US08198907B2

A chip test fixture for assisting in examining a test chip on a printed circuit board includes a switching module, a pin cord and a magnetic unit. The switching module includes a standard chip and a switch element configured to turn on either the standard chip or the test chip. The pin cord is connected with the switch module at one end and is formed with a contacting head at the other end. The contacting head has a set of contact pins corresponding to that of the test chip. The magnetic unit is configured to draw the contacting head of the pin cord and the test chip together in such a way that the contact pins of the contacting head are in contact with that of the test chip once the contacting head approaches the test chip.
US08198898B2

A downhole drill string component is disclosed comprising a substantially cylindrical cage with a hollow bore. An inner diameter of the cage is slideably connectable to a mandrel. A stab connection originates from one end of the cage and a plurality of downhole drill string instruments is circumferentially disposed around an outer diameter of the cage.
US08198897B2

The magnetic field homogeneity adjusting device (20) is characterized by comprising a magnetic field distribution measuring unit (21) for measuring the magnetic field distribution in the magnetic field space, a temperature variation calculating unit (22) for calculating the temperature variation of the ferromagnetic bodies needed to improve the homogeneity of the magnetic field space based on the measured magnetic field distribution, and a temperature control unit (12) for setting a temperature control value of the ferromagnetic bodies according to the calculated temperature variation.
US08198896B2

A local coil facility is disclosed for a magnetic resonance tomography apparatus for examining an examination object. In at least one embodiment, the local coil facility includes at least one electronic processing system, a high frequency antenna, and an antenna housing to cover the high-frequency antenna and the at least one electronic processing system, the antenna housing having at least one wall close to the object and at least one wall away from the object. To reduce or even minimize the attenuation of PET radiation in a combined MR/PET device and thus in particular to ensure a better signal to noise ratio for the PET measurement, it is proposed according to at least one embodiment of the invention that the surfaces of the wall away from the object are essentially tangential to the examination object.
US08198894B2

An RF coil for MR Imaging that can change a resonance frequency easily and instantaneously in response to a nuclide to be imaged without exchange and adjustment and that also causes only small lowering of sensitivity. The RF coil has a sub coil for changing a resonance frequency of the transmitting/receiving RF coil for transmitting and receiving an MR signal between itself and a nuclide that is an object to be imaged. The sub coil is equipped with a switch, and at the time of switching-on, shifts the resonance frequency of the RF coil by changing an inductance value of the RF coil in a noncontact manner using inductance coupling.
US08198881B2

A chopper type DC-DC converter includes a voltage converting circuit, a comparative wave generating circuit, a comparator group, and a switch control circuit. The voltage converting circuit converts a first voltage into a second voltage. The comparative wave generating circuit generates first and second comparative waves such that the voltage range of the first comparative wave is different from the voltage range of the second comparative wave. The comparator group generates a first comparison result signal indicating a result of comparison between the first comparative wave and an error signal indicating an error between the second voltage and target voltage and a second comparison result signal indicating a result of comparison between the second comparative wave and the error signal. The switch control circuit controls the voltage converting circuit based on the first and second comparison signals. The comparative wave generating circuit includes first and second comparative wave generating circuits. The first and second comparative wave generating circuits respectively generate the first and second comparative waves based on different source voltage groups.
US08198875B2

Provided is a voltage regulator capable of securely preventing a reverse current from an output terminal (122) with lower current consumption, irrespective of magnitude of a voltage of a VDD terminal (121). Such a configuration is adopted that the voltage of the VDD terminal (121) and a voltage of the output terminal (122) of the voltage regulator are compared with each other with the use of a voltage generated between a transistor and a constant current circuit, to thereby reduce current consumption of a backup battery. Besides, such a configuration is also adopted that a gate of an output transistor is connected with the output terminal (122) based on an output of a comparator circuit, to thereby prevent the reverse current securely.
US08198868B2

