from the first source layer (41a) and the second conductivity type base layer (42) by a first gate insulating layer (46a) to form a first field effect transistor structure. A lateral size (w) of the anode region (51) in an orthogonal projection onto a vertical plane perpendicular to the first main side (11) is equal to or less than 1 μm. On a first lateral side surface of the anode region (51) a first insulating layer (52a) is arranged and on an opposing second lateral side surface of the anode region (51) a second insulating layer (52b) is arranged. And a distance between the first insulating layer (52a) and the second insulating layer (52b) is equal to or less than 1 μm, the first insulating layer (52a) extending vertically from the first main side (11) to a second depth (d2), and the second insulating layer (52b) extending vertically from the first main side (11) to a third depth (d3), wherein the first depth (d1) is less than the second depth (d2) and less than the third depth (d3).
The semiconductor device according to the present application includes: a hole injection region including a hole injection layer and a semiconductor layer of a second conductivity type; a diode region including an anode layer of a second conductivity type and a cathode layer of a first conductivity type; a boundary portion semiconductor layer of a second conductivity type provided between the diode region and the hole injection region and provided on a first main surface side; a carrier injection suppression layer of a first conductivity type provided in a surface layer of the boundary portion semiconductor layer; and a semiconductor layer of a second conductivity type provided to protrude from the hole injection region on a second main surface side.
Embodiments of the disclosure provide an integrated circuit (IC) structure, including a triple well structure within a semiconductor substrate. A base region is within a doped well of the triple well structure, a collector terminal is within the doped well and laterally separated from the base region by a first insulator and a first avalanche junction is defined between a first pair of oppositely-doped semiconductor regions within the collector terminal. An emitter terminal is within the third doped well of the triple well structure and laterally separated from the collector terminal by a second insulator. A second avalanche junction is defined between a second pair of oppositely-doped semiconductor regions of the emitter terminal.
In an embodiment a component includes a semiconductor chip, a connection member and a carrier, wherein the semiconductor chip is mechanically and electrically connected to the carrier via the connection member, wherein the connection member includes a contiguous metallic connecting layer and a plurality of metallic through-vias extending vertically through the connecting layer and being laterally spaced from the connecting layer by insulating regions, wherein the insulating regions are filled with a gaseous medium and are hermetically sealed, and wherein the gaseous medium contains an insulating gas having a higher breakdown field strength compared to nitrogen, or wherein a gas pressure is less than 1 mbar in the hermetically sealed insulating regions.
A method for wafer bonding includes: providing a semiconductor wafer having a first main face; fabricating at least one semiconductor device in the semiconductor wafer, wherein the semiconductor device is arranged at the first main face; generating trenches and a cavity in the semiconductor wafer such that the at least one semiconductor device is connected to the rest of the semiconductor wafer by no more than at least one connecting pillar; arranging the semiconductor wafer on a carrier wafer such that the first main face faces the carrier wafer; attaching the at least one semiconductor device to the carrier wafer; and removing the at least one semiconductor device from the semiconductor wafer by breaking the at least one connecting pillar.
A 3D IC structure includes multiple dies, such as a top die and a bottom die. The top die and/or the bottom die can each include devices such as computing units, Analog-to-Digital converters, analog circuits, RF circuits, logic circuits, sensors, Input/Output devices, and/or memory devices. One or more vertical interconnect structure (VIS) cells are formed adjacent one or more sides of the device. A VIS is formed in some or all of the VIS cells. One or more non-sensitive circuits, such as repeaters, diodes, and/or passive circuits (e.g., resistors, inductors, capacitors, transformers), are disposed in at least one VIS cell.
A die bonding apparatus includes: a driven body; and a table for driving the driven body. The table includes: a base; a linear motor having a first mover that moves the driven body, and a stator; a first linear motion guide that is provided between the base and the stator and capable of freely moving the stator; a second linear motion guide that is provided between the base and the first mover and capable of freely moving the first mover; a second mover provided in the form of being fixed to the base; and a control device for controlling the first mover and the second mover. The control device is configured to move the stator along the first linear motion guide using the second mover.
A microelectronic device comprises a first die and a second die attached to the first die. The first die comprises a memory array region comprising a stack structure comprising vertically alternating conductive structures and insulative structures, vertically extending strings of memory cells within the stack structure, and first bond pad structures vertically neighboring the vertically extending strings of memory cells. The second die comprises a control logic region comprising control logic devices configured to effectuate at least a portion of control operations for the vertically extending string of memory cells, second bond pad structures in electrical communication with the first bond pad structures, and signal routing structures located at an interface between the first die and the second die. Related microelectronic devices, electronic systems, and methods are also described.
