US10514632B2
A method of remanufacturing a toner cartridge includes installing a modified end cap in which a portion of a drive assembly for an internal toner seal removal mechanism has been disabled. With the modified end cap installed, the toner cartridge may be post tested without removing the internal toner seal. When the post test is complete the modified end cap is removed and a non-modified end cap with a functional drive assembly is installed in its place.
US10514621B2
An electrophotographic photoreceptor includes a conductive substrate; a photosensitive layer provided on the conductive substrate; and an undercoating layer that is provided between the conductive substrate and the photosensitive layer and includes a charge transport material containing at least one of imide compounds represented by Formula (1) or (2): (in Formulas (1) and (2), R10, R11, R20, or R21 independently represents a group represented by Formula (3) or (4) where X represents a monovalent organic group having at least one of an alkyl group, an alkylene group, an ether group, an ester group, and a keto group, a halogen atom, a nitro group, an aralkyl group, or an aryl group, Y represents a sulfur atom or an oxygen atom, n represents an integer of 0 to 2, and when n represents 2, two X's may be the same or different), and an imide compound is represented by Formula (1A) where Ar represents an aromatic group having 6 to 18 carbon atoms except for a tetravalent perylene group, X1 and X2 each independently represent a nitrogen atom or a substituted or unsubstituted carbon atom, Y1 and Y2 each independently represent an oxygen atom, a sulfur atom, a selenium atom, or NH, and R1 and R2 each independently represent a hydrogen atom or a monovalent organic group:
US10514609B2
A lithographic apparatus (10) and method for preventing exposure of a peripheral portion (P) of a substrate (S). An edge mask (M) has a radial concave edge (E) that extends over less than half a circle arch. The edge mask (M) is connected to a mask carrier (4) that circumnavigates the projection system (2) to adjust a tangential coordinate (Φ) and a radial coordinate (R) of the edge mask (M) with respect to the optical axis (A) of the projection system (2) for inserting the edge mask (M) at a variable distance into the beam of radiation (B). The tangential and radial positions (Φ,R) of the edge mask (M) are coordinated with a changing position (X,Y) of the substrate (S) to prevent exposure of the peripheral portion (P) of the substrate (S) during exposure of the target region (T).
US10514600B2
A resist composition which generates acid upon exposure and exhibits changed solubility in a developing solution under action of acid, the resist composition including a base component which exhibits changed solubility in a developing solution under action of acid, and a compound represented by general formula (d1) in which Rd01 and Rd02 each independently represents a cyclic group which may have a substituent, a chain alkyl group which may have a substituent or a chain alkenyl group which may have a substituent; or Rd01 and Rd02 may be mutually bonded to form a condensed ring; m represents an integer of 1 or more; and Mm+ represents an organic cation having a valency of m.
US10514596B2
An optical device includes a first plate having a first transparent region defining an exit face of the device, and a second plate having a second transparent region defining an entrance face of the device. At least one lens is formed over at least one of the first and second transparent regions. First and second planar reflectors are spaced apart and fixed between the first and second plates in mutually-parallel orientations diagonal to the first and second plates, thereby defining an optical path through the device from the entrance face, reflecting from the first and second reflectors, through the exit face and passing through the at least one refractive surface.
US10514591B2
A camera apparatus (10) includes a degraded region information storage unit (24) that stores degraded region information for each direction in which degraded region data and an imaging direction are associated with each other, a direction recognition unit (30) that recognizes the imaging direction, and an image correction unit (32) that acquires degraded region data which is associated with the imaging direction recognized by the direction recognition unit (30) on the basis of the degraded region information for each direction and performs an image quality improvement process for the image data on the basis of a peculiar degraded region indicated by the degraded region data. The peculiar degraded region is a region related to a degradation element which is caused by at least one of the dome cover or the optical system and is based on at least one of a spatial frequency or signal intensity.
US10514585B2
An apparatus for probing an interface via second harmonic generation (SHG) spectroscopy is provided. The apparatus comprises a sample cell comprising a noncentrosymmetric material having a selected orientation angle with respect to a reference axis; optics configured to illuminate an interface formed between the noncentrosymmetric material and a different material, or formed between two different materials and disposed over the noncentrosymmetric material, with light having a frequency ω under conditions to generate a second harmonic generation (SHG) signal having frequency 2ω; a detector configured to detect the SHG signal, the SHG signal comprising a bulk second harmonic signal from the noncentrosymmetric material and an interfacial second harmonic signal from the interface; and a device comprising a processor and a computer-readable medium operably coupled to the processor, the computer-readable medium having computer-readable instructions stored thereon that, when executed by the processor, cause the apparatus to: illuminate the interface to generate the SHG signal and detect the SHG signal.
US10514584B2
An embodiment of the invention relates to an optical signal generator comprising an optical emitter configured to generate a beam of optical radiation, a first and second beam deflecting element, a modulator being located between the beam deflecting elements, a phase shifter located between the beam deflecting elements, a control unit configured to control the phase-shift of the phase shifter, wherein the first and second beam deflecting elements, the phase shifter and the modulator are located in the same plane, wherein the beam generated by the optical emitter is angled relative to said plane, wherein said first beam deflecting element is configured to deflect the emitter's beam into the plane towards the modulator, said modulator being configured to modulate the emitter's radiation and outputting a modulated radiation, wherein said second beam deflecting element is configured to deflect the modulated radiation off the plane towards an output port of the signal generator, wherein the modulator is configured to modulate the emitter's radiation in response to an electrical data signal that is applied to the modulator and comprises a data stream, and wherein the control unit is configured to generate a control signal in order to control the phase-shift of the phase shifter and in order to avoid or reduce an impact of reflected radiation on the emitter's emission characteristic.
US10514580B2
The display device includes a first substrate provided with a driver circuit region that is located outside and adjacent to a pixel region and includes at least one second transistor which supplies a signal to the first transistor in each of the pixels in the pixel region, a second substrate facing the first substrate, a liquid crystal layer between the first substrate and the second substrate, a first interlayer insulating film including an inorganic insulating material over the first transistor and the second transistor, a second interlayer insulating film including an organic insulating material over the first interlayer insulating film, and a third interlayer insulating film including an inorganic insulating material over the second interlayer insulating film. The third interlayer insulating film is provided in part of an upper region of the pixel region, and has an edge portion on an inner side than the driver circuit region.
US10514579B2
The display device includes a first substrate provided with a driver circuit region that is located outside and adjacent to a pixel region and includes at least one second transistor which supplies a signal to the first transistor in each of the pixels in the pixel region, a second substrate facing the first substrate, a liquid crystal layer between the first substrate and the second substrate, a first interlayer insulating film including an inorganic insulating material over the first transistor and the second transistor, a second interlayer insulating film including an organic insulating material over the first interlayer insulating film, and a third interlayer insulating film including an inorganic insulating material over the second interlayer insulating film. The third interlayer insulating film is provided in part of an upper region of the pixel region, and has an edge portion on an inner side than the driver circuit region.
US10514575B2
According to one embodiment, an illumination device includes a light source module, and a reflector opposed to the light source module. The reflector includes a plurality of incidence openings on which light from the light source module is made incident, a plurality of emission openings opposed to the incidence openings, a plurality of reflective surfaces extending from the incidence openings to the emission openings, respectively, and reflective films formed on the reflective surfaces. The reflector includes a plurality of blocks, and the blocks are bonded to each other to form the reflector.
US10514573B2
Various embodiments may provide a device for controlling an electromagnetic wave. The device may include a first electrode layer. The device may also include a second electrode layer. The device may further include a matrix layer between the first electrode layer and the second electrode layer. The matrix layer may include a liquid crystal layer. The matrix layer may also include at least one resonator element in contact with the liquid crystal layer. The liquid crystal layer may be configured to switch from, at least, a first state to a second state in response to a voltage applied between the first electrode layer and the second electrode layer, thereby changing an optical property of the matrix layer to control the electromagnetic wave received by the matrix layer.
US10514570B2
According to one embodiment, a display device includes a first arrangement layer and a second arrangement layer. The first layer includes a first pixel, a second pixel, and a third pixel are arranged periodically in one direction. The second layer is opposed to the first layer, and the second layer includes a first element, a second element, and a third element which are arranged periodically to correspond to the first pixel, the second pixel, and the third pixel, respectively, and separate emission light to light of wavelength corresponding to a first color, light of wavelength corresponding to a second color, and light of wavelength corresponding to a third color to be emitted on the first pixel, the second pixel, and the third pixel, respectively.
US10514565B2
Provided is a display apparatus capable of realizing the reduction in thickness and border width even in a case of the curved display and keeping a display quality successfully. The display apparatus is equipped with: a liquid-crystal panel prepared by enclosing a liquid-crystal material between a pair of glass substrates being opposed to each other; a light guide plate being opposed to the liquid-crystal panel and being made of glass; and an optical sheet arranged between the liquid-crystal panel and the light guide plate; and a frame body which joins respective peripheral portions of the liquid-crystal panel and the light guide plate with a predetermined distance between the liquid-crystal panel and the light guide plate, and having a flexibility.
US10514558B2
An orthokeratological contact lens includes a treatment zone extending radially outward from a center point and return and alignment zones extending radially outward from the treatment zone, the return zone shaped to create an empty hypertrophy volume between the lens and the cornea when the lens is applied to the cornea, wherein the treatment zone is shaped based on a target treatment curve as to cause collagen fibrils located in a stroma of a cornea to shorten and flatten the cornea in the treatment zone and to lengthen and steepen it in the return zone when the rigid contact lens makes contact with the cornea without putting excessive pressure on or compressing the cornea, the treatment curve being based on a difference between a first arc length determined when a load is applied to the cornea and a second arc length determined when no load is applied to the cornea.
US10514548B1
The present invention discloses a laser animation display method. A display system includes three parts, i.e., a laser source, a diffraction optical element and a mechanical driving device. The display method includes the following steps: S1: the laser source emits laser at first, and the laser is caused to be incident on the pattern of a first microstructure on the diffraction optical element; S2: the diffraction optical element is driven by the mechanical driving device to translate to irradiate the pattern of a second microstructure of the diffraction optical element with the laser, and the patterns on other microstructures are sequentially irradiated with the laser according to the same method; and S3: cyclic movement is kept, thereby achieving an animation effect on a screen. The present invention implements laser animation display on the premise of no additional motion control unit and almost no increase of the system size and cost.
US10514546B2
A display system comprising a foveal display having a monocular field of view of at least 1 degree is positioned within a scannable field of view of at least 20 degrees, the foveal display positioned for a user. In one embodiment, the foveal display is positioned for the user's fovea.
US10514542B2
Several embodiments of a personal display systems that comprises modular and extensible features to affect a range of user/wearer/viewer experiences. In one embodiment, the personal display system comprises a frame, said frame formed to fit and mount the head of a viewer; at least one optical piece, said at least one optical piece comprising at least a portion of a plurality of active emissive elements; at least one side piece, said side piece capable of being mated to said frame; and further wherein at least one said side piece comprising components sufficient to interact with images intended to comprise a view of said viewer. In another embodiment, a front piece may be mated to the frame of the personal display system wherein such front piece may comprise a transmissive portion affecting some form of modulation of the light being transmitted there through.
US10514534B2
The information budget of a light field microscope is increased by increasing the field of view and image circle diameter of the microscope, while keeping the ratio of overall magnification of the microscope to the numerical aperture of the microscope unchanged. Alternatively, the information budget is increased by increasing the field of view and image circle diameter of the microscope by a first factor, while increasing the ratio of overall magnification of the microscope to the numerical aperture of the microscope by a smaller, second factor. In some cases, an infinity-corrected light field microscope has an overall magnification that is greater than the nominal magnification of the objective lens.
US10514533B2
A method for creating a microscope image of an object includes emitting excitation light, illuminating points on the object in a rastering manner, and detecting a raster partial image of a predetermined magnification for each illuminated point. An optical sensor detects emission light from the object excited by the excitation light. Distances between pairs of raster partial images correspond to distances of the illumination points multiplied by a correction factor. A microscopy device includes a light source, a rastering device, an optical sensor, and a deflecting device for deflecting the emission light. The deflecting device feeds excitation light passing through an inlet to the rastering device, light deflected at the rastering device to a first outlet, and emission light passing through the first outlet to the rastering device such that the emission light is deflected from the optical axis in the same direction as the excitation light.
US10514532B1
A confocal microscope is provided having an imaging head with an optical system for capturing optically formed microscopic sectional images of a sample, and a boom stand having a platform, a shaft which extends from the platform, and an arm which extends from the shaft, where such arm is coupled to the imaging head. The imaging head has a plurality of degrees of freedom of motion in positioning the arm relative to the shaft, and the imaging head relative to the arm, so that the imaging head in a first mode can be moved to image a first sample, such as ex-vivo tissue specimen mounted on a stage, disposed upon the platform, and in a second mode the imaging head can be moved to image a second sample, such as in-vivo issue, disposed away from or beside the platform.
US10514530B2
Mixed heliostat field combining, in the same field, heliostats of different sizes and/or with different types of facets, all of them having at least one facet and being canted or not, and either having spherical, cylindrical, flat or quasi-flat (spherical with a high curvature radius) facets, such that the solar field is optimised in order to minimise shadows and blockages between heliostats, as a result of correct positioning of the heliostats in the field.
US10514522B2
A lens drive unit that prevents an actuator from being inclined is provided. In the lens drive unit, when a lens frame is displaced in a direction orthogonal to a direction in which the actuator extends and contracts with respect to a base member by, for example, impact from an outside of the lens drive unit, a drive shaft of the actuator abuts on a first lateral wall and a column, so that the actuator is prevented from being inclined with respect to the base member.
US10514521B2
Methods for manufacturing cables and cables assemblies include providing powder particles within a tube extruded about optical fiber. The particles may be accelerated so that as they strike the tube and mechanically attach to the tube.
US10514518B1
With respect to fiber optic structured cabling, dense optical termination and patching platforms, systems, and methods herein involve using an optical-connector adapter cassette that has double rows of adapters on a front portion and at least one goose-neck portion that transitions to a single row of adapters on a rear portion. The double rows of adapters may have virtually no geometry between them. Two cassettes may be cantilevered at the front of a fiber-optic enclosure. The systems includes other aspects.
US10514510B2
The present disclosure is directed to a keyed optical component assembly that ensures that the same has a proper orientation when press-fit into or otherwise coupled to a complimentary opening of an optical subassembly housing. In an embodiment, the keyed optical component assembly includes a base portion defined by a first end and a second end disposed opposite the first end along a longitudinal axis. A first arcuate region extends from the first end towards the second end and transitions into a tapered region. A second arcuate region extends from the second end towards the first end and also transitions into the tapered region. Therefore, the tapered region extends between the first arcuate region and the second arcuate region, and generally tapers/narrows from the second arcuate region to the first arcuate region. The resulting shape of the base portion may generally be described as an asymmetric tear-drop shape.
US10514493B2
Provided is a display device that can prevent light emitted from, a light guide plate from arriving at a display panel via a gap in an optical sheet and a gap between the optical sheet and a holding frame member. The display device is provided with: a light guide plate having a light exit surface; an optical sheet that is arranged facing the light exit surface, that is configured from a plurality of stacked unit sheets, and in which a plurality of flanges are arranged in each of the unit sheets so as to extend along the sheet surface of the unit sheet from the side edge of the unit sheet toward the exterior; and a holding frame member having formed therein a plurality of accommodating sections in which the flanges of the optical sheet are accommodated when holding the optical sheet. One or more of the plurality of flanges in each of the unit sheets is a matching flange having a shape that matches the shape of the accommodating section along the sheet surface. In this way, the accommodating section blocks light from the light guide plate by accommodating one or more of the matching flanges.
US10514490B2
Provided is a backlight unit capable of causing light that has exited from a light guide plate to be incident to a liquid crystal panel with high efficiency. The object is achieved by providing the backlight unit including a light source; a light guide plate that causes light to be incident to through an edge face and to exit through one of principal surfaces; and an optical film disposed on a surface of the light guide plate, the surface being on the opposite side of the light exiting surface, in which the optical film has a plurality of reflective polarizing elements each having a curved surface, and/or a plurality of reflective polarizing elements each having an inclined surface that is inclined with respect to the direction of light propagation of the light guide plate.
US10514487B2
Light guide assemblies including first, second and third light guides, a first optical coupling component disposed between and attached to the first and second light guides, and a second optical coupling component disposed between and attached to the second and third light guides are described. The first optical coupling component is adapted to couple light between the first and second light guides, and the second optical coupling component is adapted to couple light the between second and third light guides. The first light guide, the second light guide and the first optical coupling component are coextensive over a first region of the assembly, and the second light guide, the third light guide and the second optical coupling component are coextensive over a different second region of the assembly.
US10514474B2
The present invention relates to a method for synchronizing continuous seismic survey. In particular, the present invention employs a semaphore scheme for the vibes to autonomously and continuously initiate sweeps, thereby decoupling the vibratory source subsystem from the recording subsystem. By using a continuous recorder and the method of the present invention, the recording trucks and the observers can be eliminated, and the vibratory sources can be initiated more efficiently than conventional systems.
US10514467B2
A method of determining a position of a GNSS device includes receiving GNSS signals at the GNSS device from a plurality of GNSS satellites. The GNSS device generates GNSS raw data based on the GNSS signals. The GNSS raw data is stored on the GNSS device. The GNSS device receives first correction data and second correction data. The first correction data and the second correction data are generated from data from at least one reference station. Third correction data is determined based on the first correction data, the second correction data, and the GNSS raw data. Position data for the GNSS device is determined based on the third correction data and the GNSS raw data.
US10514465B2
A system and method of setting a clock at a vehicle, including: operating a vehicle clock installed in a vehicle; receiving an external time signal via wireless communications, wherein the external time signal is a wireless communications signal that includes a time value; determining whether a predetermined amount of time has passed since a most-recent clock update; when it is determined that a predetermined amount of time has passed since the most-recent vehicle clock update, then carrying out the following steps: (i) calculating a measured drift and a drift limit; (ii) determining whether the measured drift is less than the drift limit; and (iii) when it is determined that the measured drift is less than the drift limit, then setting the vehicle clock to the time value included in the received external time signal.
US10514455B2
A radar apparatus is provided, which includes an approaching velocity calculating module configured to calculate an approaching velocity of a target object from which a reflection wave caused by an electromagnetic wave is obtained, based on a change in one of phase and frequency of the electromagnetic wave transmitted and received by a radar antenna, the approaching velocity being a velocity component in a transmission direction of the electromagnetic wave, a tracking determining module configured to determine whether to track the target object based on the approaching velocity of the target object, a tracking module configured to automatically track the target object determined to be tracked by the tracking determining module, and a display controlling module configured to display the tracking result of the tracking module along with a radar image.
US10514447B2
A method for propagation time calibration of a LIDAR sensor which includes a pulsed light source, a detector surface with a plurality of optoelectronic elements for receiving light pulses of the light source reflected on objects and for converting these light pulses into electronic signals, and an electronic evaluation circuit for detecting the light pulses and for measuring the propagation times thereof. In the method, the measured propagation times are corrected with respect to the propagation times of the electronic signals in the evaluation circuit by decoupling, for at least some of the light pulses, a portion of the light, using a beam splitter at the light source, and using detection times of the decoupled light pulses as a time reference. The detector surface is illuminated with the decoupled light via a light-scattering system and used for detecting the decoupled light pulses.
US10514432B2
In the present invention, a current plane which is virtually disposed and surrounds a measurement position is assumed from magnetic field measurement values, and a current distribution (or magnetic moment distribution) which mimics a measured magnetic field is reproduced with current potentials. This is used to perform shimming calculation by a truncated singular value decomposition method with discrete shim trays that are actually used and ideal virtual continuous shim trays to carry out shimming under conditions for shimming having a uniformity that is close to ideal shimming.
US10514428B2
A signal processor is configured to receive signaling containing information about a sensed sinusoidal waveform of magnetic flux caused by a current flowing in a winding of a motor having a component of distortion caused at least in part by a magnetic flux created by the current flowing, and also about a pure sinusoidal waveform of a sensed fundamental frequency of the magnetic flux; and determine corresponding signaling containing information about anomalies in the motor that depends on a relationship between the sensed sinusoidal waveform and the pure sinusoid waveform, based upon the signaling received. The signaling may be sensed and provided by a motor magnetic flux sensor attached externally to the motor frame.
US10514426B2
The present disclosure provides a smart jumper cable having a display module, which comprises a pair of clamps and a control module. The clamps are configured to electrically connect to a vehicle battery; the control module is electrically connected with the clamps through electric wires; the control module further comprises an input port for connecting with an external power supply. The control module comprises a MCU, a switch module and a display module; wherein the display module is electrically connected with the MCU. The switch module is configured to turn on/off the power-supply to the vehicle battery from the external power supply; and the switch module is controlled by the MCU. The smart jumper cable having a display module can display not only the load voltage but also some other working status visually.
US10514420B2
A ground fault circuit interrupter (GFCI) breaker testing system can include an enclosure having at least one wall that forms a cavity. The system can also include at least one GFCI breaker disposed within the cavity. The system can further include a sensing circuit assembly having at least one switch, where the at least one switch is electrically coupled to the at least one GFCI breaker. The system can also include a user interface assembly disposed, at least in part, outside the cavity, where the user interface assembly is coupled to the sensing circuit assembly, where the user interface assembly instructs the at least one switch to test the at least one GFCI breaker.
US10514416B2
An electronic component handling apparatus that handles a DUT having a temperature detection circuit and presses the DUT against a socket electrically connected to a tester is provided. The electronic component includes: a temperature adjuster that adjusts a temperature of the DUT; a first receiver that receives a first signal from the tester, the first signal indicating a junction temperature of the DUT; a second receiver that receives a second signal from the tester, the second signal indicating a detection value of the temperature detection circuit; a first calculator that calculates the temperature of the DUT by using the first signal and the second signal; and a temperature controller that controls the temperature adjuster on the basis of a calculation result of the first calculator.
US10514413B2
Multiple magnetic field sensors are arranged around a current-containing volume at multiple longitudinal and circumferential positions. Each sensor measures multiple magnetic field components and is characterized by one or more calibration parameters. A longitudinal primary current flows through two end-to-end electrical conductors that are separated by an arc gap, and flows as at least one longitudinal primary electric arc that spans the arc gap and that moves transversely within the arc gap. Estimated transverse position of the primary electric arc is calculated, based on the longitudinal position of the arc gap, and two or more of the measured magnetic field components along with one or more corresponding sensor positions or calibration parameters. In addition, estimated occurrence, position, and magnitude of a transverse secondary current (i.e., a side arc) can be calculated based on those quantities.
US10514411B2
Described herein is a system for testing one or more multiple-unit (MU) conductors on a locomotive using a first and second test unit together with a portable display unit having a wireless transceiver for communicating with the test units. The portable display may include a panel of LED indicators corresponding to the MU conductors to be tested and a user interface in the form of a display screen. The system may be used for running both test procedures and monitoring procedures. The wireless portable display unit allows a single technician to run the procedures and review information from both test units without using long and heavy MU jumper cables.
US10514408B2
A method for locating electrostatic discharges occurring on an aircraft in flight including a step of recording, during the flight of the aircraft, electromagnetic signals resulting in the electrostatic discharges and received by a plurality of detectors arranged at different places on an exterior surface of the aircraft, a step of analyzing the signals recorded during the flight, each of the signals, received by the various detectors and corresponding to one and the same electrostatic discharge, are processed to identify at least one zone of an exterior surface of the aircraft, determining a structural part in which the electrostatic discharge probably occurred.
US10514395B2
A method for insulating an RC voltage divider includes installing at least one part of an active part of the voltage divider within an inner housing and insulating the at least one part of the active part with an insulating oil within the inner housing, hermetically sealing the inner housing, enclosing the inner housing in an outer housing and filling a space between the inner housing and the outer housing with an insulating gas. A system for insulating an RC voltage divider is also provided.
US10514390B2
A probe structure is provided, including two probe heads for electrically contacting with the two objects, respectively, an elastic buffer portion forming a hollow space therein, a conductive portion being disposed within the hollow space and thereby being surrounded by the elastic buffer portion, and having two ends respectively electrically being connected to the two probe heads. When the two probe heads do not contact with the two objects electrically, the conductive portion is linearly extended between the two probe heads.
US10514388B2
A wind detection device of a generally bisected cylindrical-type shape with a flat face at the bisection, for attachment to other devices such as a hunting bow, having opaque or translucent walls formed of an impermeable material such as plastic where one end narrows down to an opening for a lid to attach to and seal device; and where lid narrows down further to another cylindrical-type shape with another, smaller opening for contents of device to exit through.
US10514387B2
The present invention lies in the field of automated analysis devices and relates to a method for monitoring the functionality of a wash station (1) for pipetting needles (2).
US10514367B2
The present disclosure generally relates to a color indicator that signals when the concentration of an antimicrobial solution changes. In some embodiments, the color indicator is specific for changes in the concentration of an antimicrobial quaternary ammonium compound in an antimicrobial solution. The color indicator can be incorporated into a variety of articles including towels, labels, containers, buckets, trays, sinks, spray bottles, liners for containers, buckets, sinks, or spray bottles, indictor wands or strips, and test kits.
US10514365B2
A cooling-assisted inside needle capillary adsorption trap device for sampling and delivering volatile and semi-volatile analytes to an analytical device is disclosed. The device includes an inside needle capillary adsorption trap having a first end and a second end and a side aperture located between the first and second ends. The side aperture enables entering the carrier gas into the INCAT and flowing upon the surface of the sorbent (when injected into the GC injector) for complete releasing and eluting of the analytes from the interior surface of the needle. A sorbent is multiwall carbon nanotube/polyaniline and is coated onto the interior surface of the needle between the second end and the side aperture to entrap an analyte within a sample. The cooling-assisted inside needle capillary adsorption trap device also includes a cooling device configured to cool the sorbent.
US10514360B1
Methods, devices, and systems for improving the quality of electrospray ionization mass spectrometer (ESI-MS) data are described, as are methods, devices, and systems for achieving improved correlation between chemical separation data and mass spectrometry data.
US10514356B2
A gas sensor is provided which includes a sensor device, a plurality of contact springs, an insulator, a plurality of connecting terminals, and a lead cover. The insulator has an end surface which faces the connecting terminals and also includes as many protrusions as the contact springs. The insulator also has formed therein holding holes in which the contact springs are disposed. Each of the protrusions has formed therein a through-hole which communicates between an end surface of the protrusion and one of the holding holes. The through-holes are discrete from each other and formed one in each of the protrusions. This minimizes a risk of occurrence of leakage current between the contact springs or the connecting terminals arising from dew condensation and ensures a high degree of measurement accuracy of the gas sensor.
US10514351B2
The present application relates to sensors and methods for detecting and/or quantifying an oxidant such as free chlorine in a liquid sample such as drinking water. The sensors comprise a first electrode, a second electrode and a composite material between and connecting the first electrode and the second electrode, the composite material comprising a semiconductor and a redox-switchable organic compound associated therewith. The methods comprise exposing the liquid sample to the sensor under conditions to oxide the redox-switchable organic compound and analyzing a resulting change in current.
US10514350B2
An apparatus and method may operate to mount an electrode assembly with the exterior of a casing string to be placed in a borehole in a subterranean formation. The electrode assembly may include electrodes in spaced relation to one another. After the casing string and associated electrode assembly are in the borehole, the method may include providing a series of excitation signals at a plurality of frequencies to at least one electrode to inject a series of injection signals into fluid in the annulus. The method can further include receiving signals in response to the series of injection signals through at least one other electrode. The received signals can be representative of an impedance spectrum including impedance values representative of the fluid in the borehole annulus. The method can further include identifying the fluid in reference to the impedance spectrum. Additional apparatus, systems, and methods are disclosed.
US10514346B2
Provided is an X-ray fluorescence spectrometer, which has a simple structure, and is capable of promptly performing high-accuracy analysis. The X-ray fluorescence spectrometer according to the present invention includes: an X-ray source (100) configured to irradiate a sample (103) with primary X-rays; a spectroscopic device (120) configured to disperse secondary X-rays emitted from the sample (103); an energy-dispersive detector (110) configured to measure an intensity of the secondary X-rays; a retracting mechanism (108) configured to retract the spectroscopic device (120) from a path of the secondary X-rays; a scanning mechanism (114), which is configured to continuously move the detector (110) between an auxiliary measurement area (124) for measuring the secondary X-rays in a state where the spectroscopic device (120) is retracted and a main measurement area (122) for measuring the dispersed secondary X-rays; a storage device (116) configured to store, in advance, a ratio between a background intensity measured in the auxiliary measurement area (124) and a background intensity measured in the main measurement area (122); and an arithmetic device (118) configured to perform correction and quantitative analysis, the correction including subtracting a value, which is obtained by multiplying the background intensity in the auxiliary measurement area (124) by the ratio, from a measured intensity in the main measurement area (122).
US10514339B2
A test strip analyser is provided. The test strip analyser includes a frame, a test control module and an optical system. The test control module is disposed in the frame and includes a test strip carrier of a plurality of test strip carriers and a sample container of a plurality of sample containers. The test strip carrier is disposed on the frame and adapted to hold a test strip. The sample container is adapted to contain a sample. The optical system is disposed above the frame and the test control module and includes a light sensor and controller. The light sensor is configured to capture an image of the test strip. The controller is connected to the light sensor to control the light sensor, and the light sensor feedbacks the image to the controller. In addition, an analysing method using the same is also provided.
US10514338B2
A target within a sample can be characterized using an energy source configured to transform a metal in the sample into a plasma and an optical spectroscopic detector configured to detect electromagnetic radiation emitted by the plasma to provide an optical-spectrum signal. A processor can determine presence of the metal in the sample using the optical-spectrum signal. The target can include a microbe or biological toxin. A recognition construct comprising a metal and a scaffold can be applied to the sample. The scaffold can bind to the target. Energy can be applied to transform at least some of the sample into a plasma. Electromagnetic radiation emitted by the plasma can be detected to provide an optical-spectrum signal of the sample. A preparation subsystem can add the recognition construct to the sample and a washing subsystem can wash unbound recognition construct out of the sample.
US10514333B2
The present disclosure describes a device for measuring an optical absorption property of a fluid as function of wavelength. The device comprises a broadband light source for emitting light, a plurality of integrated optical waveguides for guiding this light and a light coupler for coupling the emitted light into the integrated optical waveguides such that the light coupled into each integrated optical waveguide has substantially the same spectral distribution. The device also comprises a microfluidic channel for containing the fluid, arranged such as to allow an interaction of the light propagating through each waveguide with the fluid in the microfluidic channel, and a plurality of spectral analysis devices optically coupled to corresponding waveguides—such as to receive the light after interaction with the fluid. The spectral analysis devices are adapted for generating a signal representative of a plurality of spectral components of the light.
US10514330B2
The present invention refers to a device, comprising a hollow body having at least one open end comprising at least one solid matrix binding, adsorbing, absorbing, chelating or retaining compounds which are not desired in a sample and preferably at least one barrier which is non-permeable for liquids and solids under ambience conditions, however, becomes liquid-permeable by applying an external force to the barrier, the use of such a device for isolating or purifying a biomolecule from a sample, a method for preparation of the device and a method for isolation or purification of any biomolecule using said device.
US10514329B1
A sample agitation system for an automated sampling device is described. In an example implementation, the sample agitation system includes a sample probe configured to contact a sample positioned within a sample vessel. Further, the sample agitation system includes an actuator coupled to the sample probe that is configured to stir the sample positioned within the sample vessel in one or more rotational directions. The directions may include, but are not limited to, clockwise motion, anti-clockwise motion, or the like. In some implementations, a sample probe support arm can be coupled to the sample probe and/or the actuator. The actuator can move the sample probe support arm in a translational, a rotational, and/or a vertical direction to rotate the sample probe and stir the sample.
US10514327B2
An autosampler includes a pressure release operation unit for performing, by controlling operation of a needle drive mechanism and a switching mechanism, before a tip end of a needle is pulled out from an injection port following a state where a sampling channel is disposed between a feeding device and an analytical column, a pressure release operation of switching the switching mechanism in such a way that the sampling channel is not disposed between the feeding device and the analytical column and a system including the sampling channel is made an open system, and of performing standby until a pressure inside the sampling channel is returned to atmospheric pressure.