A method and apparatus is disclosed to restore or recharge one or more cells of a battery. A switching module sources an element charging current from a first input voltage to the battery when a charging control signal is at a first logical level or sinks an element discharging current from the battery to a second input voltage when the charging control signal is at a second logical level. A controller module provides the charging control signal based upon a comparison of a reference voltage and a control voltage pulse, the control voltage pulse being generated by the controller module in response to a replica current, the replica current being proportional to the element charging current. A feedback module compares a voltage of the battery to a reference voltage to provide a charging error signal. A reference voltage generator module provides the reference voltage in response to the charging error signal, the reference voltage being proportional to a constant current and a duty-cycle of the switching charger when the charging error signal indicates a first mode of operation or a scaled representation of the constant current when the charging error signal indicates a second mode of operation.
US08198866B2

In one aspect, a handheld electric appliance includes: an oscillating electric motor or linear motor controlled by control circuitry; a battery connected to the oscillating electric or linear motor; and charge detection circuitry configured to determine a charging state of the battery. The charge detection circuitry is coupled to the control circuitry such that, in response to the charge detection circuitry determining that the charging state of the battery reaches a predetermined threshold, the control circuitry activates the oscillating electric motor or linear motor to cause noise generated by the motor to perceptibly change to indicate a threshold charging state.
US08198857B2

A common-mode voltage generator for a battery-supplied apparatus is provided with a battery voltage ripple-insensitive sensor comprising a voltage dividing circuit and a number of hysteresis comparators, by means of which a battery voltage, or a fraction thereof is compared with a series of reference voltages. These reference voltages are derived from an on-chip voltage by means of said voltage dividing circuit. The hysteresis of said hysteresis comparators is larger than the ripple on said battery voltage. Further there is an adjustable regulation loop. The sensor detects a battery voltage range and adjusts the regulation loop on the basis of this range. The regulation loop provides an output commonmode voltage, which is equal to a fraction, preferably half the battery voltage.
US08198847B2

A brushless motor system which can suppress adverse influences of electromagnetic noise without increasing the size and enhancing the performance of a filter circuit. In a brushless motor system comprising a brushless motor, an inverter, and a direct current power source, a noise return line for returning a noise current is connected between the brushless motor and the inverter. The noise current is generated in the inverter and reaches the brushless motor. With the provision of the noise return line, a common mode current leaking from the brushless motor to a ground can be reduced.
US08198841B2

A method of processing a resolver fault in a motor generator unit (MGU) includes receiving a position signal from a resolver describing a measured angular position of a rotor of the MGU, determining the presence of the resolver fault using the position signal, and calculating or extrapolating an estimated rotor position when the resolver fault is determined. A predetermined resolver fault state may be determined using a measured duration of the resolver fault, and the MGU may be controlled using the estimated rotor position for at least a portion of the duration of the resolver fault. A motor control circuit is operable for processing the resolver fault using the above method, and may automatically vary a torque output or a pulse-width modulation (PWM) of the MGU depending on the duration of the resolver fault.
US08198837B1

A DC motor control device calculates motor speed using determinations of motor field flux and armature voltage in the motor. The device includes a control module having one or more control inputs and one or more control outputs. At least one control input is configured to receive data representing field current measured in the DC motor. The control module includes flux curve logic that is responsive to measurements of motor field current to calculate a field flux in the motor. The flux curve logic uses a flux curve stored in the control module, the flux curve representing a functional relationship between field current and field flux in the motor. The flux curve is defined by a plurality of flux curve data points corresponding to a plurality of motor field currents within a lower current range and within an upper current range. The flux curve is further defined by at least a first flux curve line positioned within the lower current range and a second flux curve line positioned within the upper current range.
US08198834B2

An LED drive circuit that drives an LED is provided with: a rectifying circuit that converts an alternating voltage into a pulsating current; a constant current circuit; and an over-temperature protection portion that limits an output of the constant current circuit, wherein the LED and the constant current circuit are connected in series on an output side of the rectifying circuit.
US08198831B2