A semiconductor package includes a redistribution substrate, and a semiconductor chip disposed on a top surface of the redistribution substrate. The redistribution substrate includes under bump patterns laterally spaced apart from each other, a dummy pattern disposed between the under bump patterns, a passivation pattern disposed on a bottom surface of the dummy pattern, an insulating layer covering top surfaces and sidewalls of the under bump patterns and a sidewall and a top surface of the dummy pattern, and a redistribution pattern disposed on one of the under bump patterns and electrically connected to the one under bump pattern. The passivation pattern includes a different material from that of the insulating layer.
A semiconductor device includes first conductive films that are provided, above a semiconductor substrate, at least on both sides of a non-formation region in which the first conductive films are not provided; an interlayer dielectric film including a first portion that is provided on the non-formation region, second portions provided above the first conductive film on both sides of the non-formation region, and a step portion that connects the first portion and the second portions; a second conductive film provided above the interlayer dielectric film; through terminal portions that penetrate the second portions of the interlayer dielectric film; and a wire bonded with the second conductive film above the first portion, where the through terminal portions include one or more first through terminal portions and one or more second through terminal portions being provided at positions opposite to each other with a bonded portion of the wire being interposed therebetween.
A semiconductor package includes: a first die; a second die stacked on an upper surface of the first die, the second die including a second semiconductor substrate and a second seal ring structure that extends along a perimeter of the second semiconductor substrate; a third die stacked on the upper surface of the first die, the third die including a third semiconductor substrate and a third seal ring structure that extends along a perimeter of the third semiconductor substrate; and a connection circuit that extends through the second seal ring structure and the third seal ring structure, in a lateral direction perpendicular to the stacking direction of the first die and the second die, to electrically connect the second semiconductor substrate and the third semiconductor substrate.
One or more embodiments of techniques or systems for forming a semiconductor structure are provided herein. A first metal region is formed within a first dielectric region. A cap region is formed on the first metal region. A second dielectric region is formed above the cap region and the first dielectric region. A trench opening is formed within the second dielectric region. A via opening is formed through the second dielectric region, the cap region, and within some of the first metal region by over etching. A barrier region is formed within the trench opening and the via opening. A via plug is formed within the via opening and a second metal region is formed within the trench opening. The via plug electrically connects the first metal region to the second metal region and has a tapered profile.
Semiconductor device A1 includes: semiconductor element 1 turning on and off connection between drain electrode 11 and source electrode 12; semiconductor element 2 turning on and off connection between drain electrode 21 and source electrode 22; metal component 31 with semiconductor element 1 mounted; metal component 32 with semiconductor element 2 mounted; and conductive substrate 4 including wiring layers 411, 412 with insulating layer 421 between them. Wiring layer 411 includes power terminal section 401 connected to drain electrode 11. Wiring layer 412 includes power terminal section 402 connected to source electrode 22. Power terminal sections 401, 402 and insulating layer 421 overlap with each other as viewed in z direction. Conductive substrate 4 surrounds semiconductor elements 1, 2 as viewed in z direction, while overlapping with a portion between metal components 31, 32 as viewed in z direction.
Provided are an adapter board and a method for forming the same, a packaging method, and a package structure. One form of a method for forming an adapter board includes: providing a base, including an interconnect region and a capacitor region, the base including a front surface and a rear surface that are opposite each other; etching the front surface of the base, to form a first trench in the base of the interconnect region and form a second trench in the base of the capacitor region; forming a capacitor in the second trench; etching a partial thickness of the base under the first trench, to form a conductive via; forming a via interconnect structure in the conductive via; and thinning the rear surface of the base, to expose the via interconnect structure.
Semiconductor packages are described which increase the density of electronic components within. The semiconductor package may incorporate interposers with cavities formed into the top and/or bottom. The cavities may then be used as locations for the electronic components. Alternatively, narrow spacer interposers may be used to space apart standard more laterally elongated interposers to form the indentations used to house the electronic components. The semiconductor package designs described herein may be used to reduce footprint, reduce profile and increase electronic component and transistor density for semiconductor products.