US10514310B2
A measurement assemblage for measuring the torque on a shaft, and in particular the torsional moment of the shaft, having a sensor device that is configured to measure a magnetic field carried or generated by the shaft; a sensor holder for holding the sensor device and for disposing the sensor device with respect to a region of an outer circumferential surface of the shaft; and at least one force element that is configured to dispose the sensor holder, by force impingement, in stationary fashion with respect to the region of the outer circumferential surface of the shaft, the at least one force element being configured to exert a tensile force on the sensor holder in such a way that the sensor holder is pulled against the region of the outer circumferential surface of the shaft as a result of the tensile force.
US10514297B2
An electronic circuitry of a spectrometer, configured to electrically connect with an optical sensor of the spectrometer, includes a memory unit configured to store a measurement setting, a trigger line configured to transmit at least one trigger signal, and a control unit electrically connected to the trigger line and the memory unit. The control unit is configured to receive the trigger signal from the trigger line so as to instruct the spectrometer to perform a plurality of exposure measurements continuously under the measurement setting, and to save a plurality of spectral data acquired from the exposure measurements into the memory unit. A spectrometer using the electronic circuitry for performing the exposure measurements and a measuring method of the spectrometer are also provided.
US10514295B2
An object detector including a light-emitting system to emit light to an object, a light detector, a signal detector, and a threshold adjuster. The light detector receives the light emitted from the light-emitting system and reflected by the object, and output a signal. The signal detector detects the signal output from the light detector based on a threshold value of voltage. The threshold adjuster changes the threshold value between when the light-emitting system emits light to a part of a light-emission range of the light-emitting system and when the light-emitting system emits light to other part of the light-emission range other than the part of the light-emission range.
US10514292B2
An optical probe includes a first resonant scanner having a first mirror capable of rotating centered around a drive axis, the first resonant scanner reflecting emitted light from a light source toward a measured object, and a second resonant scanner having a second mirror capable of rotating centered around the drive axis, the second resonant scanner reflecting light reflected from the measured object toward a photoreceiver. The first mirror and the second mirror are rotationally driven in synchronization.
US10514284B2
A flow sensor sub-assembly for sensing flow of a fluidic medicament is disclosed. The flow sensor sub-assembly includes a first spring contact and a second spring contact. The spring contacts are secured to a base that has a circuit for conducting an electrical signal to and from the spring contacts to a microprocessor. The first spring contact is in electrical communication with a first piezo element and the second spring contact is in electrical communication with a second piezo element. The first spring contact has a first contact force against the first piezo element and the second spring contact has a second contact force against the second piezo element, and the first and second contact forces are equivalent. A circuit board for interfacing to a flow sensor having a plurality of piezo elements for transmitting a flow signal indicative of flow of fluidic medicament is also disclosed.
US10514283B2
The present invention is an exhaust gas flow rate measuring unit that eliminates the disturbance of the flow velocity distribution of exhaust gas flowing through an attachment pipe to accurately measure an exhaust gas flow rate, and is mounted in a vehicle to measure the flow rate of exhaust gas emitted from an exhaust pipe of the vehicle. In addition, the exhaust gas flow rate measuring unit includes the attachment pipe that is connected to the exhaust pipe and forms a flow path through which the exhaust gas flows, a flowmeter that is provided in the flow path and measures the flow rate of the exhaust gas flowing through the flow path, and a straightening mechanism that is provided on the upstream side of the flowmeter in the flow path.
US10514282B2
Methods and systems to measure a volumetric fluid flow rate through a fluid flow passage, such as an air handler of a HVAC system, are described. The system includes an air intake conduit. The air intake conduit includes a partition, an airflow measuring passage through the partition, and an airflow flow-through passage. The partition and the airflow flow-through passage are arranged in a side-by-side fashion. The airflow measuring passage is equipped with an airflow measuring device to measure the air pressure drop in the airflow measuring passage and has a minimal air pressure drop requirement. The air intake conduit has a minimal volumetric air intake requirement. When the air intake conduit has the minimal volumetric air intake, the air pressure drop measured at the airflow measuring passage is at the minimal air pressure drop requirement.
US10514276B2
A sensor device for capturing the displacement position of an optical component includes a plurality of stator electrodes and a mechanism or restricting the electric field that is relevant to the measurement of the displacement position to the region of the stator electrodes.
US10514265B2
A map display device includes a position information acquiring unit for acquiring the present position of a vehicle; a map data storage unit for storing map data; a remaining energy acquiring unit for acquiring a residual quantity of energy for driving the vehicle and equipment mounted on the vehicle; a range calculating unit for computing a range the vehicle can travel with the remaining energy, using a moving energy consumption rate which is energy consumption per unit time required for moving the vehicle and a driving energy consumption rate Eci which is energy consumption per unit time required for driving the equipment mounted on the vehicle; and an output control unit for displaying the range on a map using the map data.
US10514264B2
Methods, systems, and apparatus, including computer programs encoded on a storage device are disclosed for generating a map for use in safely navigating hazards detected at a property. One method may include actions of receiving a request for a safe path to a property occupant that is located inside the property, obtaining a floor plan of the property, obtaining real-time sensor data generated by one or more sensors installed at the property that includes (i) sensor data indicative of a hazard at the property and (ii) a current location of the property occupant, generating a map of the property based on (i) the obtained real-time sensor data and (ii) the obtained floor plan, determining a safe path between an exit of the property and the current location of the property occupant, and providing, for output on a user device, the map of the property that visually indicates the safe path.
US10514251B1
An apparatus, and related method, relates generally to a fiber-optic sensing system. In such a system, fiber-optic sensors are in a rosette or rosette-like pattern. An optical circulator is coupled to receive a light signal from a broadband light source, to provide the light signal to the fiber-optic sensors, and to receive a returned optical signal from the fiber-optic sensors. A spectral engine is coupled to the optical circulator to receive the returned optical signal and configured to provide an output signal.
US10514250B2
An interferometry system including a coherent light source operable to generate a beam of coherent light is provided. Separate waveguide pathways are optically associated between the coherent light source a photodetector. A transceiving segment can also be optically associated with each waveguide pathway at a location between the coherent light source and the photodetector. Each transceiving segment can be configured to emit an emitted beam of coherent light and positioned to receive a received portion of an emitted beam of coherent light emitted from a transceiving segment optically associated with a different waveguide pathway. The received portion of the emitted beam of coherent light can be combined with coherent light from the waveguide pathway receiving the received portion of the emitted beam of coherent light to form an optical interference signal. Accordingly, each waveguide pathway can be further configured to direct a separate optical interference signal toward a respective photodetector.
US10514248B2
A distance detecting apparatus includes an imaging unit that generates a first image signal and a second image signal and an arithmetic processing unit. The distance detecting apparatus detects the distance to a subject on the basis of an amount of defocus indicating the distance between an imaging plane of the imaging unit and an image forming plane of light fluxes. The arithmetic processing unit executes a first step of calculating an amount of temporary defocus on the basis of the first image signal and the second image signal, a second step of calculating a conversion factor used to convert an amount of image displacement between a first image and a second image into the amount of defocus on the basis of the amount of temporary defocus, and a third step of calculating the amount of defocus by using the conversion factor.
US10514243B2
The invention is a tool for measuring the distance and angle between two points on two surfaces to measure position of the points and surfaces relative to one another to provide the user with angle and distance measurements which fully define the relationship between the surfaces and points without additional calculations.
US10514232B2
A launch container apparatus for ejection from a submerged launch platform and a method for ejecting a launch container apparatus are disclosed. The apparatus comprises an enclosure for carrying an unmanned aerial device and a surfacing sensor configured to generate a control signal in response to detection of surfacing of the launch container apparatus. Petals are configured to provide buoyancy and stabilization for the launch container apparatus are also provided. A petal drive mechanism moves, in response to the control signal, the petals from a folded position to an expanded position.
US10514229B2
A crossbow cocking system may include a sled having first and second arms, an elongated cocking cable, a first handle, a second handle, a first engagement feature and a second engagement feature. The first and second engagement features may be used to engage the first handle to the first arm and the second handle to the second arm, respectively. Each engagement feature may include at least one cavity and at least one protrusion that is received in the cavity for engagement. The handles may be disengaged to permit a user to cock the crossbow.
US10514223B1
A trigger mechanism for use in a firearm having a receiver with a fire control mechanism pocket, transversely aligned pairs of hammer and trigger pin openings in the pocket, and a bolt carrier that reciprocates and pivotally displaces a hammer when cycled. The trigger mechanism includes a hammer, a trigger member, and a locking bar. The hammer has a sear notch and is mounted in the fire control mechanism pocket to pivot on a transverse hammer pin between set and released positions. The trigger member has a sear and is mounted in the fire control mechanism pocket to pivot on a transverse trigger pin between set and released positions. The trigger member has a surface positioned to be contacted by hammer when the hammer is displaced by cycling of the bolt carrier, the contact causing the trigger member to be forced to the set position. The locking bar is pivotally mounted in a frame and spring biased toward a first position in which it mechanically blocks the trigger member from moving to the release position, and is movable against the spring bias to a second position when contacted by the bolt carrier reaching a substantially in-battery position, allowing the trigger member to be moved by an external force to the released position.
US10514218B2
A firearm has a lower receiver with a first channel formed in a first surface of the lower receiver, and an upper receiver attached to the lower receiver at a pivot point. A compressible material is disposed within the first channel between the upper receiver and lower receiver. The upper receiver compresses the compressible material when the upper receiver closes onto the lower receiver. A recess can be formed within the first channel and extends into the lower receiver deeper than the first channel. A second channel is formed in a second surface of the lower receiver. Alternatively, the lower receiver has a slot formed in a surface of the lower receiver, and the compressible material is disposed within the slot. The slot includes a bottom surface and vertical surface extending from the bottom surface to the surface of the lower receiver, and rounded ends.
US10514217B2
Systems and methods may utilize a two-axis stand configured with a locator moveable along two orthogonally oriented axes. The locator may scan a tube opening. A controller may position the locator and the two-axis stand to a) scan across a plurality of tube openings, b) locate the plurality of tube openings based on the scan, and c) activate a cleaning tool to clean tube interiors associated with respective tube openings. Control may be automated and/or based on user interaction with a user interface.
US10514215B2
The present prevention provides a surface coating for cooling a surface by light scattering comprising a plurality of successive layers, each of the layers may be comprised of a plurality of spheres arranged to form a structure comprised of packed spheres. Each layer may have a different arrangement of packed spheres to create to a different light scattering property in each of the layers. The coating of the structures may also be formed by randomly packed spheres and the spheres may have a uniform diameter.
US10514213B2
Disclosed is an adjustable tool holder for holding elongate hand held tools. The tool holder comprises a telescopically adjustable base member comprising an elongate, rectangular, hollow outer member and an elongate rectangular inner member configured to be snugly and slidably received within the outer member, the inner member adapted to be secured to the outer member at a plurality of lock positions thereby rendering the length of the base member adjustable. The tool holder further comprises a compression spring, one end of which is secured at the free end of the outer member and the other end of which is secured at the free end of the inner member. The length of the spring is subject to change in accordance with the change in the length of the base member. A tool is adapted to be held between two consecutive loops of the spring.
US10514207B2
A superconductive nano heat transfer plate type heat exchanger consisting of a plurality of superconductive nano plate bundles by welding, the plate bundles being formed by welding a plurality of heat transfer plates together and sealed in vacuum, each of the plate bundles comprising an evaporation zone and a condensation zone, inside the plate bundle is padded a superconductive nano medium. The heat exchanger enhances heat transfer efficiency and may perform highly efficient heat transfer at different pressures, different temperatures, within different application scopes.
US10514204B2
A heat exchanger is provided including a first manifold and a second manifold separated from the first manifold. A plurality of heat exchange tube segments are arranged in spaced parallel relationship and fluidly couple the first and second manifold. Each of the plurality of tube segments includes a first heat exchange tube and a second heat exchange tube at least partially connected by a web extending there between. The plurality of heat exchange tube segments includes a bend defining a first section and a second section of the heat exchange tube segments. The first section is arranged at an angle to the second section. A plurality of first fins extends form the first section of the heat exchange tube segments and a plurality of second fins extends from the second section of the heat exchange tube segments.
US10514200B2
A system configuration for a chilled water plant is described in which mechanical cooling is reduced in favor of less energy intensive ambient dry or evaporative cooling. While the system sees the greatest performance improvement in dry and cool climates, considerable energy savings may be realized in a variety of climate zones. Less facility hardware is required for the same amount of total cooling capacity, reducing the overall cost of the plant.
US10514197B2
There is disclosed a refrigerator including an inner case that defines an exterior appearance of a storage space, with a communication hole formed therein, an outer case spaced apart a predetermined distance from the inner case, with a communication formed at a position corresponding to the communication hole of the inner case, a vacuum space provided between the inner case and the outer case, with being maintained vacuum, to insulate the inner case from the outer case, and a connection pipe passing through the vacuum space, to connect the communication hole of the inner case and the communication hole of the outer case with each other.
US10514195B2
A refrigerator includes a cold air supply device received in an insulating partition that defines a storage compartment into upper and lower storage compartments. As cold air is supplied into the storage compartment below the insulating partition through the cold air supply device, the refrigerator has enhanced productivity and interior volume efficiency.
US10514192B2
A dehumidifier includes a body having an inlet for suctioning air and an outlet for discharging air; a compressor, disposed at the body, for compressing a refrigerant; a condenser for condensing the refrigerant compressed from the compressor; an expander for expanding the refrigerant condensed from the condenser; an evaporator, disposed at upstream of the condenser according to the flow direction of air, for evaporating the refrigerant expanded from the expander; a condensate water tank to store condensate water condensed from the evaporator; and a condensate water pipe, connected to the condensate water tank, for flowing the condensate water to be heat-exchanged with the refrigerant compressed from the compressor.
US10514183B2
An exhaust gas latent-heat recovery device includes: a heat transfer tube disposed inside a duct through which exhaust gas flows, the heat transfer tube having a water supply inlet into which water to be heated for recovering latent heat of the exhaust gas is supplied and a water supply outlet through which the water to be heated is discharged; and a water supply control part configured to control supply of the water to be heated to the water supply inlet. The water supply control part is configured to control supply of the water to be heated from the water supply inlet so that an outlet temperature being a temperature of the water to be heated at the water supply outlet is at a set temperature.
US10514182B1
An automatic self-cleaning evaporator drain pan system, having a container housing with a chemical container and a smart control pump. The smart control pump has at least one microprocessor. An evaporator drain system has at least one sensor connected to the smart control pump; and further having an electrical system. The container housing has a container tubing, and a chemical conduit with first and second chemical delivery lines. The chemical conduit extends from the smart control pump to the evaporator drain system, transporting a chemical composition. In operation, the chemical composition is mixed with condensed water and drains from the drain outlet toward a drainage line, whereby the chemical composition prevents microorganism growth, algae, gunk and/or other solid material from forming on the drain pan and the drainage line.
US10514177B2
The SmartVent and Atmospheric Controller Apparatuses, Methods and Systems (“SmartVent”) transforms user desired environmental setting and SmartVent measurement inputs via SmartVent components into SmartVent adjustment messages and environmental change outputs. In one embodiment, a SmartVent system may include a self-regulating HVAC system, comprising a plurality of smart HVAC vents disposed in wireless communication with a remote computing device. Where the remote computing device includes a memory and a processor disposed in communication with the memory, configured to record calibration data from each of said plurality of smart HVAC vents. The calibration data may include temperature and flow rate data from each of said plurality of smart HVAC vents. The system may generate calibration tables in accordance with the recorded calibration data and transmit instructions to each of the plurality of smart HVAC vents to optimize thermal conditions and energy efficiency of the HVAC system, in accordance with said calibration tables.
US10514176B2
A refrigerant leak management system includes a return inlet assembly and a purge exhaust outlet assembly. The system also includes a sensor configured to detect refrigerant proximate an air handling enclosure of a HVAC unit. The system further includes a controller configured to control the system to drive air from a conditioned interior space of a building into an external environment via the purge exhaust outlet assembly when the sensor detects the refrigerant proximate the air handling enclosure by: actuating the return inlet assembly to close the return inlet assembly, actuating the purge exhaust outlet assembly to open the purge exhaust outlet assembly, and activating a reversible supply fan of the HVAC unit in a reverse direction.
US10514173B2
A climate control system is operated by receiving climate information from climate control input devices at one or more plugin modules. The climate information is communicated from the plugin modules to a main control unit, which determines operating instructions for climate output devices and air inlets. When it is detected that the main control unit is not operational, the control system switches to a standby control unit if so equipped. The climate information is then communicated from the plugin modules to the standby control unit. The standby control unit determines operating instructions for the climate output devices and air inlets based on the climate information. When it is detected that the standby control unit is also not operational, the plugin modules switch to an autonomous mode such that operating instructions for the climate output devices and air inlets are determined by the plugin modules.
US10514165B2
A burner system that employs a perforated flame holder and is configured to combust a powdered solid fuel includes a structure configured to protect the perforated flame holder from erosion caused by particles of the solid fuel.
US10514162B2
The bathtub generally has a wall having a translucent inner layer defining a cavity for receiving water. The bathtub has at least one translucent outer reinforcement member which is secured to a portion of the translucent inner layer, thus forming at least one window with the corresponding portion of the translucent inner layer. The bathtub has a corresponding light source which faces the translucent outer reinforcement member for lighting through the window, into the cavity. The wall further has an outer reinforcement layer covering the translucent inner layer around the at least one window.
US10514160B2
The present disclosure is directed to a light fixture mount. The light fixture mount includes a first end to receive a light fixture, a cap coupled to the light fixture that is coupled to the first end to form a first seal, and a second end to receive a collar that is coupled to a mounting member, wherein the collar comprises a sealed wire pass-through and a second seal is formed between the second end and the collar.
US10514156B2
A luminaire is provided. The luminaire includes a luminaire body and a first wireless communication device. The first wireless communication device receives a first control signal wirelessly transmitted from an outside of the luminaire body, and wirelessly transmits a second control signal in response to the first control signal. The luminaire body includes: a light source; a second wireless communication device that receives the second control signal; a light emission control circuit that is electrically connected to the second wireless communication device and controls a light emission state of the light source according to the second control signal; and a case that, with or without a cover, houses the second wireless communication device and the light emission control circuit. The first wireless communication device is attached to the luminaire body.
US10514152B2
The invention provides a lighting device comprising a light source configured to provide light source light having a blue light component and a light converter configured to convert at least part of the light source light into converter light, wherein the light converter comprises a polymeric matrix (22) with a luminescent material, wherein the luminescent material comprises a luminescent molecule (300) comprising a first group (310) able to absorb at least part of the blue light component, and a second group (320) able to emit luminescent molecule light having a red light component, wherein the first group (310) is configured to transfer at least part of the energy acquired by the absorption of said blue light component to the second group (320) for generation of said luminescent molecule light having a red light component.
US10514150B2
A reflector assembly for a solid-state luminaire is disclosed. The disclosed reflector assembly may be configured, in accordance with some embodiments, to be disposed over a given printed circuit board (PCB) of a host luminaire such that emissions of emitters populated over that PCB are reflected out of the luminaire via the reflector assembly. In some embodiments, the reflector assembly may be formed from one or more reflective members, which may be generally bar-shaped or cup-shaped, or other example configurations. In some other embodiments, the reflector assembly may be formed from a bulk body having one or more reflective cavities formed therein. The particular configuration of a given reflective member or reflective cavity, as the case may be, of the reflector assembly, as well as the particular arrangement thereof for a host luminaire, may be customized as desired for a given target application or end-use.
US10514149B2
A luminaire assembly includes: a substrate extending along a first direction comprising a first material having a first coefficient of thermal expansion; a plurality of light emitting elements (LEEs) secured to the substrate and arranged along the first direction; a light guide composed of a material having a second coefficient of thermal expansion different over an operating temperature range; a plurality of optical elements arranged along the first direction, each optical element being positioned to receive light emitted from a corresponding one or more of the LEEs and to direct the light to an edge of the light guide; a housing; and a heat coupling layer arranged between the substrate and the housing. The substrate and the heat coupling layer are constructed so that each of the plurality of LEEs, while secured to the substrate, remain registered with their corresponding optical element over the operating temperature range.
US10514144B2
A vehicle lamp includes a first reflector which reflects light emitted from a first light source to form a low-beam light distribution pattern, a second reflector which reflects light emitted from a second light source to form a high-beam additional light distribution pattern and includes a short distance reflecting surface provided at a closer position and a long distance reflecting surface provided at a farther position with respect to the second light source at a predetermined interval therebetween, a third light source which is arranged in front of the second reflector and turned on in a low-beam lighting mode, and a third reflector which is arranged in a gap between the short distance reflecting surface and the long distance reflecting surface and reflects light emitted from the third light source.
US10514142B2
A flash light source device includes: a flash lamp; a wiring board that is provided with a circuit configured to cause the flash lamp to emit light; a housing that is formed of a conductive material and accommodates the flash lamp and the wiring board; and an electromagnetic shield cable that includes a wire directly connected to the wiring board, an electromagnetic shield layer that covers the wire, and an insulating protective layer that covers the electromagnetic shield layer, and extends to the inside and outside of the housing through an opening formed in the housing. The electromagnetic shield layer is exposed at least at a part corresponding to the opening. The part corresponding to the opening in the electromagnetic shield layer is electrically connected to a part defining the opening in the housing.
US10514138B2
A light placement system includes a mounting strip including an illuminating device. The light placement system also includes a clip that is attached to a surface of an object and holds the mounting strip to illuminate an area of the object. The surface is an internal surface that is not visible from an external appearance of the object.
US10514129B2
A commercial hybrid tank includes a metal liner with an upper wall and a lower wall. The upper wall and the lower wall define a cavity therebetween. A weld joint joins the upper and lower walls together. A fiber winding layer is wrapped around an outer surface of the metal liner. A method for manufacturing a commercial hybrid tank includes overlapping surfaces of an upper wall and a lower wall to form a metal liner defining a cavity. The method includes joining the surface of the upper wall and the surface of the lower wall together by welding to form a weld joint between the upper wall and the lower wall. The method includes wrapping the metal liner with a fiber winding layer around an outer surface of the metal liner to form a hybrid tank.
US10514128B2
A drive gear assembly for a roll that is detachably supported in a machine body, the assembly comprising a drive gear mounted for a rotation about a stationary axis in the machine body, a driven gear mounted on an end portion of the roller, and a bearing formed in the machine body for supporting said end portion in an operative position in which the drive gear meshes with the driven gear, the assembly further comprising by a safety cover that is pivotally supported on the machine body to be movable between an active position in which it covers at least a part of the periphery of the driven gear, except a portion where the drive gear meshes with the driven gear, and an open position in which it permits an insertion of the end portion of the roll into the bearing, the cover being elastically biased into the open position and having an engagement surface arranged to be engaged by at least one of the roll and the driven gear for holding the cover in the active position as long as the roll is in the operative position.
US10514126B2
An ergonomically designed space saving, collapsible multi-function travel-friendly modular workstation for supporting a broad range of electronic systems, reading materials and the like for users while standing, sitting or on-the-go, and fits in anywhere, anytime is presented. The workstation comprises a support unit, telescopic rod and tripod and is designed to provide needed cooling and ventilation for electronic systems, support healthy postures, and complete comfort and versatility of a multi-function workstation with all the important things needed when working at a desk, thereby improving a user's comfort when using the workstation. Further, the workstation is designed for easy transportation, storage and set up, as well as provide a versatile workspace for a user in many different environments, for everyday use such as note taking, writing, reading, presentations, performing arts and rehearsing while playing a musical instrument, music or conductor stand, etc.
US10514125B1
An underground pipe repair device is for a joint between a service pipe and a branch pipe. The underground pipe repair device may include a T-shaped joint liner having a base portion extending laterally in the service pipe, and an arm portion extending vertically into the branch pipe, and a retention device embedded in the base portion adjacent an opening in the branch pipe. The underground pipe repair device may include an alignment device to be coupled to the retention device, and a service pipe liner extending in the service pipe and under the T-shaped joint liner and the alignment device. The alignment device extending vertically into the service pipe so that the service pipe liner has a radial bump about the opening in the branch pipe.
US10514118B2
A pipe flange (10) comprising: a circular flange plate (12) having a central (hub 14) for attaching the flange plate (12) to an end of a pipe (16), the hub (14) having a first annular portion (18) with a first inside diameter adapted to closely receive the outside diameter of the end of the pipe (16) therein. The pipe flange (12) also comprises a second annular portion formed by an annular lip (20) with a second inside diameter substantially equal to or greater than the inside diameter of the end of the pipe wherein, in use, a weld can be applied around the inside circumference of the hub (14) between the annular lip (20) and the end of the pipe.
US10514116B2
A pipe connection for conducting a fluid that is under pressure is provided, having two tubular connection parts for a conical clamping connection, which are screwed together by a union nut while one is inserted in the other, wherein each connection part has a conical sealing surface that contacts the other in a sealing manner and wherein an annular groove is provided in one of the sealing surfaces. In order to enable the pipe connection also to conduct a fluid having cycling or varying temperature, the inner of the two connection parts has thermal insulation on the inside of the pipe at least in the axial segment of the sealing surface of the connection part, wherein the thermal insulation tube has a cam or a collar on the outer surface, which engages in a recess, which is axially bounded by the two connection parts.
US10514106B2
A valve assembly for operation within a valve body of a pump includes an axial centerline, a poppet guide having a stem, and a poppet slidingly coupled to the poppet guide so that the poppet and the poppet guide define an internal cavity. The valve assembly also includes a flexible poppet guide mounting system coupled to the poppet guide and the poppet and includes a variable-area flow restrictor in fluid communication with the internal cavity. The flexible poppet guide mounting system is configured to support the poppet guide and the poppet for lateral and axial movement of the poppet guide and the poppet relative to the axial centerline. The poppet is movable relative to the poppet guide to adjust the volume of the internal cavity.
US10514101B2
A seal for insertion in a bore in an outer member and engaging an inner member received in the bore. The seal includes an annular insert having an elastomeric body over-molded on the annular insert and an inner seal extending radially inward from the annular insert. The inner seal including an inboard sealing surface and the elastomeric body over-molded on the annular insert defining an outer portion including an outboard sealing surface including an annular flap on an exterior side of the annular insert that, in an installed position, is adapted to be compressed between the outer annular insert and the outer member.
US10514095B2
A control device for a continuously variable transmission mechanism of a vehicle includes: a stepwise variable transmission mechanism which is disposed in series with the continuously variable transmission mechanism, and which has at least two or more forward gear stages; and a controller configured to increase the belt capacities to be greater than the belt capacity set when an accelerator opening degree is zero, at least in a time period from a timing when the accelerator opening degree becomes zero, to a timing when a braking force is generated by a depression of a brake pedal, the controller being configured to set an increase amount with respect to the belt capacity set when the accelerator opening degree is zero, to a smaller value as a transmission gear ratio of the stepwise variable transmission mechanism is higher.
US10514092B2
A transmission position sensor body assembly configured to be securely attached to a transmission housing includes a sensor body housing, a cap member and compression limiters. The sensor body housing has a central rim and a pair of outer receiving lobes that define a corresponding pair of bores. The cap member has a central body portion including integrally formed outer ears extending therefrom. The cam member is coupled to the sensor body. The compression limiters are coupled to the cap member at the respective outer ears and that extend through the bores of the sensor body housing. Fasteners are received through respective compression limiters. Clamping forces are transferred onto the cap member during the tightening of the fasteners to the transmission housing without acting on the sensor body housing.
US10514089B2
An auxiliary oil pump system for a gearbox, comprising: an auxiliary battery; a controller electrically connected to the auxiliary battery; and an auxiliary oil pump driven by the controller using a self-adaptive process, wherein the self-adaptive process comprises: the controller receives current operational pressure signal and compared the current operational pressure signal to a pressure threshold; if the current operational pressure signal is bigger than the pressure threshold, the auxiliary oil pump keeps current rotational speed; if the current operational pressure signal is smaller than the pressure threshold, the auxiliary oil pump improves the rotational speed by a pre-determined speed.
US10514085B2
A cam chain tensioner device of an internal combustion engine includes a cam chain tensioner, and a tensioner lifter pressing the cam chain tensioner to a cam chain. The tensioner lifter is mounted on an inclined upper surface of the cylinder head. The cylinder head has therein a valve train oil supply passage supplying oil from an oil pump to the valve train camshafts, and a tensioner lifter oil supply passage supplying oil to the tensioner lifter. The valve gear oil supply passage has a branching portion where the tensioner lifter oil supply passage branches. The branching portion is at a position higher than the tensioner lifter, and communicates with the tensioner lifter disposed at a position lower than the branching portion. It is thus possible to prevent fluttering of the cam chain and to reduce noise generated by the cam chain at the time of restart of the engine after it is stopped.
US10514082B2
The present disclosure relates to a flywheel system (1), comprising a ring-shaped flywheel rotor (3), arranged on a rotation axis (7); and a substantially cylindrical casing (2), enveloping the flywheel rotor (3) at least in a radial direction to contain the flywheel (3) in case of a calamity. The flywheel system (1) further exhibits the feature that the casing (2) comprises and having at least one inward protruding bumper (8) defining a variation from the circular shape in cross section of the casing wall (5) surrounding the flywheel rotor (3). The casing wall (5) may itself be circular and the bumper (8) can define a deviation relative to the circular shape thereof, to enhance deceleration of the flywheel rotor (3), if, in case of an accident or calamity, the flywheel rotor (3) comes loose.
US10514076B2
A shock absorber includes an upper vibration damping sheet and a lower vibration damping sheet. Multiple first vibration dampers and a second vibration damper are located between the upper vibration damping sheet and the lower vibration damping sheet; the first vibration dampers are close to an edge of both the upper vibration damping sheet and the lower vibration damping sheet. One end of the second vibration damper is located on the lower vibration damping sheet and is far away from the edge of the lower vibration damping sheet, the other end of the second vibration damper extends towards the upper vibration damping sheet along an axial direction of the lower vibration damping sheet, whereby when a carrier moves, the shock absorber provides a damping effect for a gimbal through the first vibration dampers and the second vibration damper. An aircraft includes the shock absorber mentioned above and a gimbal.
US10514074B2
A vehicle disc brake apparatus is adapted for use with a vehicle including a brake disc and includes a bracket configured to be fixed to the vehicle, a caliper body coupled to the bracket and pivotal about a pivotal axis that extends in a front-rear direction of the vehicle, a brake cylinder device that generates braking force, and two levers arranged on the caliper body. The levers transmit the braking force to the brake disc of the vehicle. The bracket and the caliper body are coupled at a position located toward the brake disc from the brake cylinder device.
US10514071B2
A torque transmitting assembly including a first drum having a plurality of teeth formed at an end thereof. A gear assembly axially aligns with the first drum and has a plurality of teeth intermeshing with the plurality of teeth of the drum. The gear assembly includes an annular gear and a plate axially aligning with the gear.
US10514066B2
A centrifugal separator includes a frame and a drive member configured to rotate a rotating part in relation to the frame around an axis of rotation. The rotating part includes a centrifuge rotor enclosing a separation space. The centrifuge rotor is adjoined to a hollow spindle supported by the frame by at least one bearing device. The interior of the hollow spindle is in thermal contact with the at least one bearing device and further includes a thermal transfer medium inlet for supplying a thermal transfer medium to said interior and a thermal transfer medium outlet for withdrawing the thermal transfer medium from the interior; and directing mechanism for directing thermal transfer medium from the thermal transfer medium inlet to the thermal transfer medium outlet in a first direction along the length of the spindle and in a second direction along the length of the spindle. The second direction is opposite the first direction. The first or second direction is along the inner wall of the interior of the spindle, the inner wall being arranged to rotate during operation of the centrifugal separator.
US10514056B2
Fasteners are disclosed herein which resist loosening even when used in applications and environments where the fastener is exposed to vibration. In one form, a two piece fastener is used for connecting multiple workpieces. In another form, a simplified fastener is disclosed for quickly and easily connecting items. In yet another form, a plug type fastener is disclosed. Other fasteners and related methods are also disclosed herein.