To stably illuminate an LED lamp even when an internally-excited electronic transformer is used in the power supply circuit, the full wave of the AC voltage supplied from the power supply circuit is rectified using a current rectifying circuit. When the power supply starts, current flows into a start-assist circuit for a specific period of time. Subsequently, when the fixed current load circuit begins operating, the current will flow into the fixed current load circuit. When the current flows into the LED driver, operation of the fixed current load circuit is stopped by a current-stopping circuit. Because the current flows into the lamp-lighting circuit across the entire voltage output even when an internally-excited electronic transformer is used in the power supply circuit, operation of the internally-excited electronic transformer will not stop and will not become unstable. When the LED is not connected, the fixed current load circuit is stopped.
US08198830B2

A current regulator includes a first current source to provide a reference current varying with a dimming step, and a second current source to generate a drive current for a white LED according to the reference current. The reference current and the dimming step have a relationship identical to or approximating a relationship between luminance and lightness perceived by human eyes. Thus, the white LED is controlled to have a linear variation of the luminance perceived by human eyes when the dimming step is changed.
US08198827B2

A dimmer switch has a user adjustable high-end trim. The dimmer switch includes a bidirectional semiconductor switch, such as a triac, for controlling the amount of power delivered from a source of alternating current power to a lighting load, such as an electric lamp. A user-adjustable timing circuit controls the conduction time of the triac from a minimum time to a maximum time. The maximum possible conduction time of the triac is the high-end trim. The minimum possible conduction time of the triac is the low-end trim. The timing circuit includes a user-accessible switch that allows a user to reduce the high-end trim from a first nominal level to a second reduced level, lower than the first level, without substantially affecting the low-end trim. The switch allows a user to switch a transient voltage suppressor into and out of parallel connection with a resistor that is part of an RC timing circuit for the triac. The dimmer switch advantageously uses less energy and the lifetime of the lamp is extended when the second reduced level of the high-end trim is selected.
US08198826B2

An illumination system including a master control unit, a device unit, a driving circuit unit, and an illumination unit is provided. The master control unit receives an input signal and outputs a control signal by performing a program operation processing to the input signal. The device unit analyzes the control signal so as to obtain a color temperature setting value and a brightness setting value, and generates two output signals according to the brightness setting value and two color temperature adjusting signals determined by the color temperature setting value. The illumination unit has at least two lamps with different color temperatures. The driving circuit unit receives and converts the two output signals so as to proportionally output two driving signals to respectively drive the two lamps. One of the two output signals is enabled after the other of the two output signals is disabled for a predetermined time.
US08198825B2

An illuminating module is capable of compensating current. The illuminating module can tune the light with a light modulating circuit. The illuminating module includes an illuminating unit and a compensating circuit. The illuminating unit includes a power source, a load impedance, and a level unit. The level unit has a level potential which changes with the light modulating circuit. The compensating circuit includes a first resistor, a first switch, and a judging unit. The first resistor is coupled to the power source. The first switch is coupled to the first resistor and the illuminating unit. The judging unit is coupled to the level unit and the first switch. When the level potential is less than a predetermined potential, the judging unit makes the first switch to be at the conducting state to parallel connect the first resistor and the load impedance.
US08198820B2

A dimmer switch for controlling the intensity of a dimmable screw-in compact fluorescent lamp provides smooth dimming of the fluorescent lamp and prevents flickering of the lamp due to multiple re-strikes. The dimmer switch prevents multiple re-strikes by avoiding multiple firings of a controllably conductive switching device of the dimmer circuit by limiting the high-end light intensity of the fluorescent lamp. Specifically, the dimmer switch limits the length of a conduction interval of the controllably conductive switching device to less than approximately 75% of each half-cycle. The dimmer switch may include a user-accessible adjustment actuator for changing the dimmer switch between an incandescent operating mode and a screw-in compact fluorescent mode. The dimmer switch may also be operable to automatically change the dimmer switch between the incandescent operating mode and the screw-in compact fluorescent mode by detecting the occurrence of the multiple firings of the controllably conductive switching device.
US08198816B2

An extra-high pressure mercury lamp includes an arc tube made of quartz glass. The lamp includes an arc tube portion and sealing portions connected to the arc tube portion, and encloses 0.15 mg/mm3 or more of mercury. A pair of electrodes are disposed face to face in the arc tube. Each electrode has a rod portion and a base end portion. The base end portion of each electrode is embedded in one of the sealing portions. One of the pair of electrodes serves as a cathode and includes a head portion, which has a larger diameter than the rod portion. A cylinder portion is connected to a rear end portion of the head portion. The cylinder portion extends in the axis direction of the electrode and surrounds the rod portion. The cylinder portion has an inner surface separated from the rod portion.
US08198814B2