A semiconductor device includes a first die pad, a second die pad, a first semiconductor element, a second semiconductor element, an insulating element, first terminals, second terminals, and a sealing resin. The sealing resin has a first side surface located on one side of a first direction, a second side surface located on the other side of the first direction, and third and fourth side surfaces that are separated from each other in a second direction orthogonal to both a thickness direction and the first direction and are connected to the first and second side surfaces. A first gate mark having a surface roughness larger than the other regions of the third side surface is formed on the third side surface. When viewed along the second direction, the first gate mark overlaps a pad gap provided between the first die pad and the second die pad in the first direction.
A leadless semiconductor package includes a conductive base having a plurality of apertures formed around a perimeter of the conductive base and extending from a first surface to an opposing second surface of the conductive base. The semiconductor package further includes an IC die having a third surface facing the first surface of the conductive base and having a plurality of conductive pillars disposed thereon. Each conductive pillar extends from the third surface to the first surface via a corresponding aperture. A dielectric fill material is disposed in the apertures and insulates the conductive pillars from the conductive material of the conductive base. An opening of an aperture at the second surface, the bottom end of the conductive pillar disposed therein, and the dielectric fill material at the opening of the aperture at the second surface together form a surface mount pad for mounting the semiconductor package to a corresponding pad of a circuit board.
A device is provided that includes a heat conductive structure; a heat transfer structure for extracting heat from the heat conductive structure by means of a boundary layer; a motor for rotating the heat transfer structure relative to the heat conductive structure; and a vertical fixing mechanism for allowing the heat transfer structure to rotate above the heat transfer structure without making contact with the heat transfer structure so as to define a boundary layer between the heat conductive structure and heat transfer structure, wherein the heat transfer structure extracts heat from the heat conductive structure by means of the boundary layer, and wherein the heat conductive structure includes small geometric turbulators.
Techniques and mechanisms for facilitating heat conductivity in a packaged device with a dummy die. In an embodiment, a packaged device comprises a substrate and one or more IC die coupled to a surface thereof. A dummy die, adjacent to an IC die and coupled to a region of the substrate, comprises a polymer resin and a filler. A package mold structure of the packaged device adjoins respective sides of the IC die and the dummy die, and adjoins the surface of the substrate. In another embodiment, a first CTE of the dummy die is less than a second CTE of the package mold structure, and a first thermal conductivity of the dummy die is greater than a second thermal conductivity of the package mold structure.
Described examples include a process that includes forming a diffusion barrier layer on a backside of a semiconductor wafer. The process also includes forming a seed copper layer on the diffusion barrier layer. The process also includes forming a copper layer on the seed copper layer. The process also includes immersion plating a silver layer on the copper layer.
An interface interconnect structure is provided for efficient heat dissipation of a power electronic device. The structure includes a first low temperature solder layer and a second low temperature solder layer, a metal-foam metal composite material is placed between the first low temperature solder layer and the second low temperature solder layer. The metal-foam metal composite material has designability in structure and performance. The thermal conductivity and coefficient of thermal expansion (CTE) of the thermal interface interconnect structure can be configured according to the selected encapsulating materials for a power electronic device, thereby achieving bisynchronous improvement in the heat dissipation efficiency and the CTE matching degree between the encapsulating materials. A remelting temperature of the interface interconnect structure is greater than melting points of the first low temperature solder layer and the second low temperature solder layer, achieving “low temperature soldering and high temperature service.”
A semiconductor device includes a semiconductor module, an insulating resin layer, a frame member, and a heat sink. Insulating resin layer is bonded to semiconductor module and contains a first resin. Frame member is disposed to surround insulating resin layer, and includes a porous material. Heat sink and semiconductor module sandwich insulating resin layer and frame member. Frame member is compressed while being sandwiched between semiconductor module and heat sink. Insulating resin layer is filled in a region surrounded by semiconductor module, heat sink, and frame member. The first resin enters pores of the porous material.
A method for manufacturing a semiconductor device structure including a doped region under an isolation feature. The method includes providing a substrate having a first surface and a second surface opposite to the first surface, wherein the substrate comprises a first well region with a first conductive type; forming an isolation feature extending from the second surface of the substrate; forming a first transistor and a second transistor adjacent to the second surface of the substrate; forming a first doped region under the isolation feature, wherein the first doped region has a second conductive type different from the first conductive type; and providing a circuit structure on the first surface of the substrate, wherein the circuit structure is configured to transmit or provide a voltage electrically coupled with the first doped region.