US10514043B2
A centrifugal fan comprises a casing and a fan impeller. The casing comprises a first cover, a second cover, a side wall structure and a isolating structure. The side wall structure is connected between the first cover and the second cover to form an accommodating space. The side wall structure includes a first air inlet and an air outlet. The isolating structure is disposed between the first cover and the second cover to distinguish the accommodating space into a first subspace and a second subspace. The isolating structure includes a through hole. As a result, airflow is guided from a side to the first air inlet easily. Then, the air inlet volume and air outlet volume of the centrifugal fan are improved.
US10514042B2
A pump features an impeller having a rotating disk with a front side and a back side. The impeller is arranged to rotate on a shaft with the front side nearest an inlet and the back side nearest a motor housing, so as to provide a main flow of liquid being pumped and a rear impeller flow of the liquid being pumped in an area between the back side of the impeller and the motor housing. The back side has a spiral-shaped vane configured to constantly sweep, and expel any debris from the area between the back side of the impeller and the motor housing. The spiral-shaped vane is formed as a curve that emanates from a central point defined by an axis of the impeller and gets progressively farther away as the curve revolves at least one complete revolution around the central point or axis.
US10514039B2
In a hydraulic control device, when the rotational speed of an electric motor is an appropriate rotational speed, a first spool is in a first position, in which communication between a sixth port and a second port is blocked. When the rotational speed of the electric motor exceeds the appropriate rotational speed, the first spool is in a second position, in which the sixth port and the second port are placed in communication.
US10514035B2
A pump is provided. The pump includes a fluid inlet section; a fluid outlet section; a stator axially between the fluid inlet section and the fluid outlet section; a rotor axially between the fluid inlet section and the fluid outlet section, the rotor and the stator defining a fluid flow space radially therebetween; a movable inlet guide configured for guiding fluid flow from the fluid inlet section into the fluid flow space; and a movable outlet guide configured for guiding fluid flow from the fluid flow space into the fluid outlet section. The rotor is rotatable inside of the stator by electromagnetic forces urging the rotor towards the stator. Rotation of the rotor inside of the stator and movement of the inlet guide and the outlet guide create a pressure in a first portion of the fluid flow space that forces fluid from the fluid flow space through the fluid outlet section and create a vacuum in a second portion of the fluid flow space that pulls fluid from the fluid inlet section into the fluid flow space. A method of forming a pump is also provided.
US10514030B2
A wear sleeve is removably mounted on a piston rod. The piston rod includes a piston cap, a piston rod body, and a piston head, with at least one of the piston cap and the piston head being removable from the piston rod body. The wear sleeve is disposed over the piston rod body and prevents the piston rod from contacting dynamic seals disposed within a pump. The wear sleeve is mechanically secured in a cylindrical recess on the piston rod between a cap shoulder of the piston cap and a head shoulder of the piston head.
US10514026B2
An object of the present invention is to provide a fluid compression system which can supply compressed fluid in accordance with a sudden change in an amount of fluid used even when the number of compressors to be installed is increased, and a control device thereof.In order to solve the problem, provided is a fluid compression system, including: a plurality of compression devices which compress fluid; and a number of device controller which controls the number of operating compression devices of the plurality of compression devices, in which at least one of the plurality of compression devices is configured of a plurality of compressor main bodies, and performs a volume control operation which changes the number of operating compression devices in accordance with an amount of compressed fluid used, or a fixed control operation which does not change an output during the operation regardless of the amount of the compressed fluid used, and the number of device controller switches a state where the plurality of compression devices perform the volume control operation and a state where the compression devices perform the fixed control operation.
US10514025B2
A preheater for a compressor that is capable of heating a lubricant oil efficiently with smaller power is provided. A preheater for a compressor includes: a capacitive oil surface sensor that is provided at a compressor used in a refrigerating cycle, and detects an oil surface of a lubricant oil A in the compressor; and a power supply unit that applies high-frequency voltage to the oil surface sensor.
US10514024B1
A detachment system for a delivery aerial drone is disclosed. The detachment system uses a pump to apply a negative pressure to a suction cup for attaching an object to be delivered. The weight of the object is coupled to a mechanical switch, such that setting down the object opens the switch and disconnects the pump. Once the pump is disconnected from its power source, the suction is removed and the object disconnects from the vacuum system. The weight of the object is coupled to a mechanical switch, such that setting down the object opens the switch and disconnects the pump. Thus, the object releases once it is gently placed on a surface such that its weight is removed from the drone.
US10514017B2
An internal combustion engine including an igniter disposed at least partially within an aperture defined in a housing of the engine, the igniter having a body including a tip supporting portion and having a tip extending from the tip supporting portion. A cooling sleeve is disposed around the tip supporting portion, and the cooling sleeve defines a path of heat transfer between the tip supporting portion and the housing. The engine may be a rotary engine. A method for cooling an igniter of an internal combustion engine is also discussed.
US10514004B2
A cascade assembly of a nacelle for a turbofan engine includes a one-piece cascade fixed to a translating sleeve constructed and arranged to move between forward and aft positions along a centerline. A hook device of the cascade assembly includes a first catch fixed to a stationary structure and a second catch fixed to the one-piece cascade. The first catch is adapted to mate with the second catch for translating load when the cascade assembly is in a deployed state and the translating sleeve is in the aft position.
US10514003B2
An exhaust duct for a gas turbine engine has an annular inlet conduit having an inlet axis. At least two outlet conduits branch off from the inlet conduit along respective outlet centerlines that are distinct from one another. The outlet centerlines when projected onto a projection plane perpendicular to the inlet axis are spaced apart from the inlet axis so as not to intersect the inlet axis.
US10513999B2
An engine controller according to one aspect of the invention is applied to a cylinder injection engine including a fuel injection valve that directly injects fuel into a cylinder. The engine controller determines whether knocking is occurring based on a signal from a knocking sensor. When the knocking is occurring, the engine controller performs partial lift fuel injection at a predetermined timing close to an ignition timing. The partial lift fuel injection is performed with a lift amount of a valve body of the fuel injection valve limited within a range between a minimum lift amount (0) and a partial lift amount, which is smaller than a maximum lift amount.
US10513993B2
An intake pressure sensor is provided in an intake path of a single cylinder engine and detects an intake pressure. A crank angle sensor detects a crank angle of the single cylinder engine. A sampling unit samples the intake pressure detected by the intake pressure sensor when the crank angle detected by the crank angle sensor becomes a sampling start angle. A calculation unit extracts M intake pressures of relatively small values of N intake pressures sampled by the sampling unit. The calculation unit acquires, as a bottom pressure, an average value of P intake pressures remaining after several intake pressures of relatively large values and several intake pressures of relatively small values of the M intake pressures are excluded.
US10513990B2
A PCM (100) selects one of a CI mode or an SI mode based on the operating conditions of the engine (1). In the CI mode, the engine (1) is operated by compression ignition combustion. In the SI mode, the engine (1) is operated by spark ignition combustion. if, while the engine (1) is being operated in the CI mode, a determination is made that an estimated value (Tc) of the catalyst temperature is lower than or equal to a warming start temperature (Ts), the PCM (100) further performs first warming control to assign four cylinders (18) as CI and SI cylinders, which perform the compression ignition combustion and the spark ignition combustion, respectively, such that the four cylinders (18) alternately perform the compression ignition combustion and the spark ignition combustion in accordance with the order of combustion of the cylinders.
US10513989B2
A controller of an internal combustion engine receives a request to activate an exhaust brake subsystem and, in response thereto, activates the exhaust braking subsystem. The controller thereafter determines that at least one parameter of the exhaust system, an intake subsystem or both compares unfavorably with at least one threshold. When the at least one parameter compares unfavorably with the at least one threshold, the controller determines that the exhaust braking subsystem has failed. In embodiments, the determination that the at least one parameter compares unfavorably with the at least one threshold comprises a determination that backpressure in the exhaust system is lower than a backpressure threshold and/or a determination that boost pressure in the intake subsystem is higher than a threshold.
US10513988B2
A turbomachine fuel circuit including: a low pressure pump; a high pressure pump; a low pressure conduit connecting the low pressure pump to the high pressure pump; a high pressure conduit supplied by the high pressure pump, in which a component is arranged; a mechanism for testing operation of the component; a check valve capable of closing off a segment of the conduit when the pressure in the low pressure conduit is less than a predetermined threshold value; and the testing mechanism is capable of detecting that the check valve at least partly closes off the segment.
US10513986B2
A turbine engine is described that includes a drive shaft and an electric generator comprising a first rotating element comprising a magnet array, wherein the first rotating element is configured to rotate in a first direction based on a rotation of the drive shaft. The turbine engine further includes a second rotating element comprising a coil array, wherein the second rotating element is configured to rotate in a second direction based on the rotation of the drive shaft, wherein the second direction is opposite to the first direction.
US10513985B2
The described gas turbine engine includes a fire mitigation system in fluid system thereof, and includes an air-introduction component located in a fluid conveying conduit upstream of a liquid pump of the fluid system. The air-introduction component has a sacrificial element which remains in place during normal operation of the gas turbine engine but has a heat-induced failure point lower than that of a remainder of the fluid conveying conduit such that it fails when exposed to a threshold temperature greater than the heat-induced failure point. Failure of the sacrificial element allows air introduction into the fluid conveying conduit upstream of the liquid pump, thereby starving the liquid pump in the event of a fire condition generating the threshold temperature.
US10513967B2
Methods and systems are providing for improving engine coolant level estimation to reduce engine overheating. The level of fluid in a coolant overflow reservoir is inferred based on the fluid level in a hollow vertical standpipe fluidically coupled to the reservoir at top and bottom locations, while the fluid level in the standpipe is estimated based on echo times of an ultrasonic signal transmitted by a sensor positioned in a recess at the bottom of the vertical standpipe. Sensor output is compensated with a term based on vehicle motion parameters to compensate for fluid level distortion due to motion-induced slosh.
US10513959B2
A device for providing a liquid additive, including at least one metallic insert, which is coated, at least in sections, with a plastic coating made of polyethylene (PE). At least one plastic structure made of a high-density polyethylene (HD-PE) or polypropylene (PP) is sprayed onto the plastic coating.
US10513949B2
A fluid circulation system may comprise a main pump configured to provide oil to a journal bearing. An auxiliary system including a pump system may be configured to provide oil to the journal bearing. A manifold may be configured to mix the oil from the main pump with oil from the auxiliary system. A journal delivery line may be configured to deliver the oil from the manifold to the journal bearing.
US10513945B2
An annular air flow passage includes two radially internal and external annular walls. An element is elongated in a direction between the internal and external annular walls and a first of the internal or external ends of the element is fixed rigidly to a first of the internal or external walls. The center of gravity position of the element is variable.
US10513932B2
A turbine engine airfoil includes a first surface to be cooled by a flow of cooling air. The first surface includes a pedestal array and a first row of contour bumps. The pedestal array includes first and second rows of pedestals extending from the first surface. The second row of pedestals runs in a direction generally parallel to the first row of pedestals. The first row of contour bumps extends from the first surface between the first row of pedestals and the second row of pedestals and runs parallel to the first row of pedestals. The first row of contour bumps is aligned such that at least one of the contour bumps of the first row of contour bumps is positioned at least one of immediately downstream of a pedestal of the first row of pedestals and immediately upstream of a pedestal of the second row of pedestals.
US10513930B2
A system and methods are provided for pre-stressing blade elements for a gas turbine engine. In one embodiment, a method includes rotating a blade element relative to an axis. The method may also include controlling rotational speed of the blade element to generate residual stress in the blade element. The method may also include rotating multiple blade elements and fan blade units to generate residual stress. Blade elements may be rotated to exceed a maximum operating speed of the blade element to 120% of the maximum operating speed of the blade element.
US10513912B2
A machine includes a spindle for storing wire, a wire passage structure having an interface coupline, a controllable drive system, a control system, and a pressure-resistant housing. The drive system is configured to feed the wire through the wire passage structure and through the interface coupling, under the control of the control system. The housing encloses the wire passage structure, the controllable drive system, and at least a portion of the control system.
US10513897B1
A gas-separator for separating trapped gases from drilling fluids retrieved from a well-bore being drilled is disclosed. The gas-separator includes a barrel separator which rotates on its longitudinal axis when pressurized drilling fluid flows out through its fluid ejection ports. Ejection of fluids from the fluid ejection ports induces rotation of the barrel separator which helps separate gases from the fluid. After separation, the gases travel out from the upper sub and to the surface, up the well-bore. The treated and gas-cleansed fluid travels downstream to the drill string and any downstream equipment, including pumps, motors, and drill bits, or; treated and gas-cleansed fluid may flow to the surface directly after treatment in the gas-separator.
US10513893B2
A joint connects casing sections of a casing string for transporting fluids and/or gases. The joint includes a first longitudinal part arranged to be at least partly overlapping a second longitudinal part or a casing section. The first longitudinal part is connected with the second longitudinal part or with the casing sections in a mounted state with the first longitudinal part adapted to move axially relative to the second longitudinal part or the casing sections in an operative state. The joint includes at least one shear member with a predefined shear value and the shear member is adapted to shear when an axial force exceeding the total shear value of the shear member is exerted, allowing a relative axial movement between the first longitudinal part and the second longitudinal part or the casing sections.
US10513892B2
Adjustment of the angle of a bent sub or other steering feature in a drill string relative to a reference angle of a downhole sensor is facilitated by a rotatable coupling between the bent sub and the sensor. The rotatable coupling may be rotated to align the high side with a reference indicium and locked at the set angle. Rows of ceramic balls retained in circumferential channels may be provided to permit rotation while carrying tensile and compressional forces. Calibration of the sensor is facilitated and opportunities for certain measurement errors are eliminated. An embodiment provides a mechanism for locking the rotatable coupling at a desired angle. The embodiment comprises a ring with teeth that engage a downhole portion of the coupling and depressions that engage an uphole portion of the coupling.
US10513891B2
A downhole coupling system for joining together two segments of a tool string includes two mandrels, each having an interlocking interface at an end that abuts the adjacent mandrel and to communicate torque from one mandrel to the next. Each of the mandrels includes a threaded exterior surface, with the threaded surfaces have opposing thread directions or differing thread pitches. The coupling includes mating internal threads. A plurality of axial grooves is formed in each of the interior surface of the coupling and the exterior surface of one of the mandrels. A keyed latch ring having a plurality of internal keys and a plurality of external keys is included to engage the axial grooves, thereby rotationally locking the coupling relative to the first mandrel and second mandrel.
US10513885B2
An involute gear is disclosed. A circular base has a surface that includes an inner region and an outer region. A gear tooth extends outward from the outer region of the surface. A shape of the gear tooth is defined by a varying cross-sectional involute profile. Starting from a first involute profile that is in a plane parallel to the surface of the circular base and extending outward from a center of the circular base, each location on the first involute profile is rotated about a corresponding axis while traversing a path defined by a corresponding imaginary ray extending from the center of the circular base to that location in the first involute profile. The corresponding axis is tangential to an imaginary circle that encompasses the inner region of the surface and is perpendicular to the corresponding imaginary ray.
US10513872B2
A latch assembly that is adjustable between first and second backset settings. A cam is rotatable about a cam axis, and facilitates linear displacement of a latch link in a first direction. A multiplier link is rotatable about a multiplier link axis that is offset from the cam axis can be rotated in the first rotational direction by engagement with the latch link. A latch bar is coupled to the multiplier link and is linearly displaced in a second direction by rotation of the multiplier link in the first direction. The latch apparatus also includes a latch bolt that is coupled to the latch bar, the latch bolt being displaced toward a retracted position by the displacement of the latch bar in the second direction. The latch assembly can also include a dead latch link can block retraction of at least the latch bolt.
US10513869B2
The present invention comprises a brace adapted to secure a fence rail to a fence post. The present invention brace may optionally be installed onto an existing fence or on a new fence. The invention includes a first fence rail brace member adapted to connect to two or more sides of a first fence rail, a second fence rail brace member adapted to connect to two or more sides of a second fence rail, and a fence post member adapted to connect to two or more sides of a fence post. The fence post brace member may form a vertical picket fastener slot, the first fence rail brace member may form a first horizontal picket fastener slot, and the second fence rail brace member may form a second horizontal picket fastener slot.
US10513866B2
The present invention refers to a wind turbine tower and a respective foundation base, comprising a central column with a central column foundation, upper tensile structural elements with upper ends attached to a tensile structure element bearing portion of the central column and tensile structural element foundations around the central column foundation. The structural system is characterized in that each lower end of the upper tensile structural elements is attached to a respective compressive structural element that connects said lower end of the respective upper tensile structural element with a compressive structural element bearing portion of the central column and that each lower end of the upper tensile structural elements is attached to a respective lower tensile structural element that connects said lower end of the respective upper tensile structural element with one of the tensile structural element foundations.
US10513865B2
A shelter for an automobile has a pair of tracks positioned on opposing sides of the automobile and rest on a supporting surface such as the floor of a garage or car-port. A plurality of frames each having a u-shaped contour extend on opposing sides and over the automobile and are spaced apart from it. The terminal ends the frames are engaged with trucks which are in rolling engagement with the tracks. A canopy of a flexible material is attached over the frames and is movable between a folded state and an unfolded state when the trucks are moved within the tracks. The tracks have mutually orthogonal roller contact surfaces and the trucks have mutually orthogonal rollers positioned for rolling on the roller contact surfaces of said tracks. The canopy is able to be withdrawn from either of opposing sides and is further able to be drawn over the automobile to the supporting surface at both opposing sides.
US10513861B2
There is provided a modular auditorium including a base portion and a plurality of tier sections assembled to the base portion. Each tier section includes a longitudinal beam, and a first floor portion and a second floor portion cantilevered from opposed regions of the longitudinal beam.
US10513860B2
The wire twisting pliers include a reversible transformation device including a casing, a double helix pin, separate right-hand and left-hand guiding elements, housed in a single drum and radially movable between a drive position in which one is directly and forcefully engaged in said right-hand or left-hand helix and couples said casing to said drum, the other is free to retract from said right-hand or left-hand helix, said casing being movable between right- and left-hand positions in which said right-hand and left-hand guiding elements are respectively in the drive position of same, free or vice versa. A reversible wire twisting pliers including such a transformation device.
US10513857B2
A device for leveling and aligning tiles and method for leveling and aligning tiles are disclosed. In one embodiment, the leveling device includes a body and two spaced and parallel strip members extending transversely from the body. Each of the spaced and parallel strip members extend to the front and rear of the body. Two opposing lateral open windows are formed in the body. A breakaway section is defined along the body. A wedge device is provided for penetrating one or more of the two opposing lateral open windows and exerting a force on the tiles for leveling them relative to each other.
US10513845B1
An adjustable barrier for use with a building having a door frame with a door frame opening, a track assembly, and a garage door positioned between the track assembly to selectively cover the door frame opening, the adjustable barrier comprising a barrier bracket and an extendable barrier panel. The adjustable barrier is adapted to seal off a garage door gap located between the garage door and the door frame, and is positioned between the door frame and the track to create a barrier preventing a pest from bypassing the garage door and entering the building through the garage door gap. The extendable barrier panel selectively extends and retracts to adjust to the distance between the track and the door frame, and may further be tapered to allow the adjustable barrier to maintain contact with the track when the track curves away from the door frame.
US10513841B1
A sink strainer assembly for attachment to a clamping ring of a sink waste valve assembly comprising a strainer sized to fit within and be attachable to the clamping ring by a locking bar attachable to the clamping ring and at least one or more screws affixing the strainer to the locking bar, the improvement to which comprises (a) the strainer comprising a cylindrical body having top and bottom surfaces provided with passageways extending from the top surface and extending through the bottom surface to permit fluids to pass through the strainer, a channel cut in the bottom surface and having a post cavity of greater depth than the channel, a screw passageway extending from the bottom of the post cavity through the top surface of the strainer body; (b) the locking bar comprising an elongated slat member having a width greater than the depth of the channel and a length sized to fit in the channel, the slat having a post member sized to fit into the post cavity, the post member having an axial passageway formed by a threaded interior wall and positioned on the slat member to be aligned to the screw passageway when the locking bar is positioned in the channel, the slat having its opposing end sections forming a shoulder extendable beneath the clamping ring lower rim when the strainer is positioned in the clamping ring; and (c) a screw sized and shaped to fit into the screw passageway and be operatively engaged with the threaded interior wall of the post member.
US10513835B2
A layered material configured for assembly of a base mat containment system is provided. The layered material includes: a first layer affixed to a barrier layer, a second layer affixed to the barrier layer, the second layer including a plurality of peaks and valleys. The base mat includes a high-strength material. A method of fabrication and a base mat containment system are disclosed.
US10513832B2
A piling hammer is disclosed. The piling hammer includes a sleeve for securely fitting around a top end of a piling, a hammer located on top of the sleeve, a first and second pneumatic cylinder secured to the sleeve and hammer, a first and second valve pneumatically coupled to the first and second pneumatic cylinders, and a pneumatic controller configured for detecting that the hammer is at a bottom position, activating the first and second valves to route pressurized gas from the pressurized gas source to the first and second pneumatic cylinders, thereby causing the hammer to rise upwards, detecting that the hammer is at a top position, activating the first and second valves to expel pressurized gas from the first and second pneumatic cylinders, thereby causing the hammer to strike the sleeve and drive the piling downwards.
US10513831B2
Extensible shells and related methods for constructing a support pier are disclosed. An extensible shell can define an interior for holding granular construction material and define a first opening at a first end for receiving the granular construction material into the interior and a second opening at a second end. The extensible shell can be flexible such that the shell expands when granular construction material is compacted in the interior of the shell. A method may include positioning the extensible shell in the ground and filling at least a portion of the interior of the shell with the granular construction material. The granular construction material may be compacted in the interior of the extensible shell to form a support pier.
US10513829B2
An edge stabilization assembly for inclined surfaces having a synthetic tuft assembly; a water-permeable polymer mesh connected on one side of the synthetic tuft assembly, and a tuft-free non-permeable woven polymer mat connected on the other side of the synthetic tuft assembly, and a plurality of fasteners.
US10513828B2
A composition for sizing paper includes alkenylsuccinic anhydride (ASA) as the sizing agent and an emulsifier system of anionic emulsifiers and nonionic components, wherein the anionic emulsifiers are chosen from alkali metal salts of aliphatic carboxylic acids or aliphatic dicarboxylic acids and the nonionic components are chosen from polyethylene glycols.
US10513807B2
A knitting machine capable of changing a pile length includes a low-pile sinker and a high-pile sinker, a low-pile selector jack arranged on the rear end side of the low-pile sinker, a high-pile selector jack arranged on the rear end side of the high-pile sinker, an actuator operable to, when a pile yarn and a ground yarn are drawn in by a knitting needle, selectively perform the first control in which the actuator acts on the low-pile selector jack, the second control in which the actuator acts on the high-pile selector jack, and the third control in which the actuator does not act on any of the low-pile and high-pile selector jacks, and a cam operable to push out the selector jack subjected to the action of the actuator and the sinker which is in contact with the selector jack to an area between the knitting needles.
US10513798B2
A method for determining a defect region of a silicon wafer which is sliced off from a silicon single crystal manufactured by a CZ method, the method including: (1) mirror-surface processing the silicon wafer in such a manner that a haze level of a surface thereof in haze measurement performed by a particle counter which uses a laser having a wavelength of 266 nm becomes 0.06 ppm or less; (2) measuring the number of defects and/or a defect density distribution on the mirror-surface-processed surface of the silicon wafer by using a particle counter capable of measuring defects having a size of 15 nm or less; and (3) determining the defect region of the silicon wafer from the measured number of the defects and/or defect density distribution.
US10513793B2
Oil well pipe component comprising a threaded portion, at least part whereof is coated with a layer of a corrosion-inhibiting material, that has been applied to at least the part of the threaded portion of the oil well pipe component by means of a method comprising a cataphoresis step from an aqueous bath, said method comprising—providing the oil well pipe component comprising a threaded portion; —immersing at least part of the threaded portion of the pipe component in a cataphoresis bath comprising water and suspended particles of corrosion-inhibiting material, and provided with an anode and a cathode means, the pipe component being connected to the cathode means; —inducing a current through the bath, in order to provide the corrosion-inhibiting material with a positive charge; —depositing a layer of the positively charged corrosion-inhibiting material onto the pipe component; and—removing the immersed part of the pipe component with the layer of corrosion-inhibiting material from the cataphoresis bath and allowing the corrosion-inhibiting material to set.
US10513792B2
The present disclosure provides for methods of phosphidation, catalysts formed from phosphidation, and methods of producing H2.
US10513787B2
An electrode for electrolysis includes a conductive substrate, a first layer formed on the conductive substrate, and a second layer formed on the first layer. The first layer contains at least one oxide selected from the group consisting of ruthenium oxide, iridium oxide, and titanium oxide. The second layer contains an alloy of platinum and palladium. The electrode for electrolysis shows low overvoltage and has excellent durability over a long period.
US10513771B2
A vaporizer body (1) having a vaporizing surface (3) for vaporizing metal in a PVD-metallization installation, wherein the vaporizing surface (3) comprises a plurality of recesses (5, 5′, 5″), with an opening of the respective recess having an area/perimeter-ratio of greater than or equal to 1.5 mm.
US10513770B2
Provided are a vapor deposition apparatus, a vapor deposition method, and a method of manufacturing an organic EL display apparatus which can prevent heat generation of a magnet chuck by using the magnet chuck that strongly attracts a deposition mask to dispose a substrate for vapor deposition and the deposition mask in proximity to each other during vapor deposition, while being less influenced by any magnetic field during alignment between the substrate for vapor deposition and the deposition mask. In the vapor deposition apparatus, a magnet chuck (3) includes a permanent magnet (3A) and an electromagnet (3B).
US10513769B2
The invention relates to the rare metal smelting field, and particularly, the present invention relates to a tantalum powder for preparing capacitors and a process for preparing the tantalum powder, and to a sintered anode prepared from the tantalum powder. As to the tantalum powder as provided by the invention, its primary tantalum powder has a BET of from 3.0 to 4.5 m2/g. After the secondary agglomeration, the tantalum powder has a large particle size. The tantalum powder has an average Fisher sub-sieve size (FSSS) of 1.2 to 3.0 μm wherein as measured with a standard sieve mesh, more than 75% of tantalum powder has a +325-mesh, and a particle size distribution D50 of more than 60 μm, that is, the secondary particle size is high. A resultant capacitor anode prepared by sintering the tantalum powder of the invention at 1200° C. for 20 minutes and then being energized at the voltage of 20 V has the specific capacitance of from 140,000 to 180,000 μFV/g and the residual current of less than 1.0 nA/μFV. Meantime, the invention provides an economical process for making the tantalum powder.
US10513768B2
A coinage cladding alloy for coinage includes nickel present in an amount from 5 wt. % to 7 wt. %, based on a total weight of the coinage cladding alloy; zinc present in an amount from 21 wt. % to 29 wt. %, based on the total weight of the coinage cladding alloy; manganese present in an amount from 12 wt. % to 16 wt. %, based on a total weight of the coinage cladding alloy; copper; an electrical conductivity from 2% International Annealed Copper Standard (IACS) to 3% IACS; and a color comprising a yellowness vector b* that is from 2 to 10, based on a CIE L*a*b* color space and determined in accordance with ASTM Standard E308-15 (2015).
US10513766B2
Provided are new high strength 6xxx aluminum alloys and methods of making aluminum sheets thereof. These aluminum sheets may be used to fabricate components which may replace steel in a variety of applications including the transportation industry. In some examples, the disclosed high strength 6xxx alloys can replace high strength steels with aluminum. In one example, steels having a yield strength below 340 MPa may be replaced with the disclosed 6xxx aluminum alloys without the need for major design modifications.
US10513765B2
Disclosed herein is stainless steel having excellent tensile strength, fatigue strength, oxidation resistance at high temperature environment. According to an exemplary embodiment of the present invention, the stainless steel having excellent oxidation resistance at high temperature includes C: 0.01 to 0.2%, Si: 0.1 to 1.0%, Mn: 0.1 to 2.0%, Cr: 12.0 to 30.0%, V: 0.01 to 0.5%, Nb: 0.01 to 0.5%, Al: 0.1 to 4.0%, Co: 0.01 to 5.0%, Mo: 0.01 to 4.0%, W: 0.01 to 4.0%, B: 0.001 to 0.15%, Ni: 5.0 to 20.0% as wt %, the balance Fe, and other inevitable impurities.
US10513754B2
A method for recovering thorium and rare earth elements from rare earth waste residues includes the steps of (1) mixing rare earth waste residues with an inorganic acid and heating to obtain a stock solution containing thorium and rare earth elements; (2) extracting thorium and rare earth elements from the stock solution with an organic phase containing an extractant; (3) washing the organic phase obtained after extraction in step (2) with a washing solution to move rare earth elements into the aqueous phase and leave thorium in the organic phase; (4) back-extracting the organic phase containing thorium obtained in step (3) with a back-extraction solution to extract move thorium in the organic phase into the aqueous phase. The extractant contains alkyl phosphonic acid monoalkyl ester and dialkylphosphinic acid.
US10513751B2
Integrated PGM converting process. The process includes smelting a catalyst material in a primary furnace, smelting the primary furnace slag in a secondary furnace, converting the collector alloys from the primary and secondary furnaces in a converter to recover PGM enriched alloy and converter slag, separating the recovered converter slag into first and second converter slag portions, and supplying the first converter slag portion to the secondary furnace for smelting with the primary furnace slag. The process can also include low- or no-flux converting; refractory protectant addition; magnetic slag separation; partial feed pre-oxidation; staged slagging; and/or jacketing the converter.
US10513750B2
The process includes melting an initial collector alloy charge to start a converter cycle, introducing feed and injecting oxygen into the alloy pool, allowing ferrous slag to collect, terminating feed introduction and oxygen injection to tap the slag, repeating the feed introduction/oxygen injection/slag tapping sequence a plurality of times, and then tapping the alloy to end the cycle. A delay before non-final slag tappings allows any entrained alloy to settle back into the alloy pool, but the final slag tapping is commenced promptly and alloy is optionally entrained. Slag from the final tapping that may contain entrained alloy can be recycled to the converter, e.g., in a subsequent cycle. The process can also include low- or no-flux converting; refractory protectant addition; slag separation; partial feed pre-oxidation; smelting the slag in a secondary furnace with primary furnace slag; and/or jacketing the converter.
US10513749B2
A hot-rolled steel sheet has predetermined chemical composition, a sum of a Si content and an Al content is higher than 0.20% and lower than 0.81%, a microstructure includes, by area fraction, 90% to 99% of a ferrite, 1% to 10% of a martensite, and a bainite limited to 5% or less, the grain size of the martensite is 1 to 10 μm, the X-ray random intensity ratio of a {211}<011> orientation which is parallel to a rolled surface of the steel sheet and is parallel to a rolling direction is 3.0 or less.
US10513748B2
In a method for manufacturing a component containing an iron alloy material, a pulverulent pre-alloy is provided. The pre-alloy comprises, in wt. %, 0.01 to 1% C, .0.01 to 30% Mn, ≤6% Al, and 0.05 to 6.0% Si, the remainder being Fe and usual contaminants. The pulverulent pre-alloy is mixed with at least one of elementary Ag powder, elementary Au powder, elementary Pd powder and elementary Pt powder so as to produce a powder mixture containing 0.1 to 20% of at least one of Ag, Au, Pd and Pt. The powder mixture is applied onto a carrier (16) by means of a powder application device (14). Electromagnetic or particle radiation is selectively irradiated onto the powder mixture applied onto the carrier (16) by means of an Irradiation device (18) so as to generate a component from the powder mixture by an additive layer construction method.
US10513744B2
The present invention relates to a marker associated with resistance to smut which is a quantitative trait of sugarcane. Specifically, a marker associated with resistance to sugarcane smut, which consists of a continuous nucleic acid region existing in a region sandwiched between the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence shown in SEQ ID NO: 14 or a different similar region, is provided.