The present invention relates to a high pressure sodium lamp comprising an evacuated cover including a base part, an arc tube comprising a first and a second electrode each being connected to the base part via conductor members. At least one conductor member is arranged isolated by a shielding member for preventing, during operation of the high pressure sodium lamp, the photo electronic stream from the at least one conductor member to the arc tube. The lamp comprises a second arc tube.
US08198809B2

An organic electroluminescence device including a substrate, an organic emitting device layer, a circuit board, a sealant and an electrical bonding layer is provided. The organic emitting device layer is on the substrate and has a first electrode layer, an emitting layer and a second electrode layer. The first electrode layer is disposed on the substrate, the emitting layer is disposed on the first electrode layer and the second electrode layer is disposed on the emitting layer. The circuit board is disposed over the substrate and covers the organic emitting device layer. The sealant is disposed between the substrate and the circuit board to seal the circuit board on the substrate. The electrical bonding layer is disposed between the substrate and the circuit board to electrically connect the circuit board and the first electrode layer of the organic emitting device layer.
US08198807B2

Hermetically-sealed packages for electronic components, e.g., OLEDs, are provided. The packages have a first glass substrate (12), a second glass substrate (16), and a wall (14) that separates the first and second substrates (12,16) and hermetically seals the electronic component (18) between the substrates (12,16). The package has a reduced outer unused area characterized by distances Dfirst (32a) and Dsecond (32b) at least one of which, and, in certain embodiments, both of which are less than 200 microns, e.g., one or both of Dfirst (32a) and Dsecond (32b) is approximately 100 microns. The reduction in unused area can be used to increase viewing area, improve electrical lead design, and/or increase package strength through the use of a wider sintered frit wall (14).
US08198806B2

Reducing the manufacturing cost of an EL display device and an electronic device furnished with the EL display device is taken as an objective. A textured structure in which projecting portions are formed on the surface of a cathode is used. External stray light is diffusely (irregularly) reflected by the action of the projecting portions when reflected by the surface of the cathode, and therefore a defect in which the face of an observer or the surrounding scenery is reflected in the surface of the cathode can be prevented. This can be completed without using a conventionally necessary high price circular polarizing film, and therefore it is possible to reduce the cost of manufacturing the EL display device.
US08198801B2

The present invention relates to a novel compound that can significantly improve the lifespan, efficiency and thermal stability of an organic light emitting device, and to an organic electroluminescence device or light emitting device comprising the compound in an organic compound layer is also disclosed.
US08198790B2

A plasma jet ignition plug having high ignition performance and high durability. The plasma jet ignition plug comprises a center electrode wherein at least a front end portion including a front end surface of the center electrode contains an oxide of at least one of the rare earth elements in a total amount of 0.5% by mass to 10% by mass inclusive and tungsten (W) in an amount of 90% by mass or greater, or contains iridium (Ir) in an amount of 0.3% by mass to 3% by mass inclusive and W in an amount of 97% by mass or greater.
US08198778B2

A rotary actuator includes a stator assembly positioned within an outer enclosure. A rotor assembly is positioned adjacent to the stator and is configured to rotate relative thereto and about a centerline axis of the rotary actuator. Each of the outer enclosure, the stator assembly, and the rotor assembly are arranged to carry a magnetic flux therethrough and form a flux path loop, such that as a magnetic flux flows through the outer enclosure, the stator assembly, and the rotor assembly, a torque is generated by rotation of the rotor assembly relative to the stator assembly.
US08198777B2