The current disclosure provides a semiconductor fabrication method that defines the height of gate structures at the formation of the gate structure. A gate line-end region is formed by removing a portion of a gate structure. A resulted recess is filled with a dielectric material is chosen to have a material property suitable for a later contact formation process of forming a metal contact. A metal contact structure is formed through the recess filling dielectric layer to connect to a gate structure and/or a source/drain region.
The present disclosure provides methods for forming conductive features in a dielectric layer without using adhesion layers or barrier layers and devices formed thereby. In some embodiments, a structure comprising a dielectric layer over a substrate, and a conductive feature disposed through the dielectric layer. The dielectric layer has a lower surface near the substrate and a top surface distal from the substrate. The conductive feature is in direct contact with the dielectric layer, and the dielectric layer comprises an implant species. A concentration of the implant species in the dielectric layer has a peak concentration proximate the top surface of the dielectric layer, and the concentration of the implant species decreases from the peak concentration in a direction towards the lower surface of the dielectric layer.
A method of forming an integrated circuit structure includes forming an etch stop layer over a conductive feature, forming a dielectric layer over the etch stop layer, forming an opening in the dielectric layer to reveal the etch stop layer, and etching the etch stop layer through the opening using an etchant comprising an inhibitor. An inhibitor film comprising the inhibitor is formed on the conductive feature. The method further includes depositing a conductive barrier layer extending into the opening, performing a treatment to remove the inhibitor film after the conductive barrier layer is deposited, and depositing a conductive material to fill a remaining portion of the opening.
An article transfer system includes a plurality of stage modules respectively provided at a plurality of layers, an interlayer transfer apparatus configured to transfer an article to each of the plurality of stage modules, and a plurality of loading and unloading apparatus respectively provided on each stage module of the plurality of stage modules, the plurality of loading and unloading apparatus configured to load an article onto respective stage modules of the plurality of stage modules. The interlayer transfer apparatus includes a mast frame extending so as to intersect each stage module of the plurality of stage modules, and a plurality of carriage units configured to move along a length direction of the mast frame, transfer articles, and move in a parallel manner with each other.
Gaskets for wafer containers include a seal body and a retention projection. The retention projection includes a retention segment extending from the seal body, a compression relief segment extending from the retention segment, and a bead disposed at an end of the compression relief segment. The compression relief segment has a cross-sectional width less than a cross-sectional width of the retention segment. The bead has a shape including portion having a width greater than a cross-sectional width of the gland at a corresponding depth in the gland. The gasket can be provided in a wafer container or a door of the wafer container.
In one embodiment a power semiconductor module includes a substrate having a first substrate side for carrying an electric circuit and having a second substrate side being located opposite to the first substrate side. The second substrate side has a flat surface and is adapted for coming in contact with a cooler. A cooling area that is surrounded by a connecting area is located at the second substrate side. A first casing component of the cooler is connected to the second substrate side at the connecting area and a second casing component is connected to the first casing component such that a cooling channel for providing the cooling area with cooling fluid is provided between the first casing component and the second casing component. A cooling structure can be welded to the cooling area at the second substrate side.
A package structure and the manufacturing method thereof are provided. The package structure includes a semiconductor die, conductive through vias, an insulating encapsulant, and a redistribution structure. The conductive through vias are electrically coupled to the semiconductor die. The insulating encapsulant laterally encapsulates the semiconductor die and the conductive through vias, wherein the insulating encapsulant has a recess ring surrounding the semiconductor die, the conductive through vias are located under the recess ring, and a vertical projection of each of the conductive through vias overlaps with a vertical projection of the recess ring. The redistribution structure is electrically connected to the semiconductor die and the conductive through vias.
A method for etching an oxide semiconductor film includes: providing a substrate including a mask of a silicon-containing film on an oxide semiconductor film containing at least indium (In), gallium (Ga), and zinc (Zn); supplying a processing gas containing a bromine (Br)-containing gas or an iodine (I)-containing gas; and etching the oxide semiconductor film by plasma generated from the processing gas.
There is provided a method for manufacturing a semiconductor device, including: attracting a semiconductor device wafer by a chuck mechanism and rotating the semiconductor device wafer horizontally; rotating a rotary blade horizontally by a vertical spindle to which ultrasonic waves are applied; trimming an outer peripheral end portion of the semiconductor device wafer that is horizontally rotating by the rotary blade that is horizontally rotating, to form a groove in the outer peripheral end portion; correcting a tip shape of the rotary blade that is horizontally rotating by a blade-forming grinding wheel during the trimming; and grinding one main surface of the semiconductor device wafer that is horizontally rotating by a cup grinding wheel that is horizontally rotating after the trimming.