US10513731B2
The invention provides modified nucleotide or nucleoside molecule comprising a purine or pyrimidine base and a ribose or deoxyribose sugar moiety having a removable 3′-OH blocking group covalently attached thereto, such that the 3′ carbon atom has attached a group of the structure —O—Z wherein Z is any of —C(R′)2-O—R″, —C(R′)2-N(R″)2, —C(R′)2-N(H)R″, —C(R′)2-S—R″ and —C(R′)2-F, wherein each R″ is or is part of a removable protecting group; each R′ is independently a hydrogen atom, an alkyl, substituted alkyl, arylalkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclic, acyl, cyano, alkoxy, aryloxy, heteroaryloxy or amido group, or a detectable label attached through a linking group; or (R′)2 represents an alkylidene group of formula ═C(R′″)2 wherein each R′″ may be the same or different and is selected from the group comprising hydrogen and halogen atoms and alkyl groups; and wherein said molecule may be reacted to yield an intermediate in which each R″ is exchanged for H or, where Z is —C(R′)2-F, the F is exchanged for OH, SH or NH2, preferably OH, which intermediate dissociates under aqueous conditions to afford a molecule with a free 3′OH; with the proviso that where Z is —C(R′)2-S—R″, both R′ groups are not H.
US10513728B2
Provided herein are products and processes for detecting the presence or absence of minor nucleic acid species in a sample containing a mixture of minor nucleic acid species and one or more major nucleic acid species, where the amount (frequency or copy number) of the minor nucleic acid species is less than that of the major nucleic acid species. Certain methods include amplifying the mixture and extending the resulting amplicons using chain terminating reagents and extension primers that specifically hybridize to the amplicons, where a chain terminating reagent specific for the major nucleic acid species has a concentration that is less than a chain terminating reagent that is specific for a minor nucleic acid species. Skewing the concentrations of the chain terminating reagents in favor of high concentrations of the chain terminating reagents specific for the minor nucleic acid species relative to a chain terminating reagent specific for a major nucleic acid species improves the detection limit (sensitivity) of detecting minor nucleic acid species present at low frequency or copy number in the mixture. In addition, the signals generated from the extension product of the major nucleic acid species amplicon can serve as a positive control and permit quantification of the minor nucleic acid species relative to the major nucleic acid species in the mixture.
US10513726B2
The present invention relates to the field of transcriptomics and provides a method for the controlled identification and/or quantification of transcript variants in samples, comprising providing a reference set of artificial polynucleic acid molecules simulating transcript variants and adding said reference set as external control to samples comprising transcript variants. The present invention further provides such a reference set, as well as a method to produce such a reference set.
US10513715B2
A process for producing a transportation fuel from a lignocellulosic feedstock comprising subjecting a stream comprising lignin to a wet oxidation that produces low molecular weight carboxylic acids. These carboxylic acids and/or the corresponding esters are fed to a hydrogenation reaction or gas fermentation wherein they are converted to an alcohol. Heat from the wet oxidation may be supplied to any stage of the process in which heat is introduced.
US10513711B2
Non-conventional yeasts are disclosed herein comprising at least one RNA-guided endonuclease (RGEN) comprising at least one RNA component that does not have a 5′-cap. This uncapped RNA component comprises a sequence complementary to a target site sequence in a chromosome or episome in the yeast. The RGEN can bind to, and optionally cleave, one or both DNA strands at the target site sequence. An example of an RGEN herein is a complex of a Cas9 protein with a guide RNA. A ribozyme is used in certain embodiments to provide an RNA component lacking a 5′-cap. Further disclosed are methods of genetic targeting in non-conventional yeast.
US10513706B2
A recombinantly expressed nucleotide triphosphate transporter efficiently imports the triphosphates of unnatural nucleotides into cells, and the endogenous cellular machinery incorporates those nucleotides into cellular nucleic acids. UBPs can therefore form within the cell's nucleic acids. Moreover, neither the presence of the unnatural triphosphates nor the replication of the UBP represents a significant growth burden. The UBP is not efficiently excised by nucleic acid repair pathways, and therefore can be retained as long as the unnatural triphosphates are available in the growth medium. Thus, the resulting cell is the first organism to stably propagate an expanded genetic alphabet.
US10513704B2
This invention provides for processes for binding to and/or chemically transforming a preselected target, where the process involves contacting said target to an oligonucleotide molecule that contains one or more “non-standard” nucleotides, which are nucleotide analogs that, when incorporated into oligonucleotides (DNA or RNA, collectively xNA), present to a pattern of hydrogen bonds that is different from the pattern presented by adenine, guanine, cytosine, and uracil. This disclosure provides an example where such an oligonucleotide molecule is built from both D- and L-mirror image carbohydrates in the backbone. It also provides a process for obtaining these binders and/or transformers by a laboratory in vitro selection process that exploits rolling circle amplification rather than the polymerase chain reaction.
US10513688B2
Methods of generating cardiomyocytes from induced pluripotent stem cells (IPSCs) are provided. More specifically, the present disclosure relates to methods of generating cardiomyocytes from iPSCs using electrical stimulation. In some aspects, uses of such cells for therapeutics and in methods of treatment are provided.
US10513682B2
The present invention generally relates to the microbiological industry, and specifically to the production of L-serine using genetically modified bacteria. The present invention provides genetically modified microorganisms, such as bacteria, wherein the expression of genes encoding for enzymes involved in the degradation of L-serine is attenuated, such as by inactivation, which makes them particularly suitable for the production of L-serine at higher yield. The present invention also provides means by which the microorganism, and more particularly a bacterium, can be made tolerant towards higher concentrations of serine. The present invention also provides methods for the production of L-serine or L-serine derivative using such genetically modified microorganisms.
US10513681B2
The disclosure provides methods and compositions to improve the nutritional conditions, such as reducing the use of fertilizers applied during the growing season, and tolerance to fungal pathogens in tomato and potato plants.
US10513680B2
The present invention relates to a method for producing biomass feedstock, by cultivating green microalgae cells in which the expression and/or the activity of the dual-specificity tyrosine-phosphorylation-regulated kinase (DYRKP-1) protein is altered, inducing reserve accumulation and/or increase in biomass production by said microalgae.
US10513679B2
A cell detection device and a cell detection method is provided with which it is possible to efficiently acquire images of cells to be measured. Cell detection device comprises flow cell through which a measurement specimen that contains particles is caused to flow, particle detector for detecting the particles in the measurement specimen supplied to flow cell, particle sorter for sorting particles that satisfy a detection condition and other particles on the basis of the result of detection performed by particle detector, specimen supply part for supplying, to flow cell, an image-capture specimen that includes detection-condition-satisfying particles that have been sorted by particle sorter, and particle-image-capture part for capturing images of the particles in the sorted image-capture specimen supplied to flow cell.
US10513678B2
A SCBI useful in ambient air pressure systems is disclosed. The SCBI includes a body which serves as the culture tube, a glass media ampoule, an inoculated stainless steel disc positioned on the top of the glass media ampoule so that the spores are close to the top/opening of the SCBI, filter paper on the top of the body and overlying the disc, and a cap.
US10513677B2
This disclosure may generally relate to a pressured vessel and, more particularly, to systems and methods for pressurizing a pressured vessel by producing a biogas using a recessed roof system. A pressured vessel may comprise a shell, wherein the shell may comprise a plurality of panels. The pressured vessel may further comprise a recessed roof and a deck. A method of collecting biogas from a pressure vessel may comprise disposing a liquid into the pressure vessel, disposing an anaerobic microorganism into the pressure vessel, adjusting a path of the biogas with a protruding baffle, collecting the biogas with the recessed roof, applying pressure to the outside of the recessed roof with the liquid such that the biogas pressure inside the recessed roof is increased, and removing the biogas from inside the recessed roof through a gas collection system.
US10513675B2
The invention relates to an aqueous washing liquor in a device for cleaning soiled textile substrates, containing a plurality of water-insoluble solid particles and a liquid phase which contains a microemulsion, and to a textile washing method using said type of washing liquor.
US10513674B1
A method of treatment of one or more articles may comprise locating a stain on an article based on a tag on the article; placing the stain on a nose of a spotting board; positioning a steam gun at least two or more inches away from the stain; simultaneously activating a steam supply and a vacuum supply of the spotting board; moving the steam gun in a defined motion relative to the stain for at least 30 seconds; simultaneously activating the vacuum supply and an air supply of the spotting board; moving the steam gun in the defined motion relative to the stain until the article is at least partially dry; and inspecting the stain.
US10513672B2
A product for cleaning a surface includes a combination of a first composition with a second composition. The first composition includes hydrogen peroxide and makes up 94-99.5% of the combination by weight. The second composition includes at least one of a silicate, a carbonate, a bicarbonate and a percarbonate and makes up 0.5-6% of the combination by weight. The first composition and the second composition are stored in separate vessels until combined to form the combination. The combination is applied to the surface after mixing.
US10513671B2
Method for treating a hydrophobically-modified textile with an aqueous solution of a nuclease enzyme, preferably a deoxyribonuclease or ribonuclease enzyme, rinsing and drying the textile. Use of the finishing step for improved cleaning with an aqueous solution of a nuclease enzyme, preferably a deoxyribonuclease or ribonuclease enzyme.
US10513662B2
Certain functionalized aldehydes scavengers may be used to at least partially scavenge sulfur-containing contaminants from fluid systems containing hydrocarbons and/or water. The contaminants scavenged or otherwise removed include, but are not necessarily limited to, H2S, mercaptans, and/or sulfides. Suitable scavengers include, but are not necessarily limited to, reaction products of glycolaldehyde with aldehydes; reaction products of glycolaldehyde with a nitrogen-containing reactant (e.g. an amine, a triazine, an imine, an aminal, and/or polyamines); non-nitrogen-containing reaction products of a hydrated aldehyde with certain second aldehydes; reaction products of 1,3,5-trioxane with hydroxyl-rich compounds (e.g. glyoxal, polyethylene glycol, polypropylene glycol, pentaerythritol, and/or sugars); and reaction products of certain aldehydes with certain phenols; and combinations of these reaction products.
US10513661B2
A process for processing plastic waste comprising converting plastic waste to hydrocarbon liquid and a first C1-4 gas; contacting hydrocarbon liquid with a first hydroprocessing catalyst in hydroprocessing unit to yield a second C1-4 gas and a first hydrocarbon product comprising C5+ liquid hydrocarbons; introducing the first hydrocarbon product to a first separating unit to produce treated hydrocarbon stream comprising C5-8 hydrocarbons and a first heavies stream comprising C9+ hydrocarbons; contacting the first heavies stream with a second hydroprocessing catalyst in hydrodealkylating unit to yield a second hydrocarbon product comprising C5+ liquid hydrocarbons and a third C1-4 gas; conveying the second hydrocarbon product to the first separating unit; feeding treated hydrocarbon stream to steam cracker to produce steam cracker product; separating steam cracker product into olefin gas, saturated hydrocarbons gas, aromatics, and a second heavies stream; and conveying the second heavies stream to hydroprocessing unit.
US10513659B2
A fire proof compound is provided including MgSO4.7H2O) (Mg4Si6O15(OH)2.6H2O) CaO (s)+H2O (l)⇄Ca(OH)2 (aq) (ΔHr=−63.7 kJ/mol of CaO) (CaSO4.2H2O) H4Mg2Si3O10). The compound can be added to a gypsum substrate of a wallboard to manufacture a fire proof wallboard. The compound can also be mixed with a paint to provide a fire proof paint. In certain composition, the compound can also exhibit an electromagnetic field blocking property. An existing wallboard manufacturing process line can be modified to accept the additional process of adding the compound to the gypsum substrate of the wallboard.
US10513657B2
The present invention relates to liquid-crystalline media (LC media) having negative or positive dielectric anisotropy, comprising a low-molecular-weight component and a polymerizable component. The polymerizable component comprises self-aligning, polymerizable mesogens (polymerizable self-alignment additives) which effect homeotropic (vertical) alignment of the LC media at a surface or the cell walls of a liquid-crystal display (LC display). The invention therefore also encompasses LC displays having homeotropic alignment of the LC medium without alignment layers. The invention discloses novel structures for self-alignment additives which have a certain position of the functional groups.
US10513650B2
A fluid composition comprising: (A) a liquid hardenable resin component comprising a resin; and (B) a hardening agent component comprising a hardening agent for the resin; wherein at least one of the resin or the hardening agent comprises a molecule having at least one heavy atom. The substitution of one or more heavy atoms that have a higher atomic weight than the other atoms of the molecule, increases the molecular mass of the resin or hardening agent, and hence, the density of the fluid composition. A method of treating a treatment zone of a well, the method comprising: introducing the treatment fluid into a well bore; and allowing the treatment fluid to form a hardened mass the well bore.
US10513633B2
Floor coating compositions and methods of forming a floor coating composition are provided. The floor coating composition includes an acrylic wax, water, and an indicator that includes a color at a first pH and that is colorless at a second pH. The method of forming a floor coating includes milling distilled water and an indicator, slowly adding an acrylic wax, slowly adding a pre-mixed solution of distilled water and an alkaline material, and then mixing the ingredients to form the composition.
US10513625B2
Cross-linkable polymeric compositions comprising an ethylene-based polymer, an organic peroxide, an optional cross-linking coagent, and an antioxidant. Such cross-linkable polymeric compositions are prepared by imbibing at least a portion of the organic peroxide, the optional cross-linking coagent, and the antioxidant into the ethylene-based polymer. Such cross-linkable polymeric compositions can be employed in forming coated conductors.
US10513615B2
A pigment pellet preparation, comprises one or more effect pigment and one or more thermosetting resin. The effect pigment is dispersed in the thermosetting resin. The thermosetting resin has 3 or more reactive terminal groups and has an acid number from about 10 to about 50 mg KOH/g resin. The preparation comprises from about 70% to about 90% by weight of one or more effect pigment and from about 5% to about 35% by weight of one or more thermosetting resin. The pigment and thermosetting resin comprise about 95% or more of the preparation. The pellets have a diameter of about 0.5 mm to about 5 mm and a length of about 1 mm to about 5 cm.
US10513604B2
The present disclosure provides a binder resin composition comprising a polyolefin particle, an organic solvent and a polymer that is soluble in the organic solvent, as well as an electrode for a lithium ion secondary battery and a lithium ion secondary battery each using the binder resin composition.
US10513596B2
Anti-fog compositions comprising a primary film having opposing major planar surfaces and a central coplanar region disposed between the opposing major planar surfaces and comprising cellulose acetate and a plasticizer. The cellulose acetate may have a degree of substitution less than 2.6. The plasticizer may be selected from the group consisting of 1,2,3-triacetoxypropane (triacetin), tributyl citrate, triethyl citrate, triphenyl phosphate, tris(clorisopropyl)phosphate, dimethyl phthalate, diethyl phthalate, bornan-2-one, PEG-DGE, PPG-DGE, tributyl phosphate, and combinations thereof. The primary film has a thickness greater than 90 microns.
US10513590B2
The instant application discloses, among other things, ways to manufacture reduced density thermoplastics. A rapid foaming process which may create a polymer product by saturating thermoplastic sheet or preforms, heating, and then forming into final shape, is described. The polymer product may include an integral solid skin. This method may be utilized with any thermoplastic. The material handling, saturation methods, and end products are also described.
US10513588B2
Disclosed herein are water-soluble films including a polyvinyl alcohol (PVOH) polymer and a combination of at least three plasticizers. The combination of plasticizers includes dipropylene glycol as a first plasticizer, a sugar alcohol such as sorbitol as a second plasticizer, and a polyol such as glycerin as a third plasticizer. When the PVOH polymer and plasticizers are blended in particular proportions and/or selected with regard to various criteria related to physical and chemical film properties, the resulting water-soluble film formed from the PVOH resin blend exhibits beneficial combinations four) of aged tensile strength, aged melting transition delta elevation, aged adhesion value, and/or resistance to seal peeling, which provide strong film seals that retain their water-solubility characteristics.
US10513584B2
A process and composition for the hydrosilylation of an unsaturated compound comprising reacting (a) a silyl hydride with (b) an unsaturated compound in the presence of (c) a platinum compound and (d) a cyclodiene, with the proviso that when the unsaturated compound is a terminal alkyne, the silyl hydride is other than a halosilane. The process and composition optionally comprise an inhibitor (e). The process and composition may be employed to form a variety of hydrosilylation products.
US10513576B2
An elastomeric polymer, comprising (1) a hard segment in the amount of 10% to 60% by weight of the elastomeric polymer, wherein the hard segment includes a urethane, urea or urethaneurea; and (2) a soft segment in the amount of 40% to 90% by weight of the elastomeric polymer. The soft segment comprises (a) at least 2% by weight of the soft segment of at least one polyether macrodiol, and/or at least one polycarbonate macrodiol; and (b) at least 2% by weight of the soft segment of at least one polyisobutylene macrodiol and/or diamine.
US10513571B2
Methods of preparing a polymerization catalyst component is provided, in which a magnesium component, a Lewis acid solubilizing component, a titanium compound, optionally a transition metal compound different than the titanium compound, and typically an inert filler are combined in a slurrying agent and spray-dried to produce a catalyst precursor in the form of a substantially spherical and porous solid particle. The methods and catalysts of this disclosure can provide ethylene homopolymer and copolymer resins having a high molecular weight tail and a broadened molecular weight distribution as compared to more traditional Ziegler-Natta catalysts.
US10513564B2
The present invention relates to a phase-stable suspension of cellulose II in water, having a high water retention capacity and a cellulose concentration between 0.1 and 5.0% by weight, a method of its preparation, and its use.
US10513561B2
The present invention provides an anti-Myl9 antibody or a Myl9 binding fragment thereof that binds to Myl9 and may inhibit the interaction between Myl9 and CD69 in humans, as well as a pharmaceutical composition comprising the same. A mouse anti-human/mouse Myl9 monoclonal antibody having binding affinity against Myl9 was obtained, and the sequence for the complementarity determining region (CDR) of said mouse anti-human/mouse Myl9 monoclonal antibody was identified. Accordingly, a humanized antibody comprising the CDR sequence of said mouse anti-human/mouse Myl9 monoclonal antibody in the variable region of heavy and light chains was produced.
US10513558B2
The invention relates generally to antibodies that specifically bind programmed cell death protein 1 (PD-1), activatable antibodies that specifically bind to PD-1 and methods of making and using these anti-PD-1 antibodies and anti-PD-1 activatable antibodies in a variety of therapeutic, diagnostic and prophylactic indications.
US10513555B2
The invention provides antibody formulations and methods useful for prophylaxis or treatment of synucleinopathies, including Parkinson's disease.
US10513553B2
This disclosure relates to peptide agents, e.g., antibodies and antigen-binding fragments thereof, that bind hemagglutinin protein of influenza viruses, and methods of their use.
US10513550B2
The present invention relates to a novel peptide of a glucagon derivative and a composition for preventing or treating obesity comprising the peptide as an active ingredient. The glucagon derivative according to the present invention shows a more excellent activating effect with regard to both glucagon-like peptide-1 receptors and glucagon receptors compared to native glucagon, and thus can be widely used as an effective agent for treating obesity.
US10513532B2
A compound contains a chemical dexpanthenol bound to a saccharide. A corresponding compound for use in therapeutic and/or cosmetic methods is also provided. The compound may be a skincare compound or a compound configured to be used in prophylaxis of skin diseases and/or treatment of skin diseases or a compound configured to be used as a medicament for accelerating wound healing.
US10513526B2
The present invention provides solid state forms of certain spiro-oxindole compounds, such as funapide and the racemic mixture of funapide and its corresponding (R) enantiomer, pharmaceutical compositions comprising the solid state forms and processes for preparing the solid state forms and the pharmaceutical compositions.
US10513520B2
Embodiments provide, among things, compounds of the formula I: wherein Het, Y, Rx, Z, X, R1-R3, R6, and R7 are defined herein; and methods for using such compounds to reduce pain (e.g., neuronal pain), treat a mammal's addiction to nicotine or anti-pain drugs, and increase a mammal's sensitivity to drugs that bind MOR or NMDAR.
US10513515B2
The present invention provides compounds that modulate protein function, to restore protein homeostasis and/or cell-cell adhesion. The invention provides methods of modulating protein-mediated diseases, such as cytokine-mediated diseases, disorders, conditions, or responses. Compositions of these compounds are also provided. Methods of treatment, amelioration, or prevention of protein-mediated diseases, disorders, and conditions are also provided.
US10513513B2
Crystals of a quinazoline derivative are provided. The present invention relates to an acid addition salt of a compound represented by Formula (I): a pharmaceutical composition containing it, and the like.
US10513511B2
The invention relates to aqueous suspension formulations of compounds, as defined in the specification and as represented by the compound of formula (I): and to their use in therapy.
US10513498B2
The present invention relates to a process for preparing a pyrazole compound of formula V, which comprises cyclizing a hydrazone substituted α,β-unsaturated carbonyl compound of formula IV by reacting it with a suitable reagent, e.g. a reducing agent, an organometallic reagent or a nucleophilic reagent. The compounds of formula V are versatile reaction tools for the preparation of pyrazole derived fine chemicals. The present invention also relates to pyrazole compounds of formulae Va, Vb, Vc, and VI.
US10513495B2
A polymorph III of N-(4-fluorobenzyl)-N-(1-methylpiperidin-4-yl)-N′-[4-(2-methylpropoxy)phenylmethyl]urea tartrate, a preparation method therefor, and a medicinal use. Compared to the existing crystalline forms, the new crystalline form has clear advantages with respect to solubility, stability and the preparation process.
US10513490B2
The invention relates to a method for producing compounds of formula (Ia), in particular to a method for producing N-[4-(cyclopropylcarbamoyl)phenylsulfonyl]-2-methoxybenzamide.
US10513473B2
A process comprises introducing an olefin monomer and a catalyst system or catalyst system components into a reaction mixture within a reaction system. The reaction system comprises: a total reaction mixture volume, and a heat exchanged portion of the reaction system comprising a heat exchanged reaction mixture volume and a total heat exchanged surface area. The process also comprises oligomerizing the olefin monomer within the reaction mixture, determining one or more reaction system operating parameters during the oligomerizing, controlling the one or more reaction system operating parameters during the oligomerizing, maintaining a ratio of the total heat exchanged surface area to a total reaction mixture volume within the reaction system in a range from 0.75 in−1 to 5 in−1, maintaining an oligomer product discharge rate from the reaction system between 1.0 (lb)(hr−1)(gal−1) and 6.0 (lb)(hr−1)(gal−1), and discharging a reaction system effluent comprising the oligomer product from the reaction system.
US10513472B2
Methods of producing at least one of ethylene and propylene. The methods may include contacting a mixture of C4+ compounds with a catalyst to convert at least a portion of the C4+ compounds to at least one of ethylene and propylene. The catalyst can include a phosphorus treated zeolite, and the mixture of C4+ compounds can include at least one of t-butyl alcohol and methyl t-butyl ether.
US10513469B2
The present invention relates to improving the efficacy of man-made and/or natural organic-based animal manure fertilizers by administration of an organic solvent formula containing polyorganic acids and/or their salts. The formulation liberates nutrient(s) that are normally bound in the soil as insoluble salts and complexes. These delivery formulations also provide an environmentally sound and inherently safe solvating system that improves diffusion of polyorganic acids to the granule fertilizer. These delivery formulations enable safe storage, transport and subsequent application or blending with solid or liquid fertilizers. The combined formulation and fertilizer can be applied to soil to provide improved efficacy of fertilizer by liberating nutrients bound in the soil for uptake by plant life.
US10513464B2
A dielectric composition with high voltage resistance and favorable reliability, and an electronic component using the composition, the composition containing a tungsten bronze type composite oxide represented by chemical formula (Sr1.00−(s+t)BasCat)6.00−xRx(Ti1.00−(a+d)ZraSid)x−2.00(Nb1.00−bTab)8.00−xO30.00, wherein R is at least one element selected from Y, La, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu, and s, t, x, a, b, and d satisfy 0≤s≤1.00, 0≤t≤1.00, 0≤s+t≤1.00, 0≤x≤3.00, 0.01≤a≤0.98, 0≤b≤1.00, 0.02≤d≤0.15, and 0.03≤a+d≤1.00. At least one element selected from Mn, Mg, Co, V, W, Mo, Li, B, and Al are contained as a sub component in 0.10 mol or more and 20.00 mol or less with respect to 100 mol of the main component.
US10513460B2
A composite material includes a cementitious composition and a plurality of fibers disposed in the cementitious composition. Each of the plurality of fibers includes a plastic component. Each of the plurality of fibers further includes a surfactant and a metal oxide, each independently heterogeneously dispersed throughout each of the plurality of fibers. A method of forming the composite material includes the step of combining the plastic component, the surfactant, and the metal oxide, to form the plurality of fibers. The method further includes the step of disposing the plurality of fibers in the cementitious composition to form the composite material.
US10513453B2
A roof mounted oxygen-fuel burner for a glass melting furnace can produce a variable moving or sweeping flame in the furnace and can also vary the flame shape. The burner has a housing having an oxygen inlet pipe coupled to an oxygen chamber and a fuel inlet pipe coupled to a fuel feeding crossover block. The fuel feeding block feeds fuel to a nozzle fuel port while the oxygen chamber feeds a plurality of nozzle oxygen ports which oxygen port outlets are angled toward the centralized fuel port outlet. A rotating impeller over the oxygen ports has a partial opening that causes a variable moving or sweeping flame in the burner as the impeller rotates. The impeller is also raised or lowered to control the flow of oxygen to the plurality of oxygen port outlets to control the shape of the burner flame.
US10513444B1
A water hydration system for disposing of the water content of the production water recovered from a hydrocarbon well. An internal combustion engine is utilized to drive electrical generators, pumps, etc., to provide electrical and mechanical power to the equipment of the well site. The engine includes a cooling system through which preprocessed production water flows to elevate the temperature thereof. The heated water is then sprayed into hot air to hydrate the air before being released to the atmosphere.
US10513443B2
A method of preparing magnetite particles may include providing a first solution of substantially ferrous sulphate. The first solution may be converted by replacing sulphate ions with chloride ions to produce a second solution of substantially ferrous chloride. The second solution may be oxidized to produce a third solution of substantially iron oxide. A system for purifying a solution of substantially iron oxide may include a solution reservoir, at least one membrane unit, and at least one pump for circulating the solution between the solution reservoir and the membrane unit. The solution may be delivered from the solution reservoir to an inlet of the membrane unit, and/or the solution may be returned from an outlet of the membrane unit to the solution reservoir.
US10513440B2
A new family of crystalline microporous metallophosphates designated AlPO-85 has been synthesized. These metallophosphates are represented by the empirical formula R+rMm2+EPxSiyOz where M is a framework metal alkaline earth or transition metal of valence +2, such as magnesium or zinc, R is an organoammonium cation, and E is a trivalent framework element such as aluminum or gallium. The AlPO-85 compositions are characterized by a new unique ABC-6 net structure, and have catalytic properties suitable for carrying out various hydrocarbon conversion processes, as well as characteristics suitable for adsorption applications.
US10513429B2
Processes for integrating complementary metal-oxide-semiconductor (CMOS) devices with microelectromechanical systems (MEMS) devices are provided. In some embodiments, the MEMS devices are formed on a sacrificial substrate or wafer, the sacrificial substrate or wafer is bonded to a CMOS die or wafer, and the sacrificial substrate or wafer is removed. In other embodiments, the MEMS devices are formed over a sacrificial region of a CMOS die or wafer and the sacrificial region is subsequently removed. Integrated circuit (ICs) resulting from the processes are also provided.
US10513415B2
A passenger conveyance system includes a depth-sensing sensor for capturing depth map data of objects within a field of view adjacent a passenger conveyance door. A processing module in communication with the depth-sensing sensor to receive the depth map data, the processing module uses the depth map data to track an object and calculate passenger data associated with the tracked object, and a passenger conveyance controller to receive the passenger data from the processing module, wherein the passenger conveyance controller controls a passenger conveyance dispatch control function in response to the passenger data.
US10513410B2
The invention relates to a winding shaft (1) for receiving at least one winding core, said winding shaft having a shaft body (2) made of fiber-reinforced plastic, preferably CFRP, having two bearing points (4, 5) at each end of the winding shaft, having radially displaceable clamping elements (20) distributed over the circumference and over the axial length for clamping, holding and releasing the winding cores. The winding shaft is designed to hold winding cores having an inside diameter of a maximum of 80 mm.
US10513408B2
A sheet conveying device, which is included in an image forming apparatus, includes a pair of rollers configured to convey a sheet in a sheet conveyance passage, a detector configured to optically detect an attitude of the sheet, one of a rotation device to rotate the pair of rollers in a direction parallel to a plane of the sheet and a moving device to move the pair of rollers in a width direction, and a controller configured to correct the attitude of the pair of rollers at a time interval, based on a detection result obtained by the detector. The controller performs the correcting operation by setting, according to reflectance of the sheet, at least one of a light emission time of the detector, the time interval of the correcting operation, light emission intensity of the detector and a conveying speed of the sheet.
US10513400B1
Disclosed are a method and/or a system for real-time analysis and marking of a target surface using a digital camera coupled marking device. In one embodiment, a master controller receives a real-time digital camera signal from the digital camera of a marking device communicatively coupled to the master controller. The master controller analyzes the digital camera signal using an image recognition algorithm, a machine vision algorithm, and a database and archives a visual state and an object design parameter of an object. The master controller compares the visual state of an object with a library of known visual states in the database to extract an associated marking pattern and a desired marking location of the object. The master controller generates and sends a marking command to a pin marker of the marking device. The pin marker engraves the marking pattern onto the object in real time.
US10513393B2
A horizontal storage module (HSM) includes a body defining a plurality of compartments configured for receiving canisters, wherein the compartments are arranged in a first row at a first elevation and a second row at a second elevation higher than the first elevation, and wherein at least a portion of one compartment in the first row is in the same horizontal axis location as at least a portion of one compartment in the second row. A method of manufacturing the HSM includes positioning adjacent segments. A carriage assembly for the HSM includes a frame and an actuation means for lifting a cask containing a canister. A method of lifting includes receiving a cask and lifting a cask for delivery of the canister to the HSM.
US10513380B2
The present invention relates to one-piece fasteners having a strap and a locking head utilized to secure elongate objects such as cables in a bundle, and in particular, to hybrid fasteners having both raised detents and locking teeth as part of the fastener strap.
US10513372B2
A child resistant bag includes: a front piece, a rear piece, a first zipper tape, a second zipper tape and a protective sheet; wherein both sides and a lower side of the first piece are respectively connected with the second piece; an up side of the first piece and an up side of the rear piece are both opened; the first zipper tape is provided on an internal face on the up side of the front piece; wherein an entire surface of a single face of the first zipper tape is integrally adhered and connected with the front piece; the second zipper tape is provided on an internal face on the up side of the rear piece; wherein the second zipper tape is adhered and connected into one body with the rear piece only by a low side portion.
US10513354B2
There is disclosed a Payload Ejection System (PES) able to store any set of payloads for launch and eject that set of payloads at a controlled speed with a low tumble rate while accommodating any offset centre of mass within a restricted volume. The need for ballasting or balancing is eliminated thus freeing up the design space for these payloads. Insensitivity to centre of mass location is enabled by the use of a deployment hinge assembly arrangement which uses two or more non-parallel folding hinge arrangements that allow for linear motion of the output link in one direction while restricting the motion all other directions. One embodiment of the current PES concept uses four (4) hinge panel assemblies, selected to provide optimal stiffness around the entire mechanism. The stiffness of the PES is integral to managing offset centre-of-mass locations by allowing the mechanism to translate the effective force vector to the center of mass location.
US10513352B2
A system and method for transferring a satellite from an initial orbit into a mission orbit. The method includes anchoring to the satellite of an external unit having a tank containing a reserve of propellants. The system includes an autonomous spacecraft having an electric propulsion module and a small internal reserve of propellants, located in a parking orbit close to the initial orbit. The spacecraft with the external unit attached to the satellite is docketed in an initial orbit, to produce a fluidic connection of the propellant tank of the external unit to the propulsion module of the spacecraft. The external unit and satellite is transferred into the mission orbit by the electric propulsion module of the spacecraft supplied with propellants directly from the external unit, thereby releasing the satellite into the mission orbit.