An automotive alternator includes a magnet holder that is composed of first and second magnet holder pieces. Each of the first and second magnet holder pieces is made of a nonmagnetic metal plate to have a one-piece structure. Each of the first and second magnet holder pieces includes a plurality of receiving portions, each of which receives a permanent magnet, and a plurality of connecting portions. All the receiving portions of the first magnet holder piece have the same orientation. Each of the connecting portions of the first magnet holder piece connects a circumferentially-adjacent pair of the receiving portions of the first magnet holder piece. All the receiving portions of the second magnet holder piece have the same orientation. Each of the connecting portions of the second magnet holder piece connects a circumferentially-adjacent pair of the receiving portions of the second magnet holder piece.
US08198767B2

A busbar unit includes a plurality of busbars including a first busbar and a second busbar, an insulating holder in which each of the busbars is arranged, and an insulating member. The holder preferably includes a first groove portion including a first opening portion arranged to receive the first busbar, and a second groove portion arranged adjacent to the first groove portion and including a second opening portion arranged to receive the second busbar. The first busbar includes a first terminal arm portion arranged to extend across the second busbar, and the insulating member is arranged between the first terminal arm portion and the second busbar.
US08198760B2

A mover includes a permanent magnet array having a plurality of permanent magnets that are magnetized in a direction perpendicular to a motion direction of the mover such that magnetic poles having different polarities alternately appear on magnetic pole surfaces of the plurality of permanent magnets in the motion direction. A stator includes first and second magnetic pole portion arrays and three excitation windings. Each of the magnetic pole portion arrays include a plurality of plate-like magnetic pole portions disposed on both sides of the permanent magnet array in the perpendicular direction. Each of the excitation windings is hollow-structured whereby two magnetic pole portions included in the first magnetic pole portion array and two magnetic pole portions included in the second magnetic pole portion array are located in an internal space of the coil and are excited by the corresponding one of the excitation windings.
US08198759B2

A battery pack connection scheme is shown that provides an optimum DC environment for every cell in the pack, such that every cell in the same or similar voltage level in the pack sees exactly the same voltage and current environment. In some examples, a portable pack is provided having a positive load connection terminal and multiple batteries connected in parallel to the terminal. Connections are made with segments preferably have matching impedances, or have matching DC resistances, creating a uniform DC environment. Portable pack designs are provided including chargers and inverters connected in the uniform DC environment.
US08198758B2

Provided are a standby power cut-off device for automatically cutting off standby power according to power-on/off of an electronic product and a control method for the standby power cut-off device. By providing an electronic product to which the standby power cut-off device and the control method therefor are applied, the present invention can efficiently cut off standby power by using an existing general outlet without a need to use an outlet having a separate function added thereto. Moreover, the present invention automatically cuts off the standby power according to power-off of the electronic product without unplugging the electronic product, thereby maximizing user's convenience.
US08198751B2

A semiconductor device of the present invention includes a plurality of switch cells having a switch transistor that controls conducting states of a global power supply line and a local power supply line according to a control signal, and a delay circuit that delays the control signal and transmits the control signal to the switch transistor connected to a subsequent stage, a chain unit that receives the control signal from outside, transmits the control signal by the delay circuit connected in series, and sequentially conducts the switch transistor, and a tree unit that is provided with the control signal via the switch cells disposed in a last stage of the chain unit, distributes the control signal to a plurality of groups by the delay circuit connected in parallel, and conducts the switch transistor in parallel by the distributed control signal.
US08198742B2

The present invention relates to an improved wind turbine, of the type which employs doubly fed induction generators (DFIG), and a wind park including the same, which permits the use of lighter weight turbines, with the ability to have greater energy capture, more precise control of asymmetrical phases and enhanced maintenance and support of the grid during fault conditions.
US08198734B2

A silicon-on-insulator (SOI) structure is provided for forming through vias in a silicon wafer carrier structure without backside lithography. The SOI structure includes the silicon wafer carrier structure bonded to a silicon substrate structure with a layer of buried oxide and a layer of nitride separating these silicon structures. Vias are formed in the silicon carrier structure and through the oxide layer to the nitride layer and the walls of the via are passivated. The vias are filled with a filler material of either polysilicon or a conductive material. The substrate structure is then etched back to the nitride layer and the nitride layer is etched back to the filler material. Where the filler material is polysilicon, the polysilicon is etched away forming an open via to the top surface of the carrier wafer structure. The via is then backfilled with conductive material.
US08198733B2