A method of manufacturing a semiconductor device includes forming a first lower overlay key including first and second patterns in a lower layer, forming a first upper overlay key including third and fourth patterns in an upper layer vertically disposed on the lower layer, irradiating a first measurement light to a first region of interest (ROI) over first portions of the first and second patterns to detect a first overlay error and irradiating a second measurement light to a second ROI over second portions of the first and second patterns, the second ROI being different from the first ROI, to detect a second overlay error.
The invention provides an analytic nebuliser device for delivering a sample in aerosolised form, the device comprising a nebuliser nozzle configured to receive a flow of said sample and generate a plume of aerosolised sample spray and a chamber configured to receive a flow of make-up gas and connecting with a plurality of microchannels having outlets arranged around and adjacent to said nebuliser nozzle wherein the microchannels are configured to produce a make-up gas stream with high linear velocity around said aerosolised sample spray to shape and direct said plume. The invention extends to a mass spectrometry or spectroscopy system including the above analytic nebuliser device, to provide in operation the aerosolised sample spray to an ionisation device of the system.
A semiconductor manufacturing apparatus includes a heating part, a first electrode, a first insulating part, a gas supply part, a second electrode, and a second insulating part. The heating part is arranged to be in one surface side of a substrate. The first electrode is arranged around the heating part. The gas supply part is arranged to be in another surface side of the substrate. The second electrode is arranged around the gas supply part. The first electrode and the second electrode are arranged to overlap with an outer edge portion of the substrate, which is a region existing from an outer peripheral end of the substrate to a position inside by a predetermined length, in a direction in which the first electrode and the second electrode face each other. The first electrode is arranged to be in contact with part of the outer edge portion on the one surface side.
A component for use in a substrate process chamber includes: a body having an opening extending partially through the body from a top surface of the body, wherein the opening includes a threaded portion for fastening the body to a second process chamber component, wherein the threaded portion includes a plurality of threads defining a plurality of rounded crests and a plurality of rounded roots, and wherein a depth of the threaded portion, being a radial distance between a rounded crest of the plurality of rounded crests and an adjacent root of the plurality of rounded roots, decreases from a first depth to a second depth at a last thread of the plurality of threads.
Systems and methods for multi-level pulsing of a parameter and multi-level pulsing of a frequency of a radio frequency (RF) signal are described. The parameter is pulsed from a low level to a high level while the frequency is pulsed from a low level to a high level. The parameter and the frequency are simultaneously pulsed to increase a rate of processing a wafer, to increase mask selectivity, and to reduce angular spread of ions within a plasma chamber.
An object of the invention is to acquire a high-quality image while maintaining an improvement in throughput of image acquisition (measurement (length measurement)). The present disclosure provides a charged particle beam system including a charged particle beam device and a computer system configured to control the charged particle beam device. The charged particle beam device includes an objective lens, a sample stage, and a backscattered electron detector that is disposed between the objective lens and the sample stage and that adjusts a focus of a charged particle beam with which a sample is irradiated. The computer system adjusts a value of an electric field on the sample in accordance with a change in a voltage applied to the backscattered electron detector.
An electrochemical device electrode includes a conductive polymer as an active material. The conductive polymer has a grain shape, and an intensity distribution pattern obtained by X-ray diffraction measurement with respect to the conductive polymer has a first peak in which a diffraction angle 2θ ranges from 18° to 21°, inclusive, and a second peak in which a diffraction angle 2θ ranges from 24° to 26°, inclusive.
An apparatus comprising a signal transformer coupled to a power line and a signal transmission, reception, or detection circuit. A sensor is configured to be responsive to the power line current or magnetic flux generated in a ferrite core of the signal transformer. When the sensor indicates that the flux generated by the power line current mat cause an attenuation of the signal strength, a second circuit generates a current through a flux cancelling winding that cancels at least some of the flux generated by the power line current.