US10513347B2
A method and apparatus comprising a first composite layer and a second composite layer in which the second composite layer is associated with the first composite layer. The first composite layer and the second composite layer form a structure. The second composite layer has a conductivity configured to dissipate an electric charge on a surface of the structure and limit a flow of an electrical current in the second composite layer in which the electrical current is caused by an electromagnetic event.
US10513345B2
The invention relates to a method for monitoring the soundness of helicopters comprising the determination of the severity of a plurality of flight missions of a plurality of helicopters, comprising a step for acquiring and storing flight data from helicopter flight missions, and a step for acquiring and storing maintenance data from the plurality of helicopters. The method is characterised in that said determination comprises a mission-type construction step, comprising a sub-step for constructing descriptors, a sub-step for partitioning the descriptors and a sub-step for allocating a mission type to each flight by associating the descriptor of said flight and a sub-set, in which this descriptor is found, and a step for interpreting the severity of the mission types, comprising a sub-step for estimating the severity models, and a sub-step for associating a severity model with each mission type determined in the mission type construction step.
US10513324B2
In one aspect, there is a rib assembly for an aircraft wing including a rib web having a top and a bottom, the rib web includes a first laminate, a second laminate, and a honeycomb panel having an array of large cells disposed between the first laminate and the second laminate, each cell having a width of at least 1 cm; and a plurality of skin flanges for fixedly attaching the rib web to a skin of the wing, each skin flange has a base member having a first portion and a second portion and a vertical member extending from the base member. The plurality of skin flanges can be attached to the top and the bottom of the rib web such that the second portion of the base member and the vertical member are attached to the rib web.
US10513323B2
A system for controlling moisture ingress in aircraft skin mounted electronics, comprising: a moisture diverter comprising a substantially planar base flange, configured to sealingly engage an underlying surface of an interior structure of an aircraft, and, a shroud having a moisture impermeable wall extending inboard from the base flange and defining an enclosure therein for enclosing an electrical connector.
US10513321B1
A watercraft propulsion device for protecting marine life includes a tube that is coupled to a hull of a marine vessel. The tube has a front end and a back end that are open. The front end is circumferentially larger than the back end so that the tube is tapered. An impeller assembly is positioned in the tube. The impeller assembly is operationally coupled to a drive shaft of the marine vessel. A power plant of the marine vessel is positioned to rotate the impeller assembly concurrently with the drive shaft to increase a pressure and a flow of water through the tube to generate thrust to propel the marine vessel. A grate is coupled to a front perimeter of the tube so that the grate covers the front end. The grate is configured to deter entry of a marine organism into the tube.
US10513320B2
The presently disclosed subject matter is directed to an adaptor that can be used to eliminate the gap present between the motor housing and the propeller in conventional trolling motors. Particularly, the disclosed adaptor comprises a first shell and a second shell that attach together and surround the base of the trolling motor propeller therebetween. As shown, the propeller blades extend from one or more apertures in the adaptor. The adaptor attaches to the trailing end of the motor housing and is maintained on the drive shaft through the use of one or more fasteners.
US10513316B2
The present invention relates to an insulation structure, for a liquefied gas cargo hold, having an anchor strip removed, a cargo hold comprising the insulation structure, and a liquefied gas carrier comprising the cargo hold. A thermal protection member is substituted for an existing anchor strip, thereby effectively preventing damage on an upper insulating panel, due to a hot gas and heat transfer during welding of a membrane, by means of the thermal protection member as well as enhancing the fixing force of the membrane. The weight of a cargo hold can be reduced by means of forming the thermal protection member from a material in which aluminum foil is covered with glass cloth. And by means of removing an existing SUS anchor strip, rivet processing is not required and thus constructability can be enhanced.
US10513314B2
A self-supporting bimini top frame is independently supportable on four contact points. A main bow defines a first support member for a bimini top connectable to the bimini top frame. The main bow defines first and second contact points. A pair of stanchions are pivotably connected to the main bow and define third and fourth contact points. A primary tension bow is pivotably and slidably connected to the main bow and defines a second support member for the bimini top. A bimini top may also be secured on the bimini top frame.
US10513303B2
An electric three wheeled vehicle includes a vehicle chassis supporting a vehicle operator seat or saddle. The vehicle chassis defines a storage region beneath the vehicle operator seat or saddle. One or more energy storage devices for powering one or more electric motors of the vehicle are located within the storage region and are supported by the chassis. The storage region and/or the energy storage device(s) each form an elongate three-dimensional volume having a long axis that is parallel to a longitudinal axis of the vehicle.
US10513291B2
An automatic tilting vehicle including a pair of wheels rotatably supported by wheel carriers and laterally spaced apart and a vehicle tilting device that tilts the vehicle to the inside of a turn when turning. The vehicle tilting device includes a swing member, an actuator that swings the swing member about a swing axis, and a pair of connecting rods pivotally attached to the swing member and the wheel carriers on both lateral sides of the vehicle. Each connecting rod has a preset weakest portion that is buckled to be deformed in a preset direction in a preset area when a buckling load equal to or larger than a preset value is applied.
US10513289B2
An encoder includes an optical scale that has a phase difference plate, a light source section that irradiates the phase difference plate with light, and a light receiving section that receives the light from the phase difference plate, and outputs a signal corresponding to a received light intensity. The light emitted from the light source section is linearly polarized, and the light receiving section outputs a signal corresponding to a polarization state of the light from the phase difference plate.
US10513284B2
A motorized device for transporting a human or inanimate payload. A platform is configured to accommodate the payload and a pair of wheel clusters are mounted to the platform at opposite ends thereof and are powered in rotation relative to the platform, for example by one or more electric motors housed in or on the platform or wheel clusters. Each of the two wheel clusters comprises three drive wheels arranged in a generally triangular and co-planar configuration, and each is independently powered about its respective axis of rotation by a hub-mounted electric motor. An electronic controller commands the motors powering the two wheel clusters and of each of the six drive wheels. The independent controllability of each wheel and of the wheel clusters relative to the platform allows the device to steer and to ascend and descend steps.
US10513277B2
A method is provided for detecting the presence of a rolling stock on a railway track that is subdivided in successive track sections forming successive electrical circuits independently fed with electrical current for monitoring the presence of a rolling stock on a track section. A transmission device for providing electrical current is located at one end of the track section, and a reception device for detecting the electrical current is located at an opposite end of the track section. This method includes steps for continuously feeding the electrical circuit with electrical current and monitoring the presence of a rolling stock on the corresponding track section so that an electrical current can be applied to the electrical circuit if the reception device detects that no rolling stock is present on the track section. A system for detecting presence of a rolling stock on a railway track is also provided.
US10513274B1
An apparatus and a method for notifying a driver of status information of a surrounding vehicle are provided to guide the driver to conduct defensive driving to provide safety by communicating with the surrounding vehicle which is located within a predetermined distance from a host vehicle on a road and is traveling in the same direction as the host vehicle. The apparatus notifies the driver whether the surrounding vehicle activates an autonomous mode. To this end, the apparatus includes: a V2V communication device to communicate with the surrounding vehicle to obtain information indicating whether the autonomous mode of the surrounding vehicle is activated; a display to display whether the autonomous mode is activated; and a controller to control the display using the information.
US10513270B2
A system may include a plurality of vehicle sensor and a computer comprising a processor and memory storing instructions executable by the processor. One of the instruction may comprise to determine a driving responsiveness (DR) value using a weighted sum comprising indices of a transition probability matrix (Q), Q being derived from likelihood of transition data (Λ) between a plurality of driving modes from a set of interacting multiple model (IMM) instruction.
US10513264B2
A controller for a motor vehicle includes means for receiving information indicative of a current vehicle speed; means for receiving information indicative of an amount of brake force a braking system is developing or is capable of developing; means for receiving information indicative of a gradient of a driving surface on which the vehicle is driving; and torque transmission reduction means for causing a powertrain torque reduction operation to be performed in which the controller causes one or more components in a torque transmission path from a torque delivery device to driven wheels to assume a torque reduction condition in which torque transmission is reduced or substantially terminated. The controller is configured automatically to cause the torque reduction operation to be performed in dependence at least in part on the information indicative of current vehicle speed, information indicative of brake force amount and information indicative of driving surface gradient.
US10513263B2
A method for controlling an engagement of a lock-up clutch (LUC) of a torque converter of a machine is disclosed. The method includes detecting a pedal tap of a pedal, wherein the pedal tap is detected when the pedal is depressed from a position corresponding to a pedal displacement less than a first threshold displacement to a position corresponding to a pedal displacement greater than a second threshold displacement, and then released to a position corresponding to a pedal displacement less than the first threshold displacement within a threshold time duration. The method further includes causing the LUC to move to the LUC unlocked position if the pedal tap is detected.
US10513241B2
The present disclosure relates to an apparatus for vehicle occupant safety during automotive collisions. The apparatus includes a plurality of compression elements rigidly fixed to a first seat belt guide and a second seat belt guide. The compression elements are arranged to resist compressive loading in response to an impact force, such as that experienced during rapid deceleration of a vehicle occupant in an automotive collision. When a pre-determined threshold force has been overcome, the compression elements predictably deform, thus absorbing energy associated with the deceleration. As a result of deformation of the compression elements, additional seat belt length is pulled from the apparatus, thus shielding the vehicle occupant from maximal injury.
US10513237B2
A head protection airbag apparatus includes an airbag which is stored on an upper edge side of a vehicle window and is deployed and inflated to cover the window, and a protector which stores a folded body of the airbag. An upper edge side portion of the window includes a vehicle body side member which partially protrudes toward a vehicle inner side around an upper side of a storage region of the folded body. The protector includes a cover part which is disposed in a disposition region of the vehicle body side member. The cover part includes a door part which can be opened such that a tip end side is rotated upward while covering a region extending from a vehicle inner side lower corner part to a vehicle inner side surface of the vehicle body side member when the airbag is being deployed and inflated.
US10513232B2
An electrical connecting device includes an electrical conductor configured to transmit at least one of electrical energy and data between a first electrical component, which is arranged in a first housing that is electrically connected to a reference potential, and a second electrical component, which is arranged in a second housing that is electrically connected to the reference potential. The electrical connecting device also includes a first shielding device configured to shield the electrical conductor, wherein the first shielding device is electrically connected to the first housing, and a second shielding device configured to shield the electrical conductor, wherein the second shielding device is electrically connected to the second housing. The first shielding device is electrically isolated from the second shielding device.
US10513221B2
Provided is a soft upper trim of a vehicle door, in which an upper substrate, a foam, and a transparent skin are laminated, and particularly, to a soft upper trim for switch assembly of a vehicle door, in which a switch, which is configured to preserve continuity of a transparent skin and display lock and unlock symbols on the transparent skin, is easily assembled to an upper substrate, and a method of manufacturing the same.
US10513210B2
Retractable seat control interface assembly and vehicle seat with retractable seat control interface
A retractable interface assembly includes a base member defining a track and a track follower support member engaging the track and moving along the track between a retracted position and an extended position. A viewing angle detent mechanism pivotably connects an interface panel to the track follower support member and defines a plurality of angular positions of the interface panel relative to the track follower support member, including a storage angle position and a full up angle position, to fix the interface panel relative to the track follower support member in one of the plurality of angular positions. A position setting device sets a position of the track follower support member along the track of the base member. The set positions include the retracted position and the extended position of the track follower support member along the track of the base member.
US10513206B2
A vehicle seat includes a seat back having a front surface and a rear surface, a panel movable along the rear surface from a stowed position adjacent the rear surface to a deployed position facing the front surface, and an airbag supported on the panel and inflatable toward the front surface to an inflated position in which the airbag contacts the panel.
US10513201B2
A method for adapting a seating position of an occupant of a vehicle in a collision of the vehicle 100 with a foreign object. The method includes a step of providing an adjustment signal, which causes a change in the seating position from an upright position to a lying position, to an interface to a seat device of the vehicle using a collision signal that indicates an imminent underride situation of the vehicle, and using a position signal that indicates a seating position of the occupant, and the provision takes place if the position signal indicates the upright position, and the provision does not take place if the position signal 108 indicates the lying position.
US10513200B2
A vehicle battery system and a method of controlling charge of a battery in the system are provided. The system includes a first battery module that has a plurality of battery cells connected to each other in series and a second battery module that has a plurality of battery cells connected to each other in series. The second battery module is connected to the first battery module in series. A controller then monitors a state of charge of each of the first and second battery modules, such that when the state of charge of one of the first and second battery modules is less than a predetermined level, the controller performs active cell balancing between the battery cells of the first battery module and the battery cells of the second battery module.
US10513197B1
A vehicle includes an electrical port configured to transfer electricity between a vehicle battery and a charge station, the port including indicia viewable by operators of the port. The vehicle includes a controller configured to operate the indicia to flicker at a frequency that is proportional to a throughput level of a charge. The operation is responsive to receiving the charge.
US10513193B2
A charging/discharging device includes an electricity storage unit provided in transport equipment, a power conversion unit for performing conversion of power exchanged between the electricity storage unit and an external power system, and a control unit for controlling an operation of the power conversion unit in accordance with a reception signal. A server device that manages charge/discharge of the electricity storage unit performs demand/supply prediction of power in the power system, decides a time, at which discharge of the electricity storage unit to the power system or charge of the electricity storage unit by power supplied from the power system is performed, and transmits an instruction including the decided time, at which the discharge or the charge is performed, to the charging/discharging device.
US10513189B2
A charging system includes an electric bus and a charger. The charger includes a supply unit and a second communication unit. The supply unit supplies power to the electric bus stopped at a preset position. If power is being supplied to the electric bus by the supply unit, the second communication unit transmits a first identifier of the charger, if power is not being supplied to the electric bus by the supply unit, transmits a second identifier that is an identifier of the charger and different from the first identifier, and if a first command is received from the electric bus, transmits and receives information related to charging of a storage functional unit included in the electric bus, with the electric bus being a transmission source of the first command, using radio communication.
US10513188B2
A rechargeable battery pack (20) for an electric or hybrid vehicle (1), comprising: at least one electric connection member (23) to a powertrain unit (5) of the electric or hybrid vehicle (1); a plurality of mutually electrically connected cells (30); at least one first circuit block (40) integrated in the rechargeable battery pack (20) and comprising a radio communication interface (45).
US10513178B2
A method and system for controlling the stability and yaw response of a vehicle being equipped with a front axle (24), a rear axle (26), a controllable differential (22) and a control unit (50) arranged for locking and unlocking the differential (22), the method includes: selectively locking or unlocking the differential (22) depending on the operation of the vehicle; measuring at least the longitudinal vehicle speed (v); comparing the measured vehicle speed (v) with a predetermined first reference speed (vH); and locking the differential (22) if the measured vehicle speed (v) exceeds the first reference speed (vH).
US10513175B2
A method for operating a covering apparatus for covering a connection element of a motor vehicle. The connection element is designed as a junction between an energy delivery apparatus external to the motor vehicle and an energy storage unit and is designed for filling and/or recharging the energy storage unit with an energy source. The covering apparatus can preferably be designed as a charging flap or as a fuel tank cover. A release device carries out the following: determination that the motor vehicle is located within a predetermined radius of the energy delivery apparatus; generation of a release signal, which describes a release of an access to the connection element through opening of the covering apparatus.
US10513173B1
A fuel tank of an advanced ballistic tolerant fuel containment system is constructed with an inner layer designed to contain fuel, an intermediate layer or layers designed to self-seal any openings or holes made into the fuel tank, and an exterior layer that reinforces the fuel tank and provides the fuel tank with hard points for connection to an aircraft or vehicle. The interior layer, the intermediate layer and the exterior layer are all constructed of thermoplastic materials.
US10513170B1
A battery retention system includes a retention surface, a retention clip connected to the retention surface. First and second side brackets are also connected to the retention surface, wherein each side bracket includes a primary ramp facing the retention clip. The battery retention system also includes a retention rod including a first slide, a second slide, and an elongated member extending between the first slide and the second slide. The first and second slides are configured to slidingly contact the first and second primary ramps, respectively. The battery retention system further includes first and second mechanical fasteners configured to engage the first and second slides, respectively, with the first and second side brackets, respectively.
US10513169B2
An installation base member couples to an opening of an automobile body and has a substantially U-shaped cross section. A hollow seal member includes a first base root and a second base root which extend from an outer-cabin side wall of the installation base member. The hollow seal member in cross section protrudes from the first base root outwardly to a first turning point, curves toward a base root of the flange and connects with the second base root. A side of the first base root includes solid (dense) material. An interval between the first and the second base roots includes sponge material. A first border between the solid (dense) material of the side of the first base root and the sponge material is closer to an exterior of the automobile than the first turning point.
US10513168B2
A vehicular optical system includes an optical device disposed to acquire information on an environment outside a vehicle cabin, a transparent member disposed on a front surface of the optical device via a predetermined closed space, an anti-fogging sheet disposed in a first region of an inner surface of the transparent member in the closed space, the first region being within an angle of view of the optical device, and a dew condensation portion disposed in a second region of the inner surface of the transparent member in the closed space, the second region being out of the angle of view of the optical device and dew condensation being more likely to occur in the dew condensation portion than in the first region.
US10513158B2
The present invention relates to a method and an apparatus for mounting a tyre on a rim or demounting a tyre from a rim. The method includes the steps of rotating the wheel (tyre/rim assembly) by an electric motor about an axis, checking the current consumption of the electric motor during the mounting and demounting operation, and continuously and automatically adjusting a specific combination of torque and speed of the electric motor during the mounting/demounting operation. The apparatus for mounting a tyre on a rim or demounting a tyre from a rim comprises an electric motor for rotating the wheel (rim/tyre assembly) about an axis, a sensing device for sensing the motor current and transmitting corresponding signals to a control device and an adjustment controller for continuously and automatically adjusting a specific combination of torque and speed of the electric motor during the mounting/demounting operation.
US10513157B2
A connection assembly for an air maintenance tire system is provided. The air maintenance tire system includes an annular air tube, a valve housing and at least one connecting tube that is in fluid communication with the annular air tube and the valve housing. The connection assembly includes a connection housing that in turn includes a first port, a second port and a fluid passageway extending between the first port and the second port. A first compression fitting fluidly connects the annular air tube to the connection housing first port and a second compression fitting fluidly connects the connecting tube to the connection housing second port. The connection assembly enables a secure connection and fluid communication between the annular air tube and the connecting tube.
US10513151B2
A pneumatic tire comprises a tread portion provided with a shoulder main groove and shoulder blind grooves. The shoulder blind grooves extend axially inwardly from one of the tread edges and each having an axially inner blind end. The shoulder main groove extends circumferentially of the tire on the axially inside of the axially inner blind ends of the shoulder blind grooves. Each shoulder blind groove is provided with an axially inner shallow part, an axially outer deep part, and a sloped part therebetween having a depth gradually increasing from the shallow part towards the deep part, and having an axially outer end positioned at a distance from the tire equator which is 42.5% to 45% of the tread width.
US10513146B2
An axle assembly having a countershaft. The countershaft may be disposed in an axle housing. An axle shaft may be disposed in the countershaft. A first clutch may control rotation of the countershaft with respect to the axle shaft. A second clutch may control rotation of the countershaft with respect to the axle housing.
US10513143B2
The invention provides an improved tool box useful for painters featuring a first receiving space or compartment, a second receiving space or compartment, a handle or means for carrying or transporting the tool box, and a means for receiving or holding in a substantially vertical position a paint brush or paint roller or tool useful for a painter. The tool box may be formed of any suitable material or combination or materials such as wood, fiber board, pressboard, rubber, plastic, metal or cardboard. The tool box may be designed for extended life or it may be formed of one or more materials adapted to be disposed of after one or a few or several uses. The tool box may be of any suitable shape such as substantially rectangular, square, oblong, elliptical, round, etc.
US10513138B2
The present invention relates to a method for producing a transfer medium, to the transfer media produced by this method and to transfer printing methods.
US10513133B2
A text concealing tool assembly for defacing text from a paper includes a handle and a cover that is attached to the handle. A defacing unit is rotatably mounted in the cover. The defacing unit is rolled over a paper to mark and pierce the paper such that writing on the paper is illegible.
US10513129B2
A tray drawer and a multi-function printer using the same are provided. The tray drawer includes a drawer body, a tray and an indicating mechanism. The tray is disposed within the drawer body. The indicating mechanism includes an indicator and a linkage. The linkage pivotally connects the indicator and a lateral surface of a front end of the tray.
US10513123B2
A recording apparatus comprising a container to store a sheet of recording medium; a conveyer configured to convey the recording medium in the container; a main tank receiving portion configured to receive a main tank for storing liquid; a sub tank configured to store liquid supplied from the main tank; and a recording head including an ejection surface where ejection openings for ejecting liquid supplied from the sub tank are formed. Each of three projected areas which are an area of the main tank receiving portion, an area of the sub tank, and an area of the recording head, each projected to a virtual plane parallel to a surface of the recording medium contained in the container from a first direction orthogonal to the virtual plane, at least partially overlaps a container projected area which is an area of the container projected to the virtual plane from the first direction.
US10513121B2
A liquid ejecting apparatus performs ejection in which droplets are deposited onto a medium and flushing in which droplets are not deposited onto the medium. The apparatus includes a recording head configured to eject the droplets, a presentation unit configured to present at least one condition selected from a number of times of ejecting droplets in the one flushing, a weight per one of the droplets in the flushing, and a timing of the flushing to be changeable, and a flushing controller configured to control the recording head to perform the flushing based on the condition changed via the presentation unit.
US10513110B2
Disclosed is an industrial single-pass inkjet printer/press incorporating an line-scan camera. The line-scan camera enables system software to inspect every sheet for quality assurance purposes. These inspection results are tied back to a digital printer to take one or more of several possible actions. Actions include ensuring a particular number of acceptable prints are generated and sorted. Actions further include performing nozzle checks without pausing or interrupting production orders.
US10513108B2
Methods and apparatuses for making multiple three-dimensional objects from multiple solidifiable materials are shown and described. In accordance with the method, the objects are designed with variable removable support heights along the build axis so that each object has an interface between first and second materials that is the same height from the build platform. The technique simplifies the process of producing multiple three-dimensional objects from multiple solidifiable materials which may have different build axis heights of first and second finished object sections so that the sources of solidifiable materials need only be switched once during the building of multiple objects.
US10513100B2
Co-cured urethane and vinyl ester, epoxy, or unsaturated polyester gel coats having improved toughness and flexibility compared with conventional polyester gel coats are disclosed. The gel coats, which have 10-50 wt. % urethane content, adhere well to structural layers and can be used in a traditional in-mold process. Co-cured elastomeric coatings comprising from 50 to 95 wt. % of a urethane component and an unsaturated polyester, epoxy, or vinyl ester are also disclosed. Unlike conventional urethane coatings, the elastomeric coatings adhere well to structural layers and can be used in a traditional in-mold process. Castings or structural layers comprising a reinforced thermoset of co-cured urethane and vinyl ester, epoxy, or unsaturated polyester components, including 10-95 wt. % of the urethane component, are also described. The invention includes in-mold processes for making laminates that utilize the gel coats, elastomeric coatings, and/or structural layers. The in-mold process gives flexible, durable, urethane-containing laminates having good interlayer adhesion.
US10513091B2
Provided is a daylighting device (10) that is used by being attached to a window frame (110) supporting an existing window glass (100) and that includes a first base (11) being light-transmissive, a first spacer (12) provided at an outer edge of one surface (11a) of the first base (11) and attached to the window frame (110), and a daylighting member (13) provided on a side of the one surface (11a) of the first base (11), in which the daylighting member (13) includes a second base (14) that is light-transmissive and a plurality of protrusion daylighting portions (15) that are light-transmissive and provided to be adjacent to each other on a side of one surface (14a) of the second base (14).
US10513084B2
The illustrative embodiment comprises the sewing of fibers into a sewing substrate, which is then overmolded, to enable the manufacture of strong and lightweight articles with complex geometries.
US10513078B2
During the manufacturing process the exterior surface of one or both of the sheets of plastic film which form the bags is treated with low temperature corona discharge plasma to raise the level of surface charge magnitude to at least 43 Dyne to increase the adhesion force between the bags. A recess is formed in each of the bags to further increase the adhesion. The increased adhesion causes the mouth of one bag to automatically open as the adjacent bag is removed from the rack. The recess is formed at the same time openings are created in the bags to accept the support rods of a dispensing rack. The bags can have simple edge sides or side gussets and may be provided in a package including a pouch which receives and supports the lower portions of the bags.
US10513069B2
There is provided a manufacturing method for molding a liquid supply member by using a first mold and a second mold. The method includes a first molding step of performing injection molding to form a first component part of the liquid supply member and a plurality of component parts of the liquid supply member other than the first component part at different positions from each other, with the first and the second mold closed relative to each other, a contacting step of moving each of the formed plurality of component parts relatively to the first component part to bring the formed first component part into contact with the formed plurality of component parts, with the first and the second mold opened relative to each other, and a second molding step of performing injection molding to join the first component part and the plurality of component parts.
US10513065B2
A spacer (1) is injection molded by using an injection molding die having resin flow channels that are designed such that a plurality of gates (6) are arranged along the longitudinal direction at a position corresponding to the outer peripheral surface of a side wall part (4) in which a plurality of arc-like peripheral surface parts (2) are connected through a waist part (3). After opening the mold and ejecting the spacer, the spacer is cooled with a runner (7) being connected to the gate (6), and thereafter, the runner (7) is cut off. As a result, when producing a water jacket spacer that is assembled to the inside of the water jacket and controls the flow of cooling water by injection molding, while producing with a high productivity without being affected by design constraints caused by draft angle, deformation in the post-molding cooling step is prevented.
US10513063B2
Injection molded articles and methods for making them from bio-based materials are described. More specifically, injection molded articles and methods for making them from bio-based materials that behave like high-molecular-weight thermosets such as lignin or protein-based materials including corn gluten meal, corn gluten feed, distillers dried grains with solubles, wet distillers grains, modified wet distillers grains, canola meal, wheat gluten, barley, cottonseed meal, sunflower meal, linseed meal, soy, rapeseed, sorghum proteins, maize, rice proteins, potato proteins, cassava proteins, sweet potato proteins, yam proteins, plantain proteins, keratin, or collagen are described.
US10513059B2
A method for manufacturing a wheel including a step (a) during which a liquid to be polymerised is cast into a first mould so as to solidify same into a tubular preform, with main axis, the first mould including modelling cores in order to form recesses, of the rib type, in the radial thickness of the tubular preform; followed by a cutting step (b), during which the tubular preform is cut perpendicular to the main axis thereof, and secant to the recesses, so as to obtain a tubular preform section forming a rim; followed by an overmoulding step (d), during which said rim is placed in a second mould, concentrically with a central supporting member, such as a bushing or a shaft, and a polymer filling material is injected so as to create an intermediate disc that provides the attachment of the rim to the central supporting member.
US10513050B2
A method for controlling a wall saw system during the creation of a separating cut in a workpiece. The movement of the saw head is controlled at the end points such that a boundary of the wall saw facing the end point coincides with the end point after the pivoting movement of the saw arm. In the case of a free end point, the boundary of the wall saw is formed by an upper exit point of the saw blade. In the case of an obstacle, the boundary of the wall saw is formed by the saw blade edge of the saw blade if the processing occurs without the blade guard or by the blade guard edge of the blade guard if the processing occurs with the blade guard.
US10513044B1
Various systems, apparatuses and methods are disclosed for portioning and/or trimming cooked or pre-cooked bacon slices (or another food product) on a production line at full line speed. An exemplary system may comprise a food conveyor and a portioner. The food conveyor may have at least one transfer mechanism that carries bacon slices over at least one transfer comb. The portioner may have at least one fixed, stationary cutter positioned relative to the transfer comb in the path of the bacon slices. As the transfer mechanism moves the bacon slices across the transfer comb, the bacon slices contact the cutter and are moved by the transfer mechanism over the cutter, which cuts the bacon slices into two or more portions of shorter length.
US10513038B2
A robot control system includes a humanoid conversation robot that has a conversation with a user, at least one service execution robot that provides a service to the user, a recognition unit that recognizes a request and an emotion of the user through the conversation between the user and the humanoid conversation robot, and a determination unit that determines a service which is to be provided to the user and a service execution robot which is to execute the service among the at least one service execution robot according to the request and the emotion of the user. The service execution robot determined by the determination unit executes the determined service.
US10513036B2
A calibration system includes a mark for a robot including a first member and second members to that are connected to each other so as to allow relative movement via a joint shaft driven by a motor and also including a rotation-angle sensor that outputs a signal corresponding to a rotation angle of the motor, the mark being fixed to one of the second members; a camera that is disposed outside the robot and that acquires images of the mark; and a difference detection unit that detects the difference between signals output from the rotation-angle sensor at the timings of acquisition of the individual images acquired by the camera when the positions of the mark in the images are caused to substantially match each other before and after reinstallation or replacement of a part.
US10513035B2
A robot-defective-part diagnostic device includes a position measuring unit with a target and a sensor for capturing an image of the target. One of the target and the sensor is attached to the robot and the other is disposed outside the robot. The position measuring unit measures the positions of the target with the sensor for postures of the robot. The device also includes an error calculation unit that calculates the positioning error based on the measured positions of the target. A parameter calculation unit that calculates the mechanical parameters of the respective operation shafts based on the measured positions of the target for the respective postures when the calculated positioning error is larger than a predetermined threshold, and a defective-part identifying unit that identifies the operation shaft where the difference between the calculated mechanical parameters and preset mechanical parameters for achieving the postures is the largest.
US10513034B2
A method of controlling a non-productive movement of a tool from a starting position to an end position in a travel envelope of a machine tool includes the steps of a) providing a collision-free first trajectory for the non-productive movement of the tool, b) determining a second trajectory that is improved over the first trajectory with regard to a selectable target parameter using an algorithm, and c) checking the second trajectory for collisions and, if the second trajectory is free of collisions, providing an instruction corresponding to the second trajectory. The first trajectory in step a) includes plural rectilinear segments and the second trajectory in step b) includes a polynomial segment and, if the second trajectory is not free of collisions in step c), steps b) to c) are repeated so that the algorithm is provided with a modified model of the travel envelope in a repeat of step b).
US10513033B2
A method for queuing robots destined for one or more target locations in an environment, includes determining if a plurality of robots destined for the one or more target locations have entered a predefined target zone proximate the one or more target locations. The method also includes assigning each of the robots to either its target location or one of a plurality of queue locations based on an assigned priority. The plurality of queue locations are grouped into one or more queue groups.
US10513032B2
A method of controlling a robotic arm with human-computer interaction, and terminal and system for the same are provided. The method of controlling the robotic arm with human-computer interaction includes: virtualizing a robotic arm to provide a virtual robotic arm having at least two movable nodes on a screen, and designating a distal movable node of the at least two movable nodes as a target node; when the target node is triggered, responding to a drag-and-drop operation by a user and generating a moving path according to a path of the drag-and-drop operation on the target node; and generating a controlling signal for controlling a motion of the robotic arm based on the moving path, and controlling the robotic arm to move according to a motion of the virtual robotic arm based on control of the controlling signal.
US10513021B2
A power tool having a rotary impact mechanism and a mode change mechanism. The impact mechanism is driven by an output member of a transmission and includes a hammer and an anvil. The mode change mechanism includes a mode collar that is movable between a first position, in which the mode collar directly couples the hammer to the transmission output member to inhibit movement of the hammer relative to the spindle, and a second position in which the mode collar does not inhibit movement of the hammer relative to the spindle.
US10513020B2
A hydraulic hammer including a housing, a piston arranged for reciprocating movement within the housing, a hydraulic circuit within the housing. The hydraulic circuit is configured for connection to a source of pressurized fluid. The hydraulic circuit includes an inlet passage configured to provide a hydraulic fluid to the piston, an outlet passage configured to provide a return flow path for the hydraulic fluid from the piston a bypass passage selectively connecting the inlet passage to the outlet passage and a thermostatic valve assembly configured to connect the inlet passage to the piston when the temperature of the hydraulic fluid is below a threshold temperature and connect the inlet passage to the bypass passage when the temperature of the hydraulic fluid is above the threshold temperature.