A semiconductor device includes a conductive pattern formed on a substrate, a conductive land formed to come into contact with at least part of the top surface of the conductive pattern, and a conductive section formed on the conductive land. The conductive section is electrically connected through the conductive land to the conductive pattern.
US08198732B2

A semiconductor device of the present invention includes an insulating film made of a low dielectric constant material having a smaller specific dielectric constant than SiO2, a wiring trench formed in the insulating film, a first barrier film made of SiO2 or SiCO formed at least on the side surface of the wiring trench, Cu wiring mainly composed of Cu embedded in the wiring trench, and a second barrier film made of a compound containing Si, O and a predetermined metallic element covering the surface of the Cu wiring opposed to the wiring trench.
US08198728B2

A semiconductor device includes a supporting base whereupon an electrode terminal is placed; an intermediate member mounted on said supporting base; a semiconductor element, a portion thereof being supported with said intermediate member, and placed on said supporting base; and a convex-shaped member which corresponds to the electrode terminal of said semiconductor element and placed on said supporting base or said intermediate member; wherein the electrode terminal of said semiconductor element and the electrode terminal of said supporting base are connected with a bonding wire.
US08198720B2

Microelectronic die packages, stacked systems of die packages, and methods of manufacturing them are disclosed herein. In one embodiment, a system of stacked packages includes a first die package having a bottom side, a first dielectric casing, and first metal leads; a second die package having a top side attached to the bottom side of the first package, a dielectric casing with a lateral side, and second metal leads aligned with and projecting towards the first metal leads and including an exterior surface and an interior surface region that generally faces the lateral side; and metal solder connectors coupling individual first leads to individual second leads. In a further embodiment, the individual second leads have an “L” shape and physically contact corresponding individual first leads. In another embodiment, the individual second leads have a “C” shape and include a tiered portion that projects towards the lateral side of the second casing.
US08198717B1

A memory device having die-stacking modules that are interchangeable within a Package-on-Package (PoP) and provide separate Chip Enable (CE) signals for all memory die in the die-stacking modules.
US08198712B2

A sealed semiconductor power module that may include a rectifier, such as a silicon controlled rectifier (SCR), is provided. The module includes an AlN substrate having a bottom surface positioned on a metallic base plate and a top surface that includes a first pad and a second pad, the substrate including a copper body on both of the two major surfaces. The module also includes a first die and a second die positioned on top of the first and second pads, respectively, the first die and the second die each including a main contact area on a top surface thereof, the first die including an isolated gate area on the top surface to which is coupled a gate terminal; and first and second power terminals in direct wirebondless electrical connection via molybdenum tabs with the main contact areas of the die.
US08198711B2

A lead frame includes a plurality of leads electrically connected to a semiconductor chip and a lead lock including a base layer disposed over the plurality of the leads and formed of a material having a coefficient of thermal expansion similar to that of inner leads. An adhesive layer is disposed between the base layer and the plurality of leads to fix the plurality of leads and adhere the base layer to the leads. At least one line electrically connects the semiconductor chip to the base layer of the lead lock. Since regions for bus bars are replaced by the lead lock and are removed, the lead frame can be miniaturized and has superior thermal stability and dimension stability.
US08198700B2

A semiconductor device structure includes a first type region and a second type region defined in a substrate, the first type region and second type region separated by one or more inter-well shallow trench isolation (STI) structures. At least one of the first type region and the second type region has one or more intra-well STI structures formed therein for isolating semiconductor devices formed within a same polarity well. The inter-well STI structures are formed at a substantially same depth with respect to the intra-well STI structures. A main well region is formed such that a bottom of the main well region is disposed above a bottom of the inter-well and intra-well STI features. One or more deep well regions couple the main well regions otherwise isolated by the intra-well STI structures, wherein the deep well regions are spaced away from the inter-well STI structures.
US08198697B2