Provided is a power cable and a method for manufacturing a power cable that reduces occurrence of uneven thickness of an insulating layer and voids and peeling due to shrinkage and has good dielectric breakdown strength. The power cable includes the insulating layer containing 15 mass % or more of a propylene-based resin having a melting point of 110° C. or higher with respect to a whole. The power cable further includes a relationship between a cooling rate X [° C./min] at the time of manufacturing an interface portion in the insulating layer with the inner semiconductive layer and a cooling rate Y [° C./min] at the time of manufacturing a central portion of the insulating layer and is expressed by the relationship (Z), wherein X≥Y×0.8 . . . (Z).
The present disclosure provides polymeric compositions with balanced electrical and mechanical properties exhibiting reduced hysteresis comprising an electrically insulating polymeric material, a first carbon black material having a statistical thickness surface area (STSA) of below 70 m2/g and an oil absorption number (OAN) in the range from 70 to 150 mL/100 g, and a second carbon black material having a statistical thickness surface area (STSA) of at least 100 m2/g and an oil absorption number (OAN) of at least 150 mL/100 g, wherein both carbon black materials are included in an amount below its respective percolation threshold concentration, with the total amount of the first carbon black material and the second carbon black material being sufficient to render the polymeric composition antistatic or electrically conductive. The polymeric compositions exhibit balanced electrical and mechanical properties and a reduced hysteresis. The disclosure also relates to a process for preparing such antistatic or electrically conductive polymeric compositions and articles produced from such compositions.
A system and a method for management, prediction, and warning of an asthma condition of an asthma patient is provided which employ a wearable, air-quality device for collecting environmental air quality data relating to the asthma condition in the patient's ambient air, an asthma management application installed on a mobile device of the asthma patient or of a care provider of the asthma patient for collecting daily asthma symptom data for the asthma patient, and a cloud processing platform for analyzing the environmental and symptom data and preparing a next day risk report accessible via the asthma management application.
A system and method for preserving block experiencing wordline failure in memory devices. An example method includes performing, by a processor, a write operation to program data to a set of memory cells addressable by a first wordline of a plurality of wordlines of a block of a memory device; determining that a program fault occurred during the write operation; determining a number of wordlines referenced by a program fault data structure that are associated with the block; and responsive to determining that the number of wordlines fails to satisfy a threshold criterion, releasing a second wordline of the plurality of wordlines to be available for write operations.
Various embodiments of the present application are directed towards an integrated memory chip with an enhanced device-region layout for reduced leakage current and an enlarged word-line etch process window (e.g., enhanced word-line etch resiliency). In some embodiments, the integrated memory chip comprises a substrate, a control gate, a word line, and an isolation structure. The substrate comprises a first source/drain region. The control gate and the word line are on the substrate. The word line is between and borders the first source/drain region and the control gate and is elongated along a length of the word line. The isolation structure extends into the substrate and has a first isolation-structure sidewall. The first isolation-structure sidewall extends laterally along the length of the word line and underlies the word line.
A resistive random-access memory (ReRAM) array with parallel reset and set programming and a method for programming is presented. The ReRAM array includes a plurality of ReRAM cells arranged in an array, wherein the array includes a plurality of rows and a plurality of columns, wherein at least two ReRAM cells of an array includes a word, wherein each ReRAM cell includes a select device having a control port, a first port, and a second port, and a resistive element; and a plurality of controllers, wherein the output of each of the plurality of controllers cause a reset programming or a set programming of the ReRAM cell in the column of the plurality of ReRAM cells that has the respective word line activated; such that the reset programming and the set programming occur in parallel.
A static random access memory (SRAM) has one or more arrays of memory cells, each array of memory cells activated in columns by a wordline. The activated column of memory cells asserts output data onto a plurality of bitlines coupled to output drivers. The SRAM includes a wordline controller generating a variable pulse width wordline which may be reduced sufficient to introduce memory read errors. Each of a high error rate, medium error rate, low error rate, and error-free rate is associated with a pulse width value generated by the wordline controller. A power consumption tradeoff exists between the wordline pulse width and consumed SRAM power. The wordline controller is thereby able to associate a wordline pulse width to an associated error rate for performing tasks which are insensitive to a high error rate or a medium error rate, which are specific to certain neural network training and inference using various NN data types.
Various embodiments provide an apparatus, a method, and a computer program product. The apparatus includes at least one processor; and at least one non-transitory memory including computer program code; wherein the at least one memory and the computer program code are configured to, with the at least one processor, cause the apparatus at least to perform: define or utilize file format syntax elements to indicate samples comprising at least one of: one or more description documents, wherein the one or more description documents comprise 3 dimensional information; or one or more updates to at least one description document of the one or more description documents; and define or utilize the file format syntax elements to indicate a relationship between samples containing the one or more description document and update information to the samples.