US10513016B2
An example torque reaction tool includes a first arm having an end with a longitudinally extending cavity, and an opposite end with a first socket drive element disposed perpendicular to a longitudinal axis of the cavity. The torque reaction tool further includes a second arm having an end portion slidably disposed within the cavity, and an opposite end with a second socket drive element thereon, oriented in the same direction as the first socket drive element. The torque reaction tool further includes a first fastener, disposed in a first threaded hole in the first arm that extends into the cavity, the first fastener being adjustable to engage the end portion of the second arm to restrict sliding movement of the second arm relative to the first arm.
US10513008B2
Embodiments of the present disclosure generally relate to chemical mechanical polishing (CMP) of substrates. In one embodiment, a carrier head for a CMP apparatus is disclosed herein. The carrier head includes a body, a retaining ring, and a sensor assembly. The retaining ring is coupled to the body. The sensor assembly is positioned at least partially in the body. The sensor assembly includes a transmitter, an antenna, and a vibrational sensor. The transmitter has a first end and a second end. The antenna is coupled to the first end of the transmitter. The vibrational sensor is coupled to the second end. The vibrational sensor is configured to detect vibration during chemical mechanical processes with respect to radial, azimuthal, and angular axes of the carrier head.
US10512994B2
A table apparatus includes a first driver applying force in a first axis direction to a table, and a second driver applying force in a second axis direction to the table. The first driver includes a first actuator generating power for moving the table in the first axis direction, and a first movable member moving along a first drive axis parallel to the first axis by actuation of the first actuator. The first movable member includes: a first linear bearing moving along the first drive axis; a first rotary bearing disposed around a first rod member fixed to the first linear bearing and rotatable relative to the first rod member; and a second linear bearing connected to the first rotary bearing and guided in the second axis direction by a second guide member fixed to an edge of the table in the first axis direction.
US10512989B2
An alloy includes a matrix that includes an amount of high-melting-temperature superalloy between about 30% and 95% by weight and an amount of low-melting-temperature superalloy between about 0% and 70% by weight. The alloy also includes an amount of a ceramic reinforcement material between about 2% and 50% by volume, dispersed in the matrix.
US10512985B2
A joint processing method includes: a friction stir welding step for forming a joint in a plate by friction stir welding a groove in the plate; a cold working step for cold working the joint under cold working conditions such that a grain size in the joint is not more than a grain size of an aluminum alloy in the groove prior to the friction stir welding step; and a solution heat treatment step for, subsequent to the cold working step, performing solution heat treatment of the plate.
US10512982B2
A pipe assembly station for performing operations on a field joint during pipe assembly has an active rail extending around an opening through which the pipe can pass. Tool carriages are arranged to traverse along the active rail and around a periphery of the pipe. The station also comprises a standby position, distanced from the active rail and a switch arranged to transfer the tool carriage from the active rail to the standby position. By providing such a combination of a rail and a standby position, a tool carriage can be brought into position on the active rail to perform a pipe joining operation and can be subsequently set back to the standby position, where it is out of the way of operations taking place on the pipe. Such a switching arrangement allows for more effective use of the limited space around the joint.
US10512980B2
A wire electrical discharge machining system includes: an electrode motion control unit for moving a wire electrode while keeping the wire electrode parallel to Z1-axis and bring the wire electrode into contact with a reference piece, and moving the wire electrode while keeping the wire electrode inclined with respect to the Z1-axis and bring the wire electrode into contact with the reference piece; an electrode position acquiring unit for acquiring a position of the wire electrode in an X1Y1Z1 orthogonal coordinate system when the wire electrode touches the reference piece; a piece position acquiring unit for acquiring a piece position of the reference piece in an X2Y2Z2 orthogonal coordinate system when the wire electrode touches the reference piece; and a relative positional relationship calculator for calculating a coordinate system relative positional relationship, based on the acquired positions.
US10512975B2
A milling insert for shoulder milling having s a positive basic shape and includes an upper side having a rake surface, a lower side including a planar bottom surface, a side surface extending around the periphery of the milling insert, and a cutting edge formed between the side surface and the rake surface. The cutting edge has at least a major cutting edge portion, a corner radius cutting edge portion, a ramping cutting edge portion, and a surface wiping cutting edge portion. The side surface includes an upper set of primary clearance surfaces and a lower set of secondary clearance surfaces having a plurality of planar secondary clearance surfaces, wherein the upper set of primary clearance surfaces forms an overhang protruding with respect to the secondary clearance surfaces and extending around the entire upper periphery of the milling insert.
US10512972B2
A saw blade can include a blade body having a cutting edge defined by multiple teeth. The teeth can be disposed in a repeating pattern including a raker tooth, a first set tooth having a light offset to a right side of the blade body, a second set tooth having a heavy offset to the left side of the blade body, a second raker tooth, a third set tooth having a light offset to the left side, and a fourth set tooth having a heavy offset to the right side of the blade body. Each tooth can include a tip, rake face, gullet having a gullet depth, and one or more clearance surfaces. The pitch distance and gullet depth of the heavy offset teeth can be less than the pitch distances and gullet depths of the remaining teeth to provide an increased amount of strength for the heavy offset teeth.
US10512971B2
A power tool and operation method for quick locking and releasing working attachment thereof are provided. The power tool includes a housing; a motor in the housing; an output shaft driven by the motor; and a chuck to lock and release a working attachment, said chuck including a chuck body coupled with the output shaft, jaws movably disposed relative to the chuck body, and a clamping sleeve outside the chuck body. The clamping sleeve is movable with respect to the chuck body so as to drive the jaws to retract and open relative to the chuck body. A control mechanism is operable to lock the clamping sleeve or the chuck body relative to the housing, and to control the motor initiating along a preset rotary direction so that relative movement between the clamping sleeve and the chuck body is generated.
US10512968B2
A method for managing a casting process based on measured properties of molding sand is provided so that casting defects or energy used can be reduced by changing the molding conditions for the mold to be produced or changing the steps after molding. The method for managing a casting process based on the properties of the molding sand includes a step (1) of measuring the properties of the molding sand just before the molding sand is supplied to a molding machine (40) and a step (2) of determining if the measured properties of the molding sand comply with predetermined properties so as to then switch between a step of molding a mold when the measured properties do comply with the predetermined properties and a step of molding a mold when the measured properties do not comply with the predetermined properties.
US10512967B2
An apparatus for setting a joining or functional element comprising a mount, a punch disposed on the mount, a hold-down device surrounding the punch, a die, which is disposed on the mount and lies coaxially opposite the punch, a drive unit for effecting a relative movement of punch and die, and a control unit. According to the invention, the drive unit moves the die relative to the mount. Furthermore, a loading device for providing a loading stroke of the hold-down device for loading of a joining or functional element with prespecified stroke path of the hold-down device, and a force-exerting member, are provided, in order to, in the setting of a joining or functional element, press the hold-down device, in a pressure phase differing from the loading stroke, with predefined compressive force against a workpiece. Furthermore, a method for setting a joining or functional element is proposed.
US10512964B2
Electrically powered crimp tools are described. Also described are methods of operating the tools and methods of crimping. The tools include a housing, an electric motor, a roller screw assembly, and a jaw assembly. In particular versions of the tools the jaw assembly includes a cam linkage member that is manually displaced by a user to more easily open the jaws after performing a crimp.
US10512960B2
A shear device (21) of an extrusion press having a booster mechanism using an air cylinder or electric motor to supplement thrust to an amount corresponding to hydraulic pressure is provided. A fastening part pressing against a die stack (4) is configured by a booster mechanism using a lever and a shear guide (24) is pressed against a horseshoe (13) to fasten it in the extrusion direction. Further, a clearance between a surface of the die stack and a shear knife can be held constant. Also, a booster mechanism using a lever is employed for a tilt mechanism for the shear guide in the extrusion press.
US10512954B2
A method to prevent groundings of polycrystalline silicon rod holders to a reactor plate by the residual polymer in the following manner: first, providing a polycrystalline silicon reactor having a reactor plate with a plurality of silicon rod holders separated from the reactor plate with an insulation; next establishing an electrical circuit from a ground connection on the reactor plate connected to high potential test equipment to a high voltage probe; and finally completing the electrical circuit by contacting the high voltage probe to the holder. By this method any remaining polymer is physically removed as the polymer burns or is ejected by the energetic release caused by mild arcing from the holder to the reactor plate.
US10512952B2
The object of the invention is to provide a device which can, with high efficiency, polish and clean the inner surface of a pipe, dry the wet inner surface of the pipe, and perform coating, wherein the device does not require a large pump or a large motive force, and does not require a blast hose or a suction hose. More specifically, provided is an intra-pipe turbine blast system that moves along the inside of a pipe and performs work by spraying a fluid toward the inside of the pipe, wherein: a gas injected from a fluid supply device to the upstream-side end inside the pipe imparts speed to a mixed phase fluid consisting of a liquid and solid particles which are likewise injected into the pipe; the flow speed of the mixed phase fluid is set to 3 m per second which is the critical speed at which solid particles can float without precipitating in the liquid, and as a result of such setting, there is a great effect on reducing the energy required for causing the mixed phase fluid to move; and the mixed phase fluid with such setting is injected at a high speed from a rotation nozzle of a turbine crawler which moves inside the pipe, thereby polishing the inner surface of the pipe, and following the polishing work, the turbine crawler can clean, dry and coat the inner surface of the pipe.
US10512948B2
A gas purge unit 20 introduces a cleaning gas into a purging container 2 with an opening 2b therethrough. The gas purge unit 20 includes a first nozzle outlet 26 and a second nozzle outlet 28. The first nozzle outlet 26 blows out the cleaning gas from a lateral side line part of the opening 2b toward the inside of the purging container 2. The second nozzle outlet 28 blows out the cleaning gas from the lateral side line part of the opening 2b toward an opening surface of the opening 2b.
US10512942B2
A system for sorting objects is provided. For instance, the system includes a first sensor, a sorting actuator, a second sensor and a controller. The first sensor observes the objects. The sorting actuator sorts the objects. The second sensor observers the sorted objects. The sorting actuator may be actuated by the controller using sorting rules, historical system data and observations of the objects. The sorting rules may be updated by the controller using observations of the sorted objects. In another aspect, a method is provided. The objects are observed. The objects are sorted using sorting rules, historical system data and observations of the objects. The sorted objects are observed. The sorting rules are updated using the observations of the sorted objects.
US10512940B2
In order to provide an airflow sorting device having high accuracy and easy adjustment properties with a simple configuration, there are provided a conduit which has a central shaft line and which lets an object to be sorted to fall due to gravity on the inside of the conduit along the central shaft line; an air supply port which is provided at a lower part of the conduit and configured to blow air upward along the central shaft line; a suction port which is provided above the air supply port of the conduit and is an opening oriented downward of a suction pipe provided parallel to the central shaft line; and an input port provided above the suction port of the conduit through which the object to be sorted is input into the periphery of the suction pipe which is in the conduit. Sorting is performed in the sorting device according to whether or not the object to be sorted is being suctioned by the suction port together with a part or the entirety of an airflow generated in the conduit by the air blown from the air supply port, and an airflow adjusting body which is provided below the suction port in the conduit and blocks a falling path of the object to be sorted which falls due to gravity, is provided, and the airflow adjusting body includes: a vertex on the central shaft line; and an inclined surface having a sectional shape, sectional areas of which are similar to each other and increase in size downward, and a drag force which acts on the object to be sorted which falls due to gravity increases downward from the suction port.
US10512937B2
A vibration motor includes a stationary portion, a vibrating body, an elastic member, and a damper member. The elastic member includes a first extending portion, a second extending portion, a first connection portion, a second connection portion, a third extending portion, a fourth extending portion, a third connection portion, a fourth connection portion, and a fifth connection portion. The damper member includes a first longitudinal portion and a second longitudinal portion. An inner section including the first extending portion, the third extending portion, and the fifth connection portion directly opposes an upper surface of a weight in plan view in an up-down direction.
US10512935B2
Methods, systems and apparatuses are disclosed for making composite prepreg stacks comprising an outer layer of thermoplastic film that is co-cured with the thermoplastic layer comprising a compressive force on the composite material, along with coated composite materials and larger structures comprising the coated composite materials made according to the disclosed methods.
US10512934B2
A superhydrophobic and self-cleaning surface including a substrate and a superhydrophobic layer. The superhydrophobic layer having a reacted form of octadecyltrichlorosilane. The octadecyltrichlorosilane is disposed on and crosslinked to a surface of the substrate via surface hydroxyl groups. The surface exhibits a rms roughness of 40 nm to 60 nm, a water contact angle of 155° to 180°, and a contact angle hysteresis of less than 15°. A method of preparing the substrate with a superhydrophobic and self-cleaning surface including treating a substrate with a plasma treatment, contacting the substrate with water or an alcohol to form an hydroxylated substrate, contacting the hydroxylated substrate with a solution of octadecyltrichlorosilane in an alkane solvent at a concentration in the range of 0.05 M to 0.3 M, and drying the solution on to the substrate under ambient air to form the superhydrophobic and self-cleaning surface on the substrate.
US10512931B2
Apparatus and techniques for use in manufacturing a light emitting device, such as an organic light emitting diode (OLED) device can include using one or more modules having a controlled environment. The controlled environment can be maintained at a pressure at about atmospheric pressure or above atmospheric pressure. The modules can be arranged to provide various processing regions and to facilitate printing or otherwise depositing one or more patterned organic layers of an OLED device, such as an organic encapsulation layer (OEL) of an OLED device. In an example, uniform support for a substrate can be provided at least in part using a gas cushion, such as during one or more of a printing, holding, or curing operation comprising an OEL fabrication process. In another example, uniform support for the substrate can be provided using a distributed vacuum region, such as provided by a porous medium.
US10512921B2
An apparatus for a fluidic ejection device and a fluidic ejection device containing the apparatus. The apparatus includes a pivot member having at least a first position and a second position, a shaft attached on a first end thereof to the pivot member and on a second end distal from the first end to a capping structure, wherein pivot of the pivot member pivots the capping structure from a first capped position to a second uncapped position adjacent an ejection head of the fluidic ejection device.
US10512911B1
Provided herein are methods for processing and/or detecting a sample. A method can comprise providing a barrier between a first region and a second region, wherein the first region comprises the sample, wherein the barrier maintains the first region at a first atmosphere that is different than a second atmosphere of the second region, wherein a portion of the barrier comprises a fluid in coherent motion; and using a detector at least partially contained in the first region to detect one or more signals from the sample while the first region is maintained at the first atmosphere that is different than the second atmosphere of the second region. The portion of the barrier comprising fluid may have a pressure lower than the first atmosphere, the second atmosphere, or both.
US10512907B2
Provided is a resin including a copolymer having a first structural unit and/or second structural unit and a structural unit having a polar group. R1, R2, R5, and R6 are each independently a hydrogen atom or an alkyl group having 1 to 8 carbon atoms, R3 and R4 are each independently a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, A1 is a saturated carbon chain having 3 to 7 carbon atoms or a structure resulting from substitution of a heteroatom for a part of the carbon atoms of the saturated carbon chain, m and n are each independently 0 or 1, and X1 and X2 are each independently a halide ion, a hydroxide ion, or an anion of an organic or inorganic acid.
US10512900B2
A hydrothermal method of preparing uniform, monodisperse ceramic lanthanum hydroxyl carbonate (LaCO3OH) having cherry-blossom-like nanogears and/or nanocubes is described. The method produced a hexagonal crystal with a crystal lattice in which at least on lanthanum ion is substituted with calcium ion. The ceramic nanoparticles produced by the method are good catalyst for the reduction of nitrogen oxides with a hydrocarbon. A method of reducing exhaust gases is described.
US10512895B2
A titanium oxide particle includes a metal compound having a titanium metal atom and a carbon atom, and being bonded to a surface of the particle via an oxygen atom, wherein an element ratio (C/Ti) between carbon and titanium on the surface is in a range of 0.2 to 1.1 and the titanium oxide particle has an absorption at a wavelength of each of 450 nm and 750 nm in a visible absorption spectrum.
US10512894B2
A porous body is provided with enhanced fluid transport properties that is capable of performing or facilitating separations, or performing reactions and/or providing areas for such separations or reactions to take place. The porous body includes at least 80 percent alpha alumina and has a pore volume from 0.3 mL/g to 1.2 mL/g and a surface area from 0.3 m2/g to 3.0 m2/g. The porous body further includes a pore architecture that provides at least one of a tortuosity of 7.0 or less, a constriction of 4.0 or less and a permeability of 30 mdarcys or greater. The porous body can be used in a wide variety of applications such as, for example, as a filter, as a membrane or as a catalyst carrier.
US10512892B2
A process for preparing hollow particles of aluminosilicates having a spherical shape of allophane type which are hybrid at the core, comprising: (a) having, at ambient temperature, an aqueous medium containing at least one aluminum precursor and one silicon alkoxide in an Al/Si molar ratio varying from 1 to 3, (b) carrying out, with stirring, the alkaline hydrolysis of said medium with gradual addition of at least one base in a base/Al molar ratio of 2.3 to 3, (c) maintaining, on conclusion of the addition of all of said base, stirring at ambient temperature until said medium is obtained in the clear state, and (d) heating the solution obtained at a temperature varying from 50 to 150° C. for 2 to 8 days, the combined stages (a) to (d) are carried out within a reactor consisting of a material which is chemically inert with respect to the reactants and expected aluminosilicate.
US10512891B2
An activated carbon manufacturing method may include preparing activated carbon precursors, carbonizing the activated carbon precursors by performing a heat treatment on the activated carbon precursors, equalizing the activated carbon precursors carbonized, in the carbonizing, by grinding the activated carbon precursors, activating the activated carbon precursors by inserting an oxidizing agent and distilled water into the equalized activated carbon precursors and performing a heat treatment on the activated carbon precursors, and introducing metal oxide particles into the activated carbon precursors by mixing the activated precursors, a metal salt, and a reducing agent in a solvent to perform reaction on the activated carbon precursors.
US10512890B1
A mixing apparatus includes a first and a second feeding tube, a first and a second atomizing/refining dose control device, and a reaction chamber. The first and second feeding tubes are arranged in a multi-sleeves manner. The first and second atomizing/refining dose control devices are respectively disposed on terminal ends of the first and second feeding tubes. The reaction chamber accommodates the first and second feeding tubes and the first and second atomizing/refining dose control devices and has a liquid dose mixing wall. The first and second feeding tubes respectively receive a first and a second liquid dose. The first and second atomizing/refining dose control devices respectively atomize or refine the first and second liquid doses and spray the atomized or refined first and second liquid doses on a surface of the liquid dose mixing wall, so as to mix the first and second liquid doses.
US10512888B2
Systems and methods provide automated parameter assurance features and results for consumables used in bioprocessing and particularly for purifying, filtering, harvesting and collecting bioprocessing fluids. Consumables having these features are sized, shaped, configured and constructed to interface with and be a component of such a bioprocessing system that includes a multi-use component or device with which it operatively engages such as by docking, engagement with a connector or other approach that allows for insertion and removal of the consumable. The consumable may be a component having a single-use life or a limited life. Each consumable has a median by which information, which can include use limits and specifications, is associated with that specific consumable, and those limits and specifications are communicated to the multi-use component which indicates any inappropriateness for use with the multi-use component.
US10512883B2
The invention relates to a process for dehumidifying a moist gas mixture. The invention further relates to an apparatus for dehumidifying a moist gas mixture and to the use of said apparatus in the process according to the invention.
US10512882B2
A drying and filtering device used for drying and filtering compressed air comprises a housing (10) having a cavity (11), an upper cover (20) disposed on the roof of the housing (10), a lower cover (30) having a drainage port (31) disposed at the bottom of the housing (10), and a cooling tube (40) disposed in the housing (10). An air inlet (21) and an air outlet (22) are provided at two sides of the upper cover (20). The cavity (11) being in communication with the air inlet (21), the air outlet (22), and the drainage port (31) respectively. The cooling tube (40) is disposed in the cavity (11) and extends from a position near the upper cover (20) downward to the lower cover (30). Compressed air enters the cavity (11) from the air inlet (21) on the upper cover (20), and contacts the cooling tube (40).
US10512878B2
A complex malodor removing equipment includes: a neutralizing module which dissolves a portion of malodor-causing substances, in malodorous gas introduced from malodor-producing equipment, in liquid water and removes same, which includes an acidity neutralizing module that introduces an alkaline substance from outside and removes an acidic malodor-causing substance from the malodor-causing substances, and an alkaline neutralizing module that introduces an acidic substance from outside and removes an alkaline malodor-causing substance from the malodor-causing substances, and which connects the acidity neutralizing module and the alkaline neutralizing module; and a balancing module which dissolves the remainder of the malodor-causing substances, in the malodorous gas introduced from the neutralizing module, in water and removes same, which includes an oxidation balancing module that introduces an oxidizing agent from outside and balances the malodor-causing substances, and a reduction balancing module that introduces a reducing agent from outside and balances the malodor-causing substances.
US10512877B2
A filter cartridge arrangement for use in air cleaners is provided. The filter cartridge arrangement includes a media pack including a plurality of inlet flutes and outlet flutes extending between first and second opposite flow faces and formed from an arrangement of facing sheet secured to corrugated sheet. An example cartridge includes a preform secured to the media pack. In some forms, the preform includes an arrangement extending over one of the flow faces.
US10512875B2
A filter media is provided. The filter media has a blend of filter media fibers, including oxidized polyacrylonitrile (OPAN) fibers and fibers of at least one other polymer, such that the OPAN fibers comprise between 30% and 95% by weight of the blend. A filter element incorporating the filter media is also provided. A method of using the filter element is provided as well. Also provided is a method of manufacturing the filter media. The filter media has applicability for filtering air in such acidic environments as a cement factory, lime kiln, asphalt process, rock dust application, and coal fired boilers.
US10512873B2
An air treatment system having an improved control system. The control system may include a dynamic “dead front” display that varies the display based on mode of operation. The display may include capacitive touch sensors and include an array of capacitive film segments or traces integrated into the display. The control system may include a self-contained electronics module that can be tested and calibrated before installation in the ATS. A dust sensor assembly may be integrated into the electronics module. The front cover may be attached with a mechanical attachment at the top and a magnetic attachment on the bottom. The ATS may include a filter retainer assembly with a rotating clip configured to perform in a cam-like manner to firmly clamp the particulate filter and carbon filter in place.
US10512869B2
A filtration system for a ventilation hood includes a first filter and a second filter, operatively disposed in series. The first filter is configured to be mounted within the ventilation hood, and has an air inlet, an air outlet, and a grease outlet. The second filter includes a filter material with an upstream surface and a downstream surface, an upstream housing element abutting the upstream surface of the filter material, and a downstream housing element abutting the downstream surface of the filter material. The housing elements include openings, and hold the filter material in compression.
US10512867B2
A filter assembly has a main filter element disposed in a filter housing and provided with an end disk with a first sealing element that seals the main filter element relative to the filter housing. A secondary filter element is disposed in the filter housing and is provided with an end disk with a second sealing element that seals the secondary filter element relative to the filter housing. The end disk of the secondary filter element is arranged relative to an axial direction of the filter assembly between the end disk of the main filter element and the filter housing. The end disk of the secondary filter element is arranged inside a flow cross section of a fluid outlet of the filter housing. The end disks of the main filter element and of the secondary filter element are axially supported on each other at least over sections thereof.
US10512862B2
Filter elements for gaseous fluid (e.g., air) filtration for wafer processing systems. The filter elements have a pleat ratio of no greater than 7, where the pleat ratio is the number of pleats per mean diameter of the filter. By having a pleat ratio no greater than 7, and in some implementations also greater than 5, the filter is optimized for wafer processing systems and methods. This pleat ratio optimizes the spacing between pleats, thus balancing filtration media area against effective area, such as what might be lost due to contaminant bridging.
US10512858B2
A membrane plate, a filter plate, and a filter press. The membrane plate is outfitted with a filter element on top of the membrane on both side surfaces, and the membrane plate has retaining elements at a distance from the margin on which the filter elements are removably secured. The filter plate also has retaining elements at a distance from the margin on which the filter elements are removably secured.
US10512857B2
Presently disclosed systems and methods for depositing a compound into a void in a sandwich panel or other structure are configured to reduce the air pressure in and around the void as the compound flows into the void, thereby reducing the amount of air trapped between the compound and the sandwich panel skin (under the compound, within the void) during the repair. Additionally or alternatively, presently disclosed systems and methods for deaerating a compound are configured to remove trapped air from the compound prior to use of the compound (e.g., prior to depositing the compound within a void for repairing the void). In some examples, the same system is configured to both deaerate the compound and deposit the deaerated compound to the void, all while in a reduced air pressure environment inside a vacuum chamber.
US10512855B2
The present disclosure includes a method for processing a beer stream for the recovery of oil. The method include a step of extracting oil from a beer stream into an organic phase comprising an organic solvent to provide in the organic phase at least a portion of the oil. In general, a beer stream refers to a composition containing alcohol, water, oil, and particulates, and can be a result of a fermentation process. When the beer stream is a beer stream from a fermentation process, it can be referred to as a fermentation broth even if it is no longer being subjected to fermentation. The beer stream can contain other components commonly found in a stream coming off a fermentation process such as, for example, glycerol and acetic acid. A method for producing ethanol, and an ethanol production facility are provided.
US10512851B1
The doll with simulated hair and nail growth includes a doll head with adjustable length hair simulating hair growth, and at least one doll hand having adjustable length fingernails, simulating nail growth. The simulated hair and nail growth are each metered, allowing the doll to be used for educational purposes to show growth of a certain length within a particular period of time. The doll head includes an internal axle, about which simulated hair fibers are wound. Selective rotation of the axle, driven by selective rotation of a knob with metered indicia, allows the apparent length of the simulated hair fibers to be adjusted in a controlled and metered fashion. The doll hand is provided with an internal sliding cartridge with simulated fingernails. Sliding of the cartridge, also in a controlled and metered fashion, allows for adjustable extension of the fingernails from fingers of the doll hand.
US10512845B2
Systems, methods and articles of manufacture for manipulating an interactive gameplay of a mobile device in real-time based on a state of a physical environment in which the mobile device is located. Embodiments include receiving, from one or more sensor devices of the mobile device during an interactive gameplay of an application on the mobile device, data characteristic of operating conditions of the environment in which the mobile device is located. Once the application determines that data received from the sensors satisfies conditions configured on the application for each type of sensor device, embodiments determine whether to manipulate the interactive gameplay by querying a remote database for one or more gameplay effects corresponding to the data. Once a response identifying at least one gameplay effect associated with the data is received, embodiments manipulate the interactive gameplay based on the identified gameplay effect.
US10512840B2
A player terminal pertaining to an embodiment of the present invention functions as a device that provides a game to a player. Since the player terminal is configured to determine a player's operation input on the basis of the change in the size of a figure that is moved by the player in an image inputted via an in-camera, it is possible to determine the player's operation input on the basis of a player action in which the figure is moved farther away from or closer to the in-camera.
US10512836B2
An interactive system based on light ray intensity recognition includes a smart device and a toy. The smart device has a touch control display screen providing variable brightness display. The toy is fitted onto the touch control screen and a light ray detection circuit is mounted on the bottom of the toy. The toy includes an LED drive circuit and an electromagnetic coil drive circuit; the output of the light ray detection circuit is respectively connected to an input of the LED drive circuit and an input of the electromagnetic coil drive circuit, the light ray detection circuit implementing detection of a brightness signal of the display picture of the touch control display screen of the smart device and outputting a drive signal, such that the LED drive circuit drives an LED to light up, switch off, or flash, and the electromagnetic coil drive circuit drives the toy to vibrate.
US10512832B2
A system and method for creating content such as artificial reality (AR) messages at an event, particularly among members on a social network, thereby enhancing and expanding the event experience. Typically, a participant shares an event with spectators, such as friends or a subset of friends in the participant's social network. The AR message may include geo-referenced artificial reality words, products or symbols and appear in a perspective view of the event to the participant or spectators. In addition to creating an active gallery for an event, messages, audio and video can be exchanged among participants and spectators, and virtual goods, money, bets, applause, other feedback, and donations exchanged.
US10512827B1
A golf club head with at least one hollow rail disposed on the sole of the club head body, and an insert positioned within at least a portion of the at least one hollow rail. The insert may include a thermoplastic polymer, such as thermoplastic urethane, and may be positioned to beneficially modify a mass distribution of the club head. By providing sole rail(s), a player may benefit from improved ball speed due to the improved interaction between the club head and turf or ground. The golf club head may further include a channel along a length of the sole of the club head, wherein the channel traverses the at least one hollow rail. The channel may extend in a heel-toe direction along the sole and allow greater flexibility in the club head upon impact with a golf ball.
US10512823B2
In a multi-piece solid golf ball made up of, successively, a core, an intermediate layer and a cover having numerous dimples on the surface thereof, the intermediate layer is formed of a resin material and the cover is formed of a urethane resin material, each having a specific respective Shore D hardness. The ball has a specific (intermediate layer thickness)/(core diameter) value and a specific (cover thickness)/(core diameter) value, and the core has a specific deflection. The sphere consisting of the core encased by the intermediate layer has an initial velocity A and the core has an initial velocity B which together satisfy the condition A−B≥0 m/s. This golf ball provides an increased distance and has both a soft feel when played and a high durability to repeated impact.
US10512820B2
A multi-purpose balance exercise device designed to be used in multiple positions and for diverse exercises. For example, various embodiments allow for the device to be used as an aerobic step device as well as the ability to easily adjust the device to various heights to easily decrease the level of difficulty of the device for use during various exercises. The balance exercise device can provide a plurality of handles and grab points both horizontally and vertically, which allow for an enhanced number of exercises or movements using either the top and/or bottom of the device. The exercise device includes a flexible bladder filled with air, other gases, or gels attached to a substantially rigid base. The base can include an interior within which features such as handles are disposed to provide a gripping or lifting exercise for which the balance exercise device can be used.
US10512819B2
A gait monitor 100 is disclosed which has a pair of movement sensors 501, 503 configured to be placed on either side of a user's head, preferably secured in the ears. Therefore, the movement sensors 501, 503 are each placed on both sides of the user's body but in equal distance to the midsagittal plane of the user and can monitor the gait of the user without need of any movement sensor centrally aligned in the midsagittal plane. Furthermore, the gait monitor 100 is able to determine if the steps of the user strikes the ground in a heel strike or forefoot strike in order to help the user improve his running efficiency.
US10512808B2
A dry sprinkler assembly includes a housing, a sprinkler head assembly with a sprinkler head and a trigger assembly, and an actuator assembly. The actuator assembly has a sealing subassembly for sealing the inlet port of the housing and is operatively coupled to the trigger assembly such that the sealing subassembly releases the sealing of the inlet port in response to the trigger assembly releasing its closure at the outlet opening. The sealing subassembly moves in a linear path substantially parallel with the central longitudinal axis of the housing when releasing the sealing of the inlet port wherein the flow of fire suppressant through the inlet port and into the fluid flow passage is substantially unimpeded.
US10512807B2
A portable fire hose dewatering device made of durable materials and used by one or more persons. It is considered fire fighting equipment and more specifically for efficiently removing the water from fire hoses prior to the hoses being rolled and stored. The device includes a mounting base, a rotatable shaft, bearings at the shaft ends, a pair of side structures/flanges on the mounting base, a spacer bar, and a set of pull handles connected to the side flanges.
US10512802B2
A cover for an energy absorber for use in a horizontal lifeline system includes four cover pieces structured to interlock together to form the cover. Each cover piece includes an interlocking section structured to slide into the interlocking section of another one of the cover pieces, a number of tabs, and a number of tab receivers. The number of tabs are structured to snap together with the tab receivers of another one of the cover pieces and the number of tab receivers are structured to snap together with the tabs of another one of the cover pieces.
US10512792B2
A therapy planning system and method generate an optimal treatment plan accounting for changes in anatomy. Therapy is delivered to the subject according to a first auto-planned optimal treatment plan based on a first image of a subject. A second image of the subject is received after a period of time. The second image is registered with the first image to generate a deformation map accounting for physiological changes. The second image is segmented into regions of interest using the deformation map. A mapped delivered dose is computed for each region of interest using the dose delivery goals and the deformation map. The first treatment plan is merged with the segmented regions of the second image and the mapped delivered dose during optimization.