An IGBT is disclosed which separated into two groups (first and second IGBT portions). First and second Zener diodes each composed of series-connected Zener diode parts are disposed so as to correspond to the groups respectively. Each of the first and second Zener diodes has an anode side connected to a corresponding one of first and second polysilicon gate wirings, and a cathode side connected to an emitter electrode. Temperature dependence of a forward voltage drop of each of first and second Zener diodes is used for reducing a gate voltage of a group rising in temperature to throttle a current flowing in the group and reduce the temperature of the group to thereby attain equalization of the temperature distribution in a surface of a chip. In this manner, it is possible to provide an MOS type semiconductor device in which equalization of the temperature distribution in a surface of a chip or among chips can be attained.
US08198696B2

This invention comprises manufacture of photovoltaic cells by deposition of thin film photovoltaic junctions on metal foil substrates. The photovoltaic junctions may be heat treated if appropriate following deposition in a continuous fashion without deterioration of the metal support structure. In a separate operation, an interconnection substrate structure is provided, optionally in a continuous fashion. Multiple photovoltaic cells are then laminated to the interconnection substrate structure and conductive joining methods are employed to complete the array. In this way the interconnection substrate structure can be uniquely formulated from polymer-based materials employing optimal processing unique to polymeric materials. Furthermore, the photovoltaic junction and its metal foil support can be produced in bulk without the need to use the expensive and intricate material removal operations currently taught in the art to achieve series interconnections.
US08198693B2

A solid-state image pickup apparatus includes: a substrate in which a charge generation portion that generates a signal charge is formed on a surface layer; a layer covering an upper surface of the substrate; a waveguide formed on the layer covering the upper surface of the substrate at a position corresponding to the charge generation portion; a hollow portion formed on the layer covering the upper surface of the substrate at a position on an outer side of the waveguide; and an optically-transparent layer formed on the layer covering the upper surface of the substrate such that at least the hollow portion becomes airtight.
US08198692B2

Spin torque magnetic integrated circuits and devices therefor are described. In an example, a spin torque magnetic device for a logic circuit includes a majority gate structure. An output is coupled to the majority gate structure. Three inputs are also coupled to the majority gate structure.
US08198678B2

A semiconductor device includes a source, a drain, and a gate configured to selectively enable a current to pass between the source and the drain. The semiconductor device includes a drift zone between the source and the drain and a first field plate adjacent the drift zone. The semiconductor device includes a dielectric layer electrically isolating the first field plate from the drift zone and charges within the dielectric layer close to an interface of the dielectric layer adjacent the drift zone.
US08198675B2

A silicon carbide semiconductor device having excellent performance characteristics and a method of manufacturing the same are obtained. An extended terrace surface is formed at a surface of an initial growth layer on a 4H—SiC substrate by annealing with the initial growth layer covered with an Si film, and then a new growth layer is epitaxially grown on the initial growth layer. A 3C—SiC portion having a polytype stable at a low temperature is grown on the extended terrace surface, and a 4H—SiC portion is grown on the other region. A trench is formed by selectively removing the 3C—SiC portion with the 4H—SiC portion remaining, and a gate electrode of a UMOSFET is formed in the trench. A channel region of the UMOSFET can be controlled to have a low-order surface, and a silicon carbide semiconductor device having high channel mobility and excellent performance characteristics is obtained.
US08198672B2

Monolithic, three dimensional NAND strings include a semiconductor channel, at least one end portion of the semiconductor channel extending substantially perpendicular to a major surface of a substrate, a plurality of control gate electrodes having a strip shape extending substantially parallel to the major surface of the substrate, the blocking dielectric comprising a plurality of blocking dielectric segments, a plurality of discrete charge storage segments, and a tunnel dielectric located between each one of the plurality of the discrete charge storage segments and the semiconductor channel.
US08198665B2

A semiconductor storage device includes: a substrate having a semiconductor layer at least on a surface thereof; and a plurality of quantum dot elements forming a charge storage layer formed above the semiconductor layer via a first insulating film that becomes a tunnel insulating film in such a manner that the quantum dot elements are connected with a bit line in series, wherein each quantum dot element forms a single electron memory.
US08198658B2

