摘要:
Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.