US10512784B2
Systems, methods and implantable devices configured to provide cardiac resynchronization therapy and/or bradycardia pacing therapy. A first device located in the heart of the patient is configured to receive a communication from a second device and deliver a pacing therapy in response to or in accordance with the received communication. A second device located elsewhere is configured to determine an atrial event has occurred and communicate to the first device to trigger the pacing therapy. The second device may be configured for sensing the atrial event by the use of vector selection and atrial event windowing, among other enhancements. Exception cases are discussed and handled as well.
US10512780B2
The present invention is generally directed to methods, systems, and computer program products for coordinating musculoskeletal and cardiovascular hemodynamics. In some embodiments, a heart pacing signal causes heart contractions to occur with an essentially constant time relationship with respect to rhythmic musculoskeletal activity. In other embodiments, prompts (e.g., audio, graphical, etc.) are provided to a user to assist them in timing of their rhythmic musculoskeletal activity relative to timing of their cardiovascular cycle. In further embodiments, accurately indicating a heart condition during a cardiac stress test is increased.
US10512779B2
A system includes a pulse waveform generator and an ablation device coupled to the pulse waveform generator. The ablation device includes at least one electrode configured for ablation pulse delivery to tissue during use. The pulse waveform generator is configured to deliver voltage pulses to the ablation device in the form of a pulsed waveform. A first level of a hierarchy of the pulsed waveform includes a first set of pulses, each pulse having a pulse time duration, with a first time interval separating successive pulses. A second level of the hierarchy of the pulsed waveform includes a plurality of first sets of pulses as a second set of pulses, a second time interval separating successive first sets of pulses, the second time interval being at least three times the duration of the first time interval.
US10512773B2
An elongated guide sheath for delivering at least one medical instrument to a body lumen. For reliable and cost effective implantation of an electrode at the AV septum the inventive guide sheath forms a first guiding sleeve and a second guiding sleeve at least partly separated by a shared wall section, wherein the longitudinal axis of the first guiding sleeve and the longitudinal axis of the second guiding sleeve run parallel to a longitudinal guide sheath axis, wherein the wall of the first guiding sleeve and/or of the second guiding sleeve each comprises a slit which runs along at least part of the length of the respective guiding sleeve. Further, a system including the above guide sheath, a first catheter and/or guide wire and a second catheter or electrode is proposed.
US10512759B2
Catheters with weeping balloons can be used for various medical purposes. For example, in some embodiments provided herein weeping balloons are used for catheter visualization devices. In some embodiments, weeping balloons are used to deliver therapeutic agents. Weeping balloons can include openings of a selected size and shape through which a fluid gradually flows or “weeps.” The design of the openings can affect performance characteristics such as, but not limited to, fluid flow rate, tear resistance, and mitigation of counter-flow.
US10512756B2
Sizing catheters that include an inner member and an outer member. The inner member includes an elongate shaft and a plurality of radiopaque markers spaced axially from each other and secured to an outer surface of the shaft, the span of radiopaque markers defining a first portion of the inner member. The outer member that is disposed snugly around and in substantial contact with the inner member along at least the first portion of the inner member.
US10512754B2
A tip for a medical device includes a hollow body having a window, a sensor positioned within the hollow body and oriented such that its active surface is pointed towards the window, and a membrane positioned within a beam path of the sensor. The membrane passes energy without preventing an outer surface of the hollow body of the tip from coming in contact with tissue, thus allowing the hollow body to deliver therapy to an adjacent tissue and/or diagnose adjacent tissue. The membrane can cover the window or the sensor. The membrane is desirably permeable to an irrigant, such that a suitable level of irrigant outflow from the window is maintained, and thin enough that it minimizes attenuation of energy passing to and/or from the sensor.
US10512752B2
A tray (100) for accommodating a coiled medical device, such as a catheter assembly (700), includes a first compartment (101), a second compartment (102), and a third compartment (103). The catheter assembly (700) and devices associated with a catheterization procedure, such as syringes (701,702) containing sterile water and lubricating jelly and a specimen container (703) can be disposed within the tray. Printed instructions (1001) can be included with the tray (100). When a CSR wrap (1000) is disposed about the tray (100), the printed instructions can be placed atop the CSR wrap (1000) but beneath an outer sterile wrap (1002). The printed instructions (1001) can include a patient portion (1202) that is detachably coupled to a health care services portion (1201) such that it can be taken home with the patient after the procedure.
US10512751B2
Methods of modifying the luminal profile of a body vessel are described. An example method comprises advancing a cannula out of the distal end of a catheter disposed within the lumen of a body vessel of an animal and toward a target site on the wall of the body vessel; passing contrast dye through the cannula toward the target site; simultaneously continuing the advancing and passing until the distal end of the cannula punctures the inner layer of the wall of the body vessel at the target site; and passing a bulking agent through the cannula and into a space between connective tissue layers surrounding the vessel wall at the target site. Medical devices, medical device assemblies, and kits are also described.
US10512749B2
Medical techniques include systems and methods for administering a positive pressure ventilation, a positive end expiratory pressure, and a vacuum to a person. Approaches also include treating a person with an intrathoracic pressure regulator so as to modulate or upregulate the autonomic system of the person, and treating a person with a combination of an intrathoracic pressure regulation treatment and an intra-aortic balloon pump treatment.
US10512747B2
A gas outlet extender allows for relocation of existing medical gas outlets to positions that are more ergonomic to care-givers at the point-of-use. In various aspects, the gas outlet extender may take one source of gas supply and provide the facility with a plurality of separate sources of that gas supply. By taking measurements of various parameters of the gas supply, an installer may obtain confidence that the gas flow for each of the plurality of separate sources meets regulatory requirements.
US10512738B2
A dual chamber vaporization tank comprises an inner tube, an intermediate tube, an outer tube, and a mouthpiece assembly. An e-liquid chamber is defined by a first annulus between the inner tube and the intermediate tube. The tank further comprises a porous ceramic ring having a heating coil disposed on an inner surface and an outer surface in fluid communication with the e-liquid chamber. An airflow path is defined from the surrounding air through an airflow aperture into a second annulus between the intermediate tube and the outer tube, along the second annulus in a first direction, through the heating coil in a second direction opposite the first direction, and through the inner tube.
US10512724B2
A medicament delivery device is presented having a housing that is arranged to accommodate a medicament container, a drive mechanism capable of, upon activation, act on said medicament container, a communication unit arranged in the housing, a switch operably connectable to the drive mechanism and connected to the communication unit for activating the communication unit when the switch is operated, wherein the switch is operated by the drive mechanism at the end of a dose delivery sequence.
US10512709B2
[Problem to be Solved] To provide a porous composite that has excellent uniform dispersability of OCP and that comprises OCP and collagen in a sufficiently mixed state; and a bone regeneration material comprising the porous composite. [Means for Solution] A porous composite comprising octacalcium phosphate and collagen, characterized in that in an image obtained by enlarging a 5.0-mm×5.0-mm range of a plane of the porous composite 15 times with a scanning electron microscope (SEM), agglomerated particles of octacalcium phosphate have a fractal dimension (D) of 0.70 or more; and the area of c) portions consisting of collagen accounts for 5% or less of the total area of a) portions consisting of agglomerated particles of octacalcium phosphate, b) portions consisting of octacalcium phosphate microparticles and collagen, and the c) portions consisting of collagen.
US10512705B2
Articles can be provided with odor resistance by applying a dispersion of a halogenated heterocyclic N-halamine in an inert liquid carrier onto the surface of the article and allowing the inert liquid carrier to penetrate into it. The N-halamine accordingly becomes deposited on the surface of the article after the inert liquid carrier penetrates into the article. This method can be used to provide odor resistance to a variety of substrates, including garbage bags. It can also be used to deposit other functional particulates onto the surface of substrates having sufficient porosity to take up the vehicle. For instance, such functional particles can be oxidants that display antimicrobial and/or enzyme inhibitory efficacy or particles having toxin interaction potentials through oxidative degradation or adsorption of toxic substances in air and/or water, such as fluoride uptake by metal oxide microparticles.
US10512702B2
The present invention provides a breathing assistance apparatus that has a convenient and effective method of cleaning internal conduits inside the apparatus. The breathing assistance apparatus is preferably a gases supply and humidification device. The cleaning method is a method of disinfection that is automated so minimal training is required to disinfect in particular an internal elbow conduit within the device. It is therefore not necessary to dismantle the gases supply and humidification device, therefore, inadvertent damage to the internal parts of the device is avoided. The present invention also provides a method of disinfecting a heated breathing conduit and a patient interface.
US10512695B2
The subject invention is directed to a pharmaceutical composition comprising an open matrix network carrying a pharmaceutically active ingredient, wherein the open matrix network comprises inulin.
US10512686B2
The present application relates to compositions for oral immunotherapy of peanut allergies. Further, the present application relates to methods for the preparation of the compositions for immunotherapy, and their use in immunotherapy.
US10512683B2
The present disclosure relates to a combination therapy comprising a therapeutic vaccine and a recombinant vaccinia virus for treating HPV-associated diseases. The present disclosure further relates to a method of administration of a combination therapy comprising a therapeutic vaccine and a recombinant vaccinia virus for treating HPV associated diseases.
US10512682B2
The present invention relates to antigenic and vaccine compositions comprising Norovirus antigens and adjuvants, in particular, mixtures of monovalent VLPs and mixtures of multivalent VLPs, and to a process for the production of both monovalent and multivalent VLPs, the VLPs comprising capsid proteins from one or more Norovirus genogroups.
US10512678B2
Disclosed is a formulation of the following enzymes: Alpha-galactosidase, Alpha amylase, Beta Glucanase, Lactase, BioCor DPP=IV (Proprietary blend) and Pectinase, which has been found to be effective in treating histamine intolerant people, and causing a significant improvement in a wide variety of pathologies and symptoms, including, but not limited to: inflammation, pruritus, urticaria, hypotension, tachycardia, fatigue, migraines, conjunctivitis, incontinence, nasal congestion, panic attacks, acid reflux, depression and angioedema.
US10512661B2
A method for reducing the likelihood of developing non-alcoholic steatohepatitis (NASH) in an individual diagnosed with non-alcoholic fatty liver disease involves providing in the gut of an individual a population of beneficial bacteria selected from the group consisting of Lactobacillus species, and at least 6 grams per day of fiber to the individual to maintain a therapeutically effective amount of the beneficial bacteria in the gut of the individual. In certain embodiments, monoacylglycerolacyltransferase-3 (MGAT3) synthesis is inhibited to lower triacylglycerol (TAG) production, while in others, expression of diacylglycerolacyltransferase-2 (DGAT-2) is inhibited. The beneficial bacteria are preferably modified to produce increased amounts of butyrate and are also encapsulated in a frangible enclosure. Levels of Roseburia are preferably increased while the levels of Akkermansia spp. in the individual's gut microbiome are reduced.
US10512659B2
The present disclosure relates to methods and apparatus for producing platelet rich plasma, bone marrow mononuclear cells, stromal vascular fraction from adipose tissue, and other concentrated or enriched biological fluids.
US10512653B2
A new and novel method for determining post procedural treatment is disclosed herein. In one embodiment, the method includes the steps of: determining a depth at which a surgical procedure on at least one eye of a patient is to be performed or was performed; providing a first set of instructions for administering a first medication for a first length of time to said at least one eye of said patient, said first length of time based at least in part upon said depth; providing a second set of instructions for administering a second different pressure lowering medication for a second length of time to said at least one eye of said patient, and physically administering the first medication and second different pressure lowering medication based upon the instructions.
US10512648B2
A tyrosine kinase inhibitor (TKI) for use in a method for the treatment of cancer in a patient, wherein the method comprises subjecting the patient to reduced caloric intake, i.e a daily caloric intake reduced by 10-100%, including starvation, for a period of 24-190 hours and administering the tyrosine kinase inhibitor to the patient during such period; the tyrosine kinase inhibitor is preferably selected among Lapatinib, Crizotinib, Gefitinib, Erlotinib, Afatinib and Regorafenib.
US10512643B2
Dosage forms, drug delivery systems, and methods related to sustained release of dextromethorphan or improved therapeutic effects are disclosed. Typically, bupropion or a related compound is orally administered to a human being to be treated with, or being treated with, dextromethorphan.
US10512642B2
Methods and compositions disclosed herein generally relate to methods, compounds, and compositions for treating myeloproliferative neoplasms (MPNs) or a symptom thereof, comprising administering, to a subject in need thereof, a therapeutically effective amount of a DUSP1 inhibiting compound, or of a pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof. Embodiments of the invention also relate to use of a compound, or pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof, for the preparation of a composition or medicament for the treatment of a myeloproliferative neoplasm (MPN), wherein the compound is an inhibitor of DUSP1.
US10512638B2
The present invention is directed to pyrazol-4-yl-pyridine compounds which are allosteric modulators of the M4 muscarinic acetylcholine receptor. The present invention is also directed to uses of the compounds described herein in the potential treatment or prevention of neurological and psychiatric disorders and diseases in which M4 muscarinic acetylcholine 5 receptors are involved. The present invention is also directed to compositions comprising these compounds. The present invention is also directed to uses of these compositions in the potential prevention or treatment of such diseases in which M4 muscarinic acetylcholine receptors are involved.
US10512633B2
Anti-viral compounds with low cytotoxicity are identified from screening of products found in Red Sea sponges, including the sponge Stylissa carteri. The identified compounds can be brominated pyrrole-2-aminoimidazole alkaloids and derivatives thereof. Specific examples of identified compounds include oroidin, hymenialdisine, and debromohymenialdisine, as well as derivatives thereof. The compounds also can be useful scaffolds or pharmacores for further chemical modification and derivatization. Selected compounds, particularly oroidin, show selective anti-viral HIV-1 activity coupled with reduced cytotoxicity. The compounds can function as HIV reverse-transcriptase inhibitors, and molecular modeling can be used to confirm inhibition.
US10512629B1
Provided herein are fixed-dose combination (FDC) compositions comprising therapeutically effective amounts of at least one cannabinoid and spilanthol whether as essentially pure isolates or synthetics or as components of essential oils or plant extracts or combinations thereof. The compositions are formulated as pharmaceutical compositions, nutraceuticals, cosmeceuticals, nutricosmetics, cosmetics, or food products. The pharmaceutical compositions are useful for the treatment of a gastro-enteric disease selected from the group consisting of irritable bowel disease, Crohn's disease, colitis, irritable bowel syndrome, and acute and chronic pancreatitis or of sepsis. Other pharmaceutical uses are as anti-allergic, anti-inflammatory, immunomodulator, antioxidant, anti-microbial, antibacterial, antifungal, antiviral, antinociceptive, analgesic, anesthetic, anti-cancer, apoptosis inducing, antiscorbutic, antipyretic, anti-malarial, addiction mitigatory, anxiolytic, anti-depressant, diuretic, anti-diarrheal, vasodilator or aphrodisiac agents. The pharmaceutical compositions of this invention exhibit a synergistic effect.
US10512625B2
A topical pharmaceutical composition containing diacerein and/or its analogs is provided. Also provided is a method for treating various diseases using this topical pharmaceutical composition.
US10512623B2
The present invention relates to new pharmaceutical salts of β-GPA which exhibit improved physical properties. In particular, the invention relates to salts of β-GPA with improved flow properties (e.g., improved Carr's index and/or Hausner ratio) such as fumarate salts, succinate salts, and oxalate salts. The invention also relates to pharmaceutical compositions including a pharmaceutically effective amount of one or more salts of β-GPA, as well as methods of treating cancer including administration of a formulation including a β-GPA salt of the invention to a subject in need thereof.
US10512609B2
The present invention relates to immediate release formulations of (R)-2-amino-3-phenylpropyl carbamate and methods of using the same to treat disorders.
US10512606B2
The present application relates to compositions comprising and methods of using a liposome comprising a pHLIP polypeptide, wherein a lipid bilayer of the liposome is substantially free of the pHLIP polypeptide.
US10512597B2
The present invention relates to an oral composition and method for alleviating the symptoms associated with xerostomia using encapsulated cation-releasing compounds formulated either intimately together or in separate compartments in a composition containing cation-sensitive mucoadhesive polymers.
US10512586B1
A system for vision rehabilitation therapy includes a controller, a laser generator for generating a laser beam with a cyclic frequency-varying laser pulse train having a frequency range of 10 Hz˜35 Hz, and a light spot regulating device for forming a light spot with a diameter of about 20 mm and a laser power density of less than 1.5 mW/cm2. A blade is disposed in front of the laser generator and shaped to block or unblock the laser beam as the blade rotates. A speed regulating motor is provided to regulate rotation speed of the blade through a drive circuit. A pair of virtual reality three-dimensional glasses is provided to generate a virtual reality three-dimensional green scenery, and a massage device is provided to massage acupoints around the eyes and on the head of a user.
US10512577B2
A robot includes a motion mechanism capable of operating in accordance with each of a first motion pattern for supporting a user with a first motion representing a standing-up motion and a second motion pattern for supporting a user with a second motion representing a sitting-down motion, a battery that supplies electric energy to the motion mechanism, a control unit that determines a multiple-motion availability index indicating the availability of an operation in accordance with a multiple-motion pattern including the first and second motion patterns on the basis of the battery level and the amounts of energy charge in the battery required for the operations performed by the motion mechanism in accordance with the first and second motion patterns if the control unit detects that the battery level is a first threshold value or lower, and a presentation unit that presents the multiple-motion availability index determined by the control unit.
US10512576B2
Apparatus and methods for providing therapeutic treatment for symptoms associated with GERD and/or other digestive disorders and/or other medical conditions are described herein. In some embodiments, an apparatus includes a support element and a conformable riser element adjacent the support element. The riser element and the support element collectively form a body support member configured to support a user and define a receiving portion configured to receive a portion of the user's arm. The riser element and the support element are each disposed within a casing formed at least in part with a stretch material. In some embodiments, the riser element includes a polyester filler material and the stretch material includes a four-way stretch material. The four-way stretch material in combination with the polyester filler material enables the riser element to be conformable.
US10512559B2
A cervical collar has an anterior component including a lower support that is adjustable in angle relative to a main support. The lower support is hingedly connected to the main support at first and second end portions. An elongate element engages the first and second end portions. A lock mechanism is operatively connected to the elongate element, and is arranged for locking rotation of the lower support relative to the main support, by moving the elongate element between locked and unlocked conditions. An upper support is received by the main support at least at a front section of the main support, and is arranged to be fitted against a user's chin.
US10512556B2
A stent includes a high radial force segment and a highly flexible segment, where the diameters of the high radial force segment and the highly flexible segment are substantially the same. The stent may further be placed with an additional stent segment, where the additional stent segment has a radial force similar to the radial force of the highly flexible force segment.
US10512535B2
Embodiments of the invention relate to a flexible, shape-shifting optic adapted to cooperate with a zonular capture haptic system and produce accommodation power both by shape shifting and axial shifting. The optic is designed as a small, thin walled optic vesicle comparable in size to current rigid monofocal IOL optics.
US10512530B2
An electric toothbrush including a handle, a head movable with respect to said handle, and a rotating working element having at least one brush located out of the geometric axis of said handle. The electric toothbrush further includes an electric motor for driving the working element in a rotary movement in a clockwise/counterclockwise direction, and a motor rotation direction switch coupled functionally with the head and the handle. The head and the handle are coupled with resilient technical means that enable, after exertion of the torque to the head, to rotate the head with respect to the handle into the left or right positions, where the motor rotation direction switch turns on the motor in the clockwise/counterclockwise rotation direction. After releasing said torque, the resilient technical means enable to maintain the head in a standby position relative to the handle, where the motor rotation direction switch turns off the motor.
US10512520B2
A surgical illumination apparatus comprises a fiber optic input, and illuminated surgical instrument, and an optical coupling bracket for coupling the fiber optic input to the illuminated surgical instrument. The coupling bracket comprises an elongate frame having a proximal end, a distal end, and a central channel extending therebetween, wherein the central channel is sized to receive and support optical fibers of the fiber optic input. The proximal end of the bracket is coupled to the fiber optic input, and the distal end of the bracket is coupled to an illumination element of the illuminated surgical instrument. The apparatus may further comprise a shroud disposed around the illumination element that is coupled to the bracket.
US10512517B2
A containment case assembly, including a tray and closing lid, comprises an upper frame that is configured to support from one to a plurality of removable screw decks is described. The screw decks have a column of first openings into which removable silicon plugs or inserts are positioned. The removable inserts include indicia or labels that indicate to a user the size of a surgical screw that is positioned in a row of second openings that are aligned in the screw deck immediately adjacent to one of the first openings. The upper frame of the containment case also has an inlet provided with a series of adjacent indicia or labels that are spaced at regular millimeter intervals for use in verifying the length of a surgical screw. The upper frame is further provided with a series of regularly spaced openings that have progressively larger sizes. These openings enable a user to verify the diameter of a surgical screw.
US10512513B2
Telerobotic, telesurgical, and/or surgical robotic devices, systems, and methods employ surgical robotic linkages that may have more degrees of freedom than an associated surgical end effector in space. A processor can calculate a tool motion that includes pivoting of the tool about an aperture site. Linkages movable along a range of configurations for a given end effector position may be driven toward configurations which inhibit collisions. Refined robotic linkages and methods for their use are also provided.
US10512512B2
Scenes captured with an endoscope (201) of a teleoperated surgical system (200) and displayed on a display unit (251) maintain a consistent brightness even though optical output power of an illuminator (210) changes, and working distance (204) between tissue (203) and the distal tip of the endoscope changes. Teleoperated surgical system (200) also automatically detects when endoscope (201) contacts tissue (203) and adjusts the output optical power of illuminator (210) so that tissue damage does not occur.
US10512511B2
Tool mount adaptors for interfacing a medical instrument with a medical insertion device are provided. The tool mount adaptor includes a collar for holding a medical instrument wherein the tool mount adaptor is releasably attachable to the medical insertion device. Cannula holder assemblies for a medical insertion device are also provided. The cannula holder assembly includes: (a) a cannula track; and (b) a cannula carriage slideably mounted on the cannula track comprising a cannula holder mount and a demobilizer. Medical insertion devices comprising the tool mount adaptors and/or cannula holder assemblies are also provided together with methods of using the medical insertion devices in diagnostic and/or therapeutic applications.
US10512510B2
A medical system employs a sensing coil that includes a flexible core containing a magnetically permeable material and an electrical conductor wound around the flexible core. The electrical conductor may be wound in a manner that permits use of the sensing coil in a range of configurations from straight to bent with a minimum radius of curvature.
US10512498B2
Apparatus and methods for treating conditions such as rhinitis are disclosed herein where a distal end of a probe shaft is introduced through the nasal cavity where the distal end has an end effector with a first configuration having a low-profile which is shaped to manipulate tissue within the nasal cavity. The distal end may be positioned into proximity of a tissue region having a post nasal nerve associated with a middle or inferior nasal turbinate. Once suitably positioned, the distal end may be reconfigured from the first configuration to a second configuration which is shaped to contact and follow the tissue region and the post nasal nerve may then be ablated via the distal end. Ablation may be performed using various mechanisms, such as cryotherapy, and optionally under direct visualization.
US10512496B2
A stock instrument includes at least one guide interacting feature. A lower instrument surface of the stock instrument is placed into contact with the patient tissue. A guide has a lower guide surface contoured to substantially mate with at least a portion of an upper instrument surface of the stock instrument. A predetermined instrument orientation upon the patient tissue is defined, which is preselected responsive to preoperative imaging of the patient tissue. The guide and instrument are mated in a predetermined relative guide/instrument orientation wherein at least one guide interacting feature of the instrument is placed into engagement with at least one instrument guiding feature of the guide. The guide is moved into a predetermined guide orientation with respect to the patient tissue and concurrently the instrument is moved into a predetermined instrument orientation with respect to the patient tissue.
US10512494B2
A pedicle screw has quadruple screw threads capable of moving forward a long distance in a bone upon rotation. For a screw to be embedded in a dense cortical bone of a vertebra, the threads include relief screw threads, to strongly couple with bone tissue in the cortical bone. For a screw to be embedded in a cancellous bone of the vertebra, two lines of threads (odd or even) include relief screw threads while the other two lines of threads include intaglio screw threads, thereby more strongly coupling with relatively soft cancellous bone tissue. The threads are provided in the whole pedicle screw, to move forward at 4-fold higher speed than a single screw thread, and intaglio screw threads are formed at a position to which the cancellous bone is fixed, so that cancellous bone tissues penetrate between the intaglio threads, thereby strongly coupling to the cortical and cancellous bones.
US10512486B2
This disclosure provides a system for securing a bone to a rod, the system comprising a ligature, a body, and two fasteners. The ligature has two free ends and an intermediate portion therebetween, the intermediate portion being configured to engage a bone. A portion of a rod can be fastened to the body using one of the fasteners. The ligature can be fastened to the body using another one of the fasteners. The two fasteners are distinct from one another and are adapted to fasten two free end portions of the ligature to the body independently from fastening the portion of the rod to the body.
US10512478B2
Mechanical thrombectomy systems including an elongate catheter configured as an elongate inversion support, a flexible tractor configured to roll and invert over the distal end of the elongate inversion support, and a clot engaging member on the distal end of an elongate manipulator are described herein. These systems may capture a clot using the clot engaging member and draw the clot and clot engaging member and roll the flexible tractor into the catheter to remove the clot and clot engaging member from a vessel.
US10512471B2
A knee arthroplasty system may have a femoral joint prosthesis with a femoral bone engagement surface with an anterior portion, a posterior portion, and a distal portion that connects the anterior portion to the posterior portion. A first femoral anchoring member may protrude from the distal portion, and may be connected to the anterior portion with a primary femoral web. A tibial resection guide may have a base member and a guide member with a slot that guides a cutting blade to resect the tibial plateau. The guide member may slide along an arcuate path relative to the base member.
US10512466B2
An adapter assembly for connecting an end effector to a surgical instrument includes first and second drive assemblies configured for converting rotational motion into linear motion, and an actuation assembly. The second drive assembly includes a pair of push/pull cables for longitudinally advancing and retracting a drive member.
US10512464B2
A surgical brace device for use in a surgical procedure including surgical stapling operations on bodily organ to protect the stapled tissue against damaging effects of physiological motion of the organ is disclosed herein. The surgical brace device comprises a pair of splint members of a predetermined rigidity profile, configured to be disposed on either side of the stapled tissue and dimensioned to span at least a portion of the width thereof; a strut member fixedly joined with the pair of splint members at one ends thereof; and a tie member configured to traverse the tissue of the organ disposed at a predetermined distance from the plurality of strut members to interconnect the pair of splint members and anchor the surgical brace device thereto.
US10512462B2
A surgical stapler has a body, a shaft assembly extending distally from the body, and an end effector coupled with a distal end of the shaft assembly. The end effector has a stapling head assembly, an anvil, and a vacuum port. The vacuum port is operable to draw tissue between the stapling head assembly and the anvil. The anvil is operable to move toward and away from the stapling head assembly to thereby capture the tissue drawn between the stapling head assembly and the anvil. The stapling head assembly comprises a plurality of wheel assemblies and staple cartridges. At least one wheel assembly is operable to rotate to thereby move the anvil toward and away from the body. The remaining wheel assemblies are operable to rotate to thereby drive staples through the captured tissue. The body includes user input features operable to drive the wheel assemblies.
US10512461B2
The present disclosure relates to a surgical fastener applying apparatus for applying fasteners to body tissue. The apparatus includes a cartridge receiving half-section defining an elongated channel member configured to releasably receive a firing assembly and a single use loading unit. A lockout structure prevents insertion of the single use loading unit into the channel member after the firing assembly is mounted to the cartridge receiving half-section. Alternatively, the lockout structure prevents full insertion of the firing assembly into the cartridge receiving half-section, if the single use loading unit is not engaged with the firing assembly.
US10512460B2
A system (10) including an helicoidal member (16); an elongated guide (26) positionable at least partially through the helicoidal member (16) along the longitudinal axis of helicoidal member (16), the guide (26) defining a longitudinally extending peripheral surface cooled portion (32); a cooling subsystem (33) for cooling the peripheral surface cooled portion (32); and a driver (34) for mounting the helicoidal member (16) thereto and rotating the helicoidal member (16) along the helicoidal member longitudinal axis while allowing the helicoidal member (16) to advance along the guide (26) in a distally oriented direction.
US10512453B2
The ultrasonic sensor includes, on the same substrate, transmitter elements, receiver elements, a potential controller for receiver electrodes of the receiver elements, and a connection switching unit for the receiver electrodes and the potential controller. During the ultrasound transmission period of the transmitter elements, the connection switching unit connects the potential controller and one of the receiver electrodes, and connects the receiver electrodes. During the reception period of the receiver elements, the connection switching unit disconnects the potential controller and the one of the receiver electrodes, and disconnects the receiver electrodes.
US10512432B2
This relates to a monitoring system capable of measuring a plurality of vital signs. The monitoring system can include a plurality of sensors including, but not limited to, electrodes, piezoelectric sensors, temperature sensors, and accelerometers. The monitoring system can be capable of operating in one or more operation modes such as, for example: capacitance measurement mode, electrical measurement mode, piezoelectric measurement mode, temperature measurement mode, acceleration measurement mode, impedance measurement mode, and standby mode. Based on the measured values, the monitoring system can analyze the user's sleep, provide feedback and suggestions to the user, and/or can adjust or control the environmental conditions to improve the user's sleep. The monitoring system can further be capable of analyzing the sleep of the user(s) without directly contacting or attaching uncomfortable probes to the user(s) and without having to analyze the sleep in an unknown environment (e.g., a medical facility).
US10512431B2
According to embodiments of the present invention, a sensor patch for detecting extravasation is provided. The sensor patch includes an elastic film, and at least one sensing electrode disposed on the elastic film, wherein an electrical resistance of the at least one sensing electrode is changeable in response to a force acting on the at least one sensing electrode. According to further embodiments of the present invention, a sensing device is also provided.
US10512429B2
Methods and apparatus provide Cheyne-Stokes respiration (“CSR”) detection based on a blood gas measurements such as oximetry. In some embodiments, a duration, such as a mean duration of contiguous periods of changing saturation or re-saturation occurring in an epoch taken from a processed oximetry signal, is determined. An occurrence of CSR may be detected from a comparison of the duration and a threshold derived to differentiate saturation changes due to CSR respiration and saturation changes due to obstructive sleep apnea. The threshold may be a discriminant function derived as a classifier by an automated training method. The discriminant function may be further implemented to characterize the epoch for CSR based on a frequency analysis of the oximetry data. Distance from the discriminant function may be utilized to generate probability values for the CSR detection.
US10512425B2
An apparatus, method and system for dermatologically noninvasive testing for blood sugar concentration using an interferometry optical design. The present apparatus, method and system are used to measure the optical properties of blood, without puncturing the skin or drawing blood samples. They incorporate the use of an electromagnetic light source and two optical polarizers. A dermatological sample, e.g., the earlobe, webbing between fingers, is illuminated with polarized electromagnetic light. When the linearly polarized light passes through this dermatological sample, the blood in the dermatological sample acts as an optical rotator due to the optical interaction with the blood sample. The presence of molecular chirality in the blood sample induces optical activity. After the skin is illuminated, a second polarizer finds the orientation of the polarization by maximizing the intensity on the photo detector. As a result, the blood sugar concentration may be determined.
US10512422B2
A location detection system identifies the locations of medical devices such as patient support apparatuses and/or patient care devices within a medical facility. The devices communicate via a wired connection to one or more medical facility systems (e.g. nurse call system, computer network, etc.), and/or via a wireless connection to such systems. The location detection system automatically determines location information of the devices and communicates the location information so that the recipient of any outgoing alerts and/or other information sent from the devices is apprised of the location of the particular device sending the alert or other information. Caregivers are thereby able to respond to the correct location of an alert, and software systems such as EMR systems, admission discharge and transfer (ADT) systems, etc. are able to correlate transmitted device data with the location and/or patient assigned to that location.