In an audio signal processing method and system for echo suppression, selection of a target audio processing mode is controlled based on strength of a speaker signal. In the method and system, a control signal is generated based on the strength of the speaker signal, and the target audio processing mode is controlled based on the control signal to perform signal processing on a microphone signal so as to obtain better voice quality. When the speaker signal does not exceed a threshold, the system selects a first mode, and performs signal processing on a first audio signal and a second audio signal to obtain a first target audio; or when the speaker signal exceeds a threshold, the system selects a second mode, and performs signal processing on a second audio signal to obtain a second target audio, and the mode can be switched based on the speaker signal.
The present disclosure discloses an inter-channel phase difference parameter encoding method, where a current frame is obtained; a signal type and a previous IPD parameter encoding scheme of a previous frame are obtained; a current IPD parameter encoding scheme is obtained at least based on the signal type of the previous frame and the previous IPD parameter encoding scheme; and an IPD parameter of the current frame is processed based on the current IPD parameter encoding scheme.
Systems and processes for providing a virtual assistant service are provided. In accordance with one or more examples, a method includes receiving, from an accessory device communicatively coupled to the first electronic device, a representation of a speech input representing a user request. The method further includes detecting a second electronic device and transmitting, from the first electronic device, a representation of the user request and data associated with the detected second electronic device to a third electronic device. The method further includes receiving, from the third electronic device, a determination of whether a task is to be performed by the second electronic device in accordance with the user request; and in accordance with a determination that a task is to be performed by the second electronic device, requesting the second electronic device to performed the task in accordance with the user request.
The disclosure deals with a system and method for improved general task-oriented virtual assistants (VAs). The presently disclosed framework incorporates discovery of knowledge from online sources to accomplish tasks (open world), user-specific knowledge for personalization, and domain-specific knowledge for context adaptation to recommend and assist the users over procedural tasks such as cooking and Do-it-Yourself (DIY) tasks. The approach also focuses on content curation for fault-tolerant execution to ensure the end goal is reached despite common failures.
Technologies are disclosed for interacting with a virtual assistant to coordinate, recommend and perform actions. According to some examples, a user may use their voice to interact with a virtual assistant to receive recommendations relating to determining when to perform one or more actions. For example, a user may interact with a virtual assistant to request a recommendation as to when they should leave for the office, leave the office for the day, perform a task, and the like. The recommendation system accesses selected data sources (e.g., calendars, task lists, traffic, transportation schedules, maps, . . . ) to obtain data used in generating the recommendation. In addition, to providing a recommended time, the virtual assistant may also recommend actions to perform. The virtual assistant may also provide notifications to one or more other users that includes information relating to the user leaving.
A method including transcribing, into digital tokens, utterances from a conversation between an agent and a person. The method also includes embedding the digital tokens into an utterances tensor including sequences of the digital tokens. The method also includes obtaining a metadata tensor by encoding metadata related to the utterances into the metadata tensor. The method also includes executing a machine learning model which takes, as input, the utterances tensor and the metadata tensor, and which outputs a predicted source article predicted to be related to the utterances. The method also includes generating an interactive link to the predicted source article.
Methods, systems, and apparatuses for predicting an end of a command in a voice recognition input are described herein. The system may receive data comprising a voice input. The system may receive a signal comprising a voice input. The system may detect, in the voice input, data that is associated with a first portion of a command. The system may predict, based on the first portion and while the voice input is being received, a second portion of the command. The prediction may be generated by a machine learning algorithm that is trained based at least in part on historical data comprising user input data. The system may cause execution of the command, based on the first portion and the predicted second portion, prior to an end of the voice input.
In some implementations, a system may receive an audio stream associated with a call between a user and an agent. The system may process, by the device and using a speech alteration model, speech from a first channel of the audio stream to alter the speech from having a first speech characteristic to having a second speech characteristic, wherein the speech alteration model is trained based on reference audio data associated with the first speech characteristic and the second speech characteristic and based on reference speech data associated with the first speech characteristic and the second speech characteristic. The system may extract the speech from the first channel that has the first speech characteristic. The system may provide, within a second channel of the audio stream, altered speech that corresponds to the speech and that has the first speech characteristic.