US10512420B2
Systems are described for monitoring extremities for injury or damage following a physical impact. A device embodiment includes, but is not limited to, a deformable substrate; a sensor assembly coupled to the deformable substrate, the sensor assembly configured to generate one or more sense signals based on detection of a physical impact to a body portion and based on detection of a physiological parameter; circuitry operably coupled to the sensor assembly and configured to receive the one or more sense signals based on detection of the physical impact and to determine whether the physical impact exceeds a threshold impact value, the circuitry configured to instruct the sensor assembly to detect one or more physiological parameters of the body portion when the physical impact exceeds the threshold impact value; and a reporting device operably coupled to the circuitry.
US10512417B2
A method is for displaying position information relating to a position of a region of interest of a patient relative to an examination unit of an imaging apparatus. A first examination plane is assignable to the examination unit and a camera is disposed relative to the examination unit such that, via a lens of the camera, three non-collinear reference points lying in a first reference plane parallel to the first examination plane are mapped to three collinear first image points lying on a first line. In an embodiment, the method includes capturing a camera image of the region of interest via the camera; displaying a positioning image, the positioning image including the camera image; and displaying first marking information relating to a position of the first line in the positioning image.
US10512407B2
One innovative aspect is directed to heart rate data collection. In some implementations, a circuit includes a light detector for generating a first electrical signal based on received light. The circuit includes a switching circuit, having a first and a second configuration, configured to receive a first voltage signal based on the first electrical signal and to switch among the first and the second configurations. The circuit includes first and second sampling circuits for sampling a value of the first voltage signal when the switching circuit is in the first configuration and second configurations, respectively. The circuit includes an ambient light cancellation circuit for generating a current signal to counter a first component of the first electrical signal when the first switching circuit is in the first configuration.
US10512400B2
A vision protection method is provided to ensure a viewer to rest his/her eyes after viewing on an electronic device for a certain period, wherein the eyesight protection method includes the steps of detecting at least one of eye activities of the viewer and working parameter of the electronic device in a working mode of the electronic device during the viewer is working on a current work displaying by the electronic device; switching the working mode of the electronic device to a resting mode when an abnormal eye activity of the viewer is detected; and switching the electronic device from the resting mode back to the working mode to resume the display of the current work of the electronic device. Therefore, the viewer is enforced to rest his/her eyes after every certain period.
US10512395B2
Methods to create montages of wide-field fundus images, while correcting for the projective distortion inherent to an imaging system are described. The methods use specific knowledge of the imaging geometry of the particular imaging system to map the fundus images onto a set of 3D ray vectors, which allows them to be stitched together efficiently and precisely. After co-aligning the images using feature detection and matching, the registered images are projected back into 2D to generate the final montaged image. The method could be used on any type of wide-field fundus images including, but not limited to, those generated from optical coherence tomography, optical coherence tomography angiography, and broad-line fundus imaging systems.
US10512394B2
The present invention discloses a new and improved endoscopic-enabled mouth gag for routine ENT procedures, such as adenoidectomy and nasopharyngeal biopsy. The invention modifies the existing mouth gag, provides a stable and adjustable placement for an endoscopic device potentially employed during an ENT procedure, and is to replace the outdated surgical method where the surgical field is visualized indirectly via a handheld mirror (with or without the preexisting mouth gag). The inventive endoscopic-enabled mouth gag not only provides enhanced visualization of the surgical field for a clinician, assistants, and trainees, but also enables a clinician to perform the procedure bimanually (with both hands).
US10512393B2
A video processor includes an identification section configured to identify a kind of an endoscope, an electronic zoom processing section configured to magnify by a first magnification factor and a second magnification factor larger than the first magnification factor, and a mode setting section configured to set to a first mode of enabling selection of a first processing pattern, and a second processing pattern, when connection of a super-wide angle endoscope is identified, and set to a second mode enabling selection of the second processing pattern when connection of a single visual field endoscope is identified, wherein when the mode setting section performs electronic zoom processing by the second magnification factor in the first mode, the electronic zoom processing section cuts out an image so that only the optical image of the forward visual field is displayed and magnifies the image with the second magnification factor.
US10512385B2
A dishwasher can include a tub defining a treating chamber receiving dishes for treatment, a spray system providing treating liquid to the treating chamber, a first dish rack located in the tub and having a bottom wall tiered to form multiple levels defining an effective inclination angle for the bottom wall, and a second dish rack located below the first dish rack and having an inclined non-tiered bottom wall.
US10512380B2
A motor assembly includes an impeller inside a motor assembly housing, a motor including a rotor including a rotor shaft rotatable with the impeller and a pair of stators disposed facing each other across the rotor while electromagnetically interacting with the rotor to rotate the rotor shaft, and a motor housing inside the motor assembly housing that fixes the pair of stators relative to the rotor.
US10512378B2
Provided is a vacuum cleaner including a base configured to form a lower surface of a cleaner body; moving wheels provided at both side surfaces of the cleaner body and rotated for travel of the vacuum cleaner and also configured to support the cleaner body to be rotated in normal and reverse directions; and a dust container installed at a front of the moving wheels and configured to collect suctioned dust, wherein the base includes a center portion; a first half portion configured to extend to be inclined upward from a front end of the center portion; and a second half portion configured to extend to be inclined upward from a rear end of the center portion, and a rotating center of the moving wheels is located between the first half portion and the second half portion.
US10512368B1
A wiping solution dispenser utilizes a motorized dispenser mechanism that moves a nozzle back and forth along a stroke to dispense a wide band of wiping solution onto toilet tissue. A motor may be coupled with a nozzle that moves back and forth or rotates about a pivot point to dispense a band of wiping solution. Wiping solution may be within a solution container that is configured for insertion into the dispenser housing and may be automatically ruptured by a puncture feature. A pump may force the wiping solution from the nozzle, or the solution may be gravity fed. A motion detector may be incorporated to control the actuation and dispensing of the solution. A near field communication transceiver may be used to receive payment before solution is dispensed.
US10512366B1
Multiple food ingredient dispensing device that include a body having a dispensing opening and an internal orifice plate that supports a release mechanism. The device either includes a carousel unit on a central axle or a carrier that turns on a bearing. The carousel unit or carrier hold a plurality of ingredient pods that contain food ingredients, and which rotate relative to the body. Rotating the ingredient pods can cause a selected one to rotate over the release mechanism. The release mechanism can then cause a controlled volume of the food ingredient to fall from associated ingredient pod. Also included are a viewing window with measurement indicia and a measurement adjust knob that adjusts the amount that falls when the release mechanism is opened. A dispensing opening then allows the food ingredient to fall out of the dispensing device.
US10512359B2
A programmable controlled intelligent cooking machine comprises: a housing and a wok arranged inside of the housing, electromagnetic heating coils, a wok rotating device, a wok working position controlling device, a wok lid and a wok lid controlling device, an electromagnetic heating controlling device, an ingredient feeding device, an accessory ingredient adding device, a dish discharging device, a wok washing device and a control device, wherein the electromagnetic heating coils wind around the external wall of the wok and heat the wok under the control of the electromagnetic heating controlling device; the wok working position controlling device is used for driving the wok to rotate to respective working positions to perform respective operations; the electrical control device is used for receiving preset recipe commands and sending corresponding control commands; the other devices are connected with the control device respectively so as to receive control commands.
US10512358B1
The systems and methods provide a container assembly comprising: a container having a known storage capacity for storing a liquid; an additive dispensing assembly, the additive dispensing assembly dispensing variable, non-zero quantities of one or more additives into the liquid stored in the container; one or more vessels that each contain one of the additives, of the one or more additives, to be dispensed into the liquid; and a gas dispensing assembly, the gas dispensing assembly releasing a gas into the liquid stored in the container, and the gas dispensing assembly including: an onboard gas tank; a valve assembly; and a gas outlet, and the valve assembly controlling flow of gas from the onboard gas tank, through the valve assembly, and to the gas outlet so as to output the gas into the liquid; and wherein the valve assembly, to perform the controlling the flow of gas, is movable between: an open position, in which flow of gas is allowed to flow from the onboard gas tank to the gas outlet; and a closed position in which the flow of gas is prevented to flow from the onboard gas tank to the gas outlet.
US10512351B1
A package delivery door, such as for mounting in a garage door, comprises a frame which defines a package delivery opening and a delivery door which is movable between a first position in which it closes the package delivery opening and a second position in which it does not. In the second position, the door may serve as a ramp for sliding package into the garage space behind the garage door. A stop limits rotation of the delivery door to the second position. The package door may include a lock which is unlocked when an unlock code is read or received from a package which is presented to the door.
US10512349B2
An electric wine decanter comprises a housing, an air pump, a spout, the retaining base and a control switch. The retaining base is provided with a vent hole for communicating with the air in the wine container and a wine guide tube for extending to a bottom of the wine container. The housing further includes a directional control valve therein for controlling an air flow switch of the air pump and a drive device for controlling the operation of the directional control valve. The directional control valve includes a valve body and a valve seat mounted to a bottom of the valve body. It is only necessary to install the electric wine decanter on the mouth of the wine container. By the opening and closing of the different valve mouths, the flow path of the air flow is changed to realize the functions of pressure-holding, vacuumizing and decanting.
US10512335B2
The assembly chair includes a pair of frames, a plurality of coupling rods, a plurality of pairs of depressed portions, at least one support member, and a sheet. The sheet is removably installed between the support member and the coupling rod. At least at one end portion of the sheet, the sheet includes a plurality of inserted portions along a width direction of the sheet. A flat plate is passed through at least one of the inserted portions. The support member with a flat intermediate portion is passed through another one of the inserted portions. The sheet is wound around outer peripheries of the inserted portion through which the plate is passed and the inserted portion through which the support member is passed to adjust a length of the sheet. In such state, the support member has both end portions fitted to the depressed portions on the frames.
US10512330B2
A legrest mechanism including a seat base rail, a mechanism rail, a drive assembly, a pivot plate link, a pivot plate, a main drive link, and a parallelogram legrest link assembly. The drive assembly moves the mechanism rail relative to the seat base rail, which drives movement of the parallelogram legrest link assembly between a retracted position and an extended position. The parallelogram legrest link assembly includes first and second legrest links, footrest and legrest drive arms, and a legrest bracket. The main drive link has a pin that is slidingly received in a slot in one of the first legrest link, second legrest link, or main drive link such that movement of the parallelogram legrest link assembly is decoupled from movement of the main drive link when the legrest and/or parallelogram legrest link assembly encounters an obstruction while moving from the extended position to the retracted position.
US10512329B2
An adjustable anchoring group for the wall assembly of wall-cupboards includes a hanging bracket device, provided with an anchoring base to a wall-cupboard and a hooking element; an anchoring support to a wall; a regulation system; and an actuation system of the reciprocal position between the hanging bracket device, the hooking element and the anchoring support to effect a regulation in the position of the wall-cupboard with respect to the wall, according to two directions perpendicular to each other. Both the regulation member and the actuation member are accessible from both below and above for controlling both the regulation member and the actuation member from both sides.
US10512328B2
A retraction device, in particular for pull-out guides, has a housing, in which a guide for a linearly movable slider and a guide track for a driver attached to the slider are provided. The driver can be coupled with an activator and a damper comprising a damper housing and a piston rod is provided between the housing and the slider. There is a pull-out guide with a stationary guide rail and a running rail which is movable relative to the guide rail.
US10512324B2
A scrubbing brush head assembly for cleaning an animal includes a shell. A wall coupled to the shell defines an upper chamber and a lower chamber. A pipe is coupled to the shell and is in fluidic communication with the lower chamber. A connector is configured to couple the pipe to a water source. A valve is configured to control a flow of water. A regulator fluidically couples the upper chamber to the lower chamber and the pipe. Tubes extend from a bottom of the shell and are in fluidic communication with the lower chamber. An actuator selectively actuates the regulator to fluidically couple the upper chamber to the lower chamber and the pipe. The water is partially directed to the upper chamber to dispense shampoo from the upper chamber to the lower chamber. The tubes direct the shampoo and the water to a body of an animal.
US10512322B2
A holder apparatus comprises a strap assembly, a cradle assembly, and an arm assembly. The strap assembly includes a support plate component attachable to a belt component. The cradle assembly includes a device-securing structure and an adjustment mechanism. The arm assembly includes a flexible arm component and a clip component. A first end of the flexible arm component is selectively engageable with the clip component. A second end of the flexible arm component is selectively engageable with the cradle assembly.
US10512318B2
A luggage system having a removable decorative storage crown for receiving and temporarily storing clothing items, such as suit jackets, uniforms, costumes, or other items using the same device that is used as a pull-handle. A stand element can be unfolded from the base of the luggage to act as a support, preventing the device from tipping when in a clothing rack orientation, but which can simply fold away when the luggage is being transported.
US10512313B2
A fastener tape includes a mounting part for mounting a fastener element and a sewing part for sewing a fabric. The mutually adjoining sides of the mounting part and sewing part are integrally connected to each other. Another side of the mounting part which is spaced distantly from the sewing part provides a fastener element mounting side for mounting the fastener element. The sewing part is constituted of a plain weave texture.
US10512311B2
An ornament assembly forms a ring hole for a string or a latch through fabric or leather goods. The ornament assembly includes a first body and a second body. The first body includes a first base defining a first through hole at a center of the first base and a first protrusion protruded from a boundary of the first through hole. The second body includes a second base defining a second through hole at a center of the second base and a second protrusion protruded from a boundary of the second through hole. The first protrusion defines an insert groove at a surface which is opposite to the second protrusion. The second protrusion is configured to be inserted into the insert groove to be combined with the first protrusion.
US10512309B2
A seat belt assembly including a seat belt webbing, a buckle, and a connector tongue assembly. The tongue assembly includes a body, a slot in the body for receiving a seat belt webbing, a locking mechanism located proximate the slot, and a spring biasing the locking mechanism towards the slot to frictionally engage the webbing to prevent freefall of the assembly.
US10512306B2
A multi-colored effect for a sole structure for an article of footwear is disclosed. The sole structure comprises a sole member having a first color and an exterior layer having a second color that is different from the sole member. A plurality of slots are formed in the sole structure and the second color is visible on an outer surface of the sole structure through the plurality of slots.
US10512303B2
An article of footwear includes a footwear component that is a tongue removably attachable to an upper. The tongue has a first set of lace guides extending outward of a perimeter of the tongue. The upper has a second set of lace guides. The first set of lace guides is interleaved with the second set of lace guides when the tongue is positioned adjacent the upper. The tongue is removably attached to the upper by a lace routed through the first set of lace guides and the second set of lace guides such that the tongue is hinged to the upper at the first set of lace guides and the second set of lace guides. The tongue may be reversibly, removably attached to the upper. A footwear system includes alternately removably attachable tongues.
US10512292B2
An accessory fastener device including front and back magnets for securing an accessory to a fabric item or other surface. The front and back magnets may include fabric shields covering a portion of the magnets and are configured to interface with the front and back sides of a fabric item. The accessory fastener may also include an accessory coupling configured to removably couple with the accessory. The device is used to add a plurality of accessories to fashion items, and also as a decorative means for holding and securing items in place.
US10512289B2
A disposable surgical gown is provided. The gown includes a front panel and sleeves formed from a first spunbond layer, a nonwoven (e.g., SMS) laminate, and a liquid impervious, moisture vapor breathable elastic film disposed therebetween. The gown also includes a first and second rear panels formed from a nonwoven laminate that is air breathable and allows for an air volumetric flow rate ranging from about 20 standard cubic feet per minute (scfm) to about 80 scfm. The gown further includes a collar formed from an air breathable knit material positioned adjacent a proximal end of the gown. The collar defines a neck opening having a v-neck shape adjacent the front panel. The v-neck shape forms an angle of greater than 90° at the neck opening. The combination of features results in a reduced-glare gown that is stretchable and impervious to liquids, yet can still dissipate heat and humidity.
US10512278B2
An apparatus for reducing the temperature of a liquid product in a processing line includes a polymer member having a passageway formed therein for receiving a liquid product in the passageway; an inlet and an outlet each in fluid communication with a corresponding opposed end of the passageway; a plurality of delivery channels formed in the polymer member, each one of the plurality of delivery channels having an opening in fluid communication with a different location of the passageway and constructed to provide a chilling medium into the passageway; and a support member for the polymer member, the support member constructed to mount the polymer member in the processing line. A related method is also provided.
US10512277B2
An object of the present invention is to provide an unfermented beer-taste beverage which has an appearance with foam like beer, but does not have the characteristic odor common to beers and non-alcohol beer-taste beverages associated with fermentation; an unfermented beer-taste beverage containing a soybean dietary fiber does not have the characteristic odor common to general beers and non-alcohol beer-taste beverages associated with fermentation; when the beer-taste beverage is poured into a glass or the like, a beer-like foam with a good appearance can be formed; the foam arising from the glass is a fine and minute foam like champagne, and the foam arises linearly; in addition, the beer-like foam makes the mouthfeel smooth, and further provides a texture.
US10512269B2
The present invention relates to herbicidal heteroaryl-alkyl-oxy-substituted heteroaryl/phenyl derivatives of formula (I), as well as to processes and intermediates used for the preparation of such derivatives. The invention further extends to herbicidal compositions comprising such derivatives, as well as to the use of such compounds and compositions in controlling undesirable plant growth; in particular the use in controlling weeds in crops of useful plants.
US10512264B2
The present invention provides a composition comprising (A) a compound of formula (I) wherein R1 is methyl, methoxy or chloro, R2 is methyl or chloro and A is a substituted heteroaryl group, or an N-oxide or salt form thereof, and (B) one or more further herbicides; as well as the use of such compositions in controlling plants or inhibiting plant growth.
US10512258B2
An animal trap features entrance encouraging mechanism for urging an animal into an enclosure of the trap. The mechanism features a pushing unit pivotally supported outside the interior space of the enclosure adjacent an access-way that opens into same. The pushing unit is pivotal about an axis generally parallel to a plane of the access-way for movement between a withdrawn position in which the access-way is unobstructed and a working position in which the pushing unit substantially obstructs the access-way. An actuator coupled to the pushing unit is triggered by an animal detection device at an approach area outside the enclosure within a travel path followed by the pushing unit, whereby the pushing unit urges the animal toward and through the access-way into the interior space of the enclosure. A one way gate prevents exit of the trapped animal after return of the pushing unit to the withdrawn position.
US10512253B2
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
US10512250B2
Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element is a pest control vaporizer or pesticide vaporizer that is used to protect bees from certain pests, mites, and insects where the pesticide vaporizer expels a vapor that kills harmful pests, mites, and insects but does not harm or affect bees in the colony. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes an integral body tube that is without any holes, perforations, punctures, gaps, vents, or discontinuities. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes a detachable proximal end air nozzle. Oxalic acid vaporizer with integral body tube, detachable proximal end air nozzle, and floating heating element includes a floating heating element with a floating electrical connection.
US10512247B2
A light-up object includes a rubberized outer body; a plug in a cavity of the outer body; and a lighting device located in the plug. The light-up object further includes a first inner capsule piece, the first inner capsule piece located in the plug, and a second inner capsule piece located in the cavity of the outer body, the second inner capsule piece shaped to engage with the first inner capsule piece. The first and second inner capsules are threaded to fit together. The outer body includes grooves, running around multiple circumferences of the outer body. The outer body has a size of approximately a baseball; the outer body is shaped approximately like a sphere; and the grooves are at least 5 mm deep in the outer body.
US10512246B2
An improved trimmer is structured to be held in the palm of a user's hand. The trimmer has a grinding drum that is advantageously structured to be situated in a palmar region of the user's hand that can be said to extend from the palm and to be generally bounded by the fingertips. When the trimmer is held in the palmar region, the thumb and certain fingers can support the trimmer, and other fingers that are not necessarily employed in supporting the trimmer are usable to operate a control switch of the trimmer. The control switch controls operation of a drive motor that is connected with a grinding drum which provides abrasive surfaces that are engageable with the animal nail or claw.
US10512245B2
The present disclosure provides methods and apparatus to support transport of a pet in a self-contained expandable carrier. In some examples, the carrier may be worn by a user to support the pet in a proximate location. A pet carrier which may be worn may provide comfort to pet owners while they travel.
US10512239B1
The invention relates to the soybean variety designated 01072273. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01072273. Also provided by the invention are tissue cultures of the soybean variety 01072273 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01072273 with itself or another soybean variety and plants produced by such methods.
US10512237B1
A novel soybean variety, designated 5PFDN24 is provided. Also provided are the seeds of soybean variety 5PFDN24, cells from soybean variety 5PFDN24, plants of soybean 5PFDN24, and plant parts of soybean variety 5PFDN24. Methods provided include producing a soybean plant by crossing soybean variety 5PFDN24 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PFDN24, methods for producing other soybean varieties or plant parts derived from soybean variety 5PFDN24, and methods of characterizing soybean variety 5PFDN24. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PFDN24 are further provided.
US10512236B1
A novel soybean variety, designated 5PNPR10 is provided. Also provided are the seeds of soybean variety 5PNPR10, cells from soybean variety 5PNPR10, plants of soybean 5PNPR10, and plant parts of soybean variety 5PNPR10. Methods provided include producing a soybean plant by crossing soybean variety 5PNPR10 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PNPR10, methods for producing other soybean varieties or plant parts derived from soybean variety 5PNPR10, and methods of characterizing soybean variety 5PNPR10. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PNPR10 are further provided.
US10512217B2
A delivery device is located at an inlet side of the cleaning shoe in a combine harvester. The delivery device is controlled in order to control a feed rate of grain that is fed to the cleaning shoe. One or more controllable subsystems are controlled based upon the feed rate.
US10512216B2
The combine harvester includes a harvest frame that receives grain culms cut by a reaping device and a rake-in auger disposed within the harvest frame so as to be rotatable about a rotary axis extending in a right/left direction of the harvester body. The rake-in auger conveys the grain culms inside the harvest frame in a right/left direction of the harvester body and rakes in the grain culms toward the rear of the harvester body. The combine harvester further includes a feeder that is communicatively connected to a rear wall of the harvest frame, and that conveys the grain culms raked in by the rake-in auger toward the rear of the harvester body. A grain culm sensor that detects the presence of the grain culms when coming in contact with the grain culms is disposed at a grain culm feed port in the feeder.
US10512211B2
A bracket assembly for row unit planters to withstand draft forces created by high speed and no tillage planting. The upper and lower link arms of the bracket assembly are pivotally connected to the front and rear mounting plates using full-length crossed shafts or shortened stub spindles. Tapered bearing races and tapered bushings are utilized at each end of the link arms to minimize wear and maintenance.
US10512208B2
An agricultural seed drill with a seed sensor, generally of the type having a plurality of row units comprising a separation device. The separation device is provided with two or more separate outlet openings for separated seeds, and wherein each outlet opening is associated with a guide channel and a furrow opener, for depositing seed into a ground furrow. Further, a detector is arranged between the outlet opening and the furrow opener, to detect the discharge of a separated seed element through the outlet opening into the furrow opener and to convert it into a signal.
US10512202B2
An agricultural implement system includes a down force cylinder configured to apply a downward force to a row unit, and a depth control cylinder configured to vary a penetration depth of a ground engaging tool of the row unit. The agricultural implement system also includes a valve assembly in fluid communication with the down force cylinder and the depth control cylinder. The valve assembly is configured to automatically adjust the downward force by varying fluid pressure within the down force cylinder based on fluid pressure within the depth control cylinder.
US10517201B2
A control device for the component mounting machine is provided with an error detecting section configured to detect a pickup error in which the electronic component was not picked up during pickup operation; a recovery control section configured to perform recovery processing of picking up the electronic component by performing the pickup operation again in a case in which a quantity of the pickup errors that has occurred consecutively during multiple attempts at the pickup operation is less than a threshold value; a tape management section configured to acquire a remaining amount of the carrier tape at the feeder; and a threshold changing section configured to change the threshold value in accordance with the acquired remaining amount of the carrier tape.
US10517199B2
A method of positioning a component in a desired position on a board is provided. The method includes the steps of: (a) picking up the component with a nozzle of a movable placement unit of a pick and place machine; (b) transporting the component towards the board as a function of the desired position; (c) obtaining sensor data about an orientation of the component with respect to the nozzle with a sensor of the placement unit; (d) obtaining in the sensor rotational data about the orientation of the nozzle with respect to the placement unit; (e) combining in the sensor the sensor data and the rotational data into a data set; (f) sending the data set from the sensor to a stationary computer and computing a correction instruction in the stationary computer; and (g) placing the component on the board as a function of the correction instruction from the stationary computer.
US10517197B2
Apparatus and techniques for implementing an isolation chamber, and more particularly for implementing an EMF shielded isolation chamber. In various embodiments, an isolation tank includes a shell having an upper cover and a lower tank portion having one or more sidewalls connected to a floor. The lower tank portion is configured to hold liquid and the lower tank portion and the upper cover together define an interior chamber configured to receive a user. The isolation tank further includes a conductive shield associated with at least a portion of the shell and configured to shield at least a portion of the interior chamber from external electromagnetic fields. In various additional embodiments, the isolation tank includes a shield ground for electrically grounding the shield and/or a liquid ground for electrically grounding the liquid.
US10517194B2
Embodiments of the present disclosure include systems and methods for controlling the direction of cooling air flow across components of an electronic devices. An air-cooled electronic device includes: an air flow generator that is able to generate air flow in either first or second direction across the device; a sensor that measures first and second temperatures of air in the device when the air flows in the first and second directions, respectively; and a controller coupled to the mechanism and the sensor. The controller compares the first temperature to the second temperature and controls the air flow generator to generate the air flow in one of the first and second directions based on comparison of the first temperature to the second temperature.
US10517190B2
A fan module includes a first casing, a driving motor disposed in the first casing, a first rotor connected to the first driving motor, a second casing, a second rotor pivotally configured in the second casing, at least one guiding member and a shift apparatus connected to the first casing and the second casing, the first rotor includes a first rotating shaft and a plurality of first blades, the second rotor includes a second rotating shaft and a plurality of second blades, the guiding member is disposed on the first blade and the second blade. The whole height of the blade is adjusted by adjusting the distance between the two group blades, then the efficiency of the fan is improved effectively to optimize the noise level and the air flow.
US10517174B1
A rigid flex circuit comprised of high thermal conductivity sections, said sections having components disposed so as to have their contacts substantially planar with the surface of the thermally conductive section and wherein the contacts are interconnected directly to the traces without the use of solder and further having the thermally conductive sections interconnected to one another by means of flexible circuit sections.
US10517173B2
A display panel includes a first substrate and a second substrate; a source printed circuit board on the second substrate of the display panel, the source printed circuit board electrically connected to the display panel; a control printed circuit board electrically connected to the source printed circuit board by a signal cable; and a back cover accommodating the display panel including the first and second substrates and the source printed circuit board, and disposed between the source printed circuit board and the control printed circuit board, the back cover including a penetrating hole, through which the signal cable passes and maintaining a space by the signal cable with respect to the display panel, wherein the penetrating hole of the back cover is disposed at a mid-portion of the second substrate in a vertical direction.
US10517172B2
An embodiment of the present invention relates to a flexible printed circuit board (FPCB), which is applied to various electronic display devices, and may provide the FPCB, including a base, a first metal layer and a second metal layer on both surfaces of the base, a first plating layer on the first metal layer, a second plating layer on the second metal layer, and a first insulating pattern and a second insulating pattern respectively disposed on some region of the first plating layer and the second plating layer, wherein the first plating layer and the second plating layer may have different thicknesses.
US10517171B2
The present invention relates to a method for producing a flexible substrate. According to the method of the present invention, a flexible substrate layer can be easily separated from a carrier substrate even without the need for laser or light irradiation so that a device can be prevented from deterioration of reliability and occurrence of defects caused by laser or light irradiation. In addition, according to the method of the present invention, a flexible substrate can be continuously produced in an easier manner based on a roll-to-roll process.
US10517170B2
A multilayer board includes a flexible base material including laminated insulator layers and curved along an X-axis direction on a plane orthogonal or substantially orthogonal to a lamination direction, an interlayer connection conductor on the flexible base material, and a notch pair on the flexible base material at positions symmetrical or substantially symmetrical in the X-axis direction with respect to a position of the interlayer connection conductor, the notch pair extending in a Y-axis direction orthogonal or substantially orthogonal to the X-axis direction on the plane. The interlayer connection conductor is within a region defined by the notch pair and lines respectively joining ends of the notch pair in the Y-axis direction. A radius of curvature of a region of the flexible base material between the notch pair in the X-axis direction being greater than curvature radii of regions outside of the notch pair.
US10517153B2
A lighting device control system for controlling one or more lighting devices includes a first lighting device comprising an optical radiation source, and a portable electronic device. The portable electronic device includes a processor, a user interface, and a memory device. The memory device includes programming instructions to cause the processor of the portable electronic device to: cause the user interface to output a plurality of candidate optical characteristics for the optical radiation source and a user-selectable setting for at least some of the candidate optical characteristics, receive a selection of at least one of the candidate optical characteristics and an associated setting for each of the selected optical characteristics, generate a light operation request that comprises each of the one or more selected optical characteristics and its associated setting and an account identifier, and transmit the light operation request to the first lighting device.
US10517152B2
A method of operating a switching power converter includes operating the switching power converter in a boundary conduction mode when a switching frequency of a switch in the switching power converter is below a switching frequency threshold such than an on time of the switch is adjusted based on a desired output power of the switching power converter, and operating the switching power converter in a discontinuous conduction mode when the switching frequency of the switch is above the switching frequency threshold such that one or more of the on time of the switch and a switching period of the switch are adjusted based on the desired output power of the switching power converter and the on time of the switch is clamped at a minimum switch on time.
US10517150B1
A control method for signal transmission through voltage boosting and an application circuit therefor, wherein the control method comprises: performing voltage boosting processing on an input low-voltage signal by a supply voltage processing circuit, a low-voltage signal processing circuit and a modulation processing circuit, and outputting a high-voltage LED signal; and receiving the high-voltage LED signal by a high-voltage LED signal output circuit, performing high-voltage signal processing on the high-voltage LED signal by a high-voltage LED signal processing circuit, and outputting a control signal and a power supply which are mutually independent. The present invention increases the intensity and distance of signal propagation by performing voltage boosting processing on signals and then controlling LED lamp strings by the high-voltage LED signal processing circuit.
US10517146B2
Embodiments of the present invention generally relate to a rotation device in an RTP chamber. The rotation device includes a cylindrical inner race, a plurality of thrust bearings and a plurality of radial bearings. During operation, the bearings create a gas cushion preventing the rotating parts from contacting the stationary parts.
US10517141B1
A network system for accessing situation related information is disclosed. In one embodiment, the system includes a network connection for receiving an indication of an occurrence of a situation; a situational network formed based on the occurrence of the situation, the situational network including a plurality of participant devices determined to be geographically proximate to the situation, each of the participant devices corresponding to a participant in the situational network; a second network connection for presenting a roll call query to each of the plurality of participant devices soliciting a reply related to a status of the participant; a plurality of network connections established for receiving a status response from the participant devices; and a database for aggregating the status responses from responsive participants into a roll call list.
US10517129B2
The present disclosure relates to a Bluetooth pairing method and a Bluetooth device. One example method is applied to a first Bluetooth device, and the method includes: detecting a movement parameter of the first Bluetooth device during a movement; if the movement parameter meets a preset condition, enabling Bluetooth, and broadcasting a first query data packet to at least one Bluetooth device within an effective range; receiving a first query response data packet returned by the at least one Bluetooth device within the effective range; determining a to-be-paired Bluetooth device from the at least one Bluetooth device within the effective range based on first information included in the first query response data packet, where the first information includes at least one of first pairing indication information and RSSI information; and sending a pairing request to the to-be-paired Bluetooth device, to pair with the to-be-paired Bluetooth device.
US10517121B2
Embodiments of the present invention provide a service processing method, a related apparatus, and a system. The method includes: UE adds a service type indication of a service initiated by the UE to an RRC connection request and sends the RRC connection request to a base station, and adds the service type indication of the service initiated by the UE to a non-access stratum NAS request and sends the NAS request to a mobility management network element. In this way, when a network side performs congestion control or overload control, the base station may determine, according to the service type indication, that the service initiated by the UE is a voice service, a video service, or a short message service, accept the RRC connection request. Similarly, the mobility management network element may accept, according to the service type indication, the NAS request.