A device for detecting biomolecules includes: a semiconductor substrate; a source region and a drain region separately provided at the substrate; a chamber formed at the substrate including a region between the source region and the drain region, the chamber configured to contain a sample including the biomolecules; and an electrode which applies a voltage to the sample in the chamber. The biomolecules are mobile with respect to the electrode and sample. Methods for detecting biomolecules are also disclosed.
US08198657B2

A thin film transistor array panel includes an insulating substrate. A gate line is formed on the insulating substrate and has a gate electrode. A gate insulating layer is formed on the gate line. A semiconductor layer is formed on the gate insulating layer and overlaps the gate electrode. Diffusion barriers are formed on the semiconductor layer and contain nitrogen. A data line crosses the gate line and has a source electrode partially contacting the diffusion barriers and a drain electrode partially contacting the diffusion barriers and facing the source electrode. The drain electrode is on the gate electrode. A pixel electrode is electrically connected to the drain electrode.
US08198649B2

The present invention relates to a compound semiconductor substrate and a method for manufacturing the same. The present invention provides the manufacturing method which coats spherical balls on a substrate, forms a metal layer between the spherical balls, removes the spherical balls to form openings, and grows a compound semiconductor layer from the openings. According to the present invention, the manufacturing method can be simplified and grow a high quality compound semiconductor layer rapidly, simply and inexpensively, as compared with a conventional ELO (Epitaxial Lateral Overgrowth) method or a method for forming a compound semiconductor layer on a metal layer. And, the metal layer serves as one electrode of a light emitting device and a light reflecting film to provide a light emitting device having reduced power consumption and high light emitting efficiency.
US08198645B2

To provide a semiconductor light emitting device with a light extraction efficiency increased and a method for manufacturing the semiconductor light emitting device.A semiconductor light emitting device 1 includes a supporting substrate 2 and a semiconductor stack 6 including an MQW active layer 13 emitting light and an n-GaN layer 14 at the top. In the upper surface of the n-GaN layer 14 of the semiconductor attack 6, a plurality of conical protrusions 14a are formed. The protrusions 14a are formed so that an average WA of widths W of bottom surfaces of protrusions 14 satisfies: WA>=λ/n, where λ is wavelength of light emitted from the active layer and n is a refractive index of the n-GaN layer 14.
US08198642B2

A light emitting diode (LED) apparatus with temperature control and current regulation functions is provided. The LED apparatus includes at least one LED die and at least one temperature control and current regulation (TCCR) device. The TCCR device is electrically connected between the LED die and a power source, and is placed within an effective temperature sensing distance of the LED die, so as to sense temperature changes of the LED die. The resistance of the TCCR device is proportional to the temperature in a range of 25° C. to 85° C., i.e., the resistance increases with temperature. Moreover, the resistance difference of the TCCR device between 50° C. and 80° C. is greater than or equal to 100 mΩ.
US08198640B2

Provided is a semiconductor light emitting device and a method of fabricating the same. The semiconductor light emitting device comprises: a first conductive semiconductor layer; an active layer on the first conductive semiconductor layer; a second conductive semiconductor layer on the active layer; a second electrode part on the second conductive semiconductor layer; an insulation layer on the second electrode part; and a first electrode part on the insulation layer, a portion of the first electrode part being electrically connected to the first conductive semiconductor layer.
US08198632B2

A thin film transistor (TFT) substrate includes: a plurality of gate wirings; a plurality of data wirings insulatedly crossing the gate wirings to define a plurality of pixels; a plurality of common voltage lines formed along edges of pixels and mutually connected in an extending direction of the gate wirings; and a plurality of common electrodes formed at the pixel such that the plurality of common electrodes partially overlap with the common voltage line and mutually connected in an extending direction of the data wirings. A uniform common voltage can be stably applied on the entire surface of the TFT substrate.
US08198625B2

Provided are a transparent nonvolatile memory thin film transistor (TFT) and a method of manufacturing the same. The memory TFT includes source and drain electrodes disposed on a transparent substrate. A transparent semiconductor thin layer is disposed on the source and drain electrodes and the transparent substrate interposed between the source and drain electrodes. An organic ferroelectric thin layer is disposed on the transparent semiconductor thin layer. A gate electrode is disposed on the organic ferroelectric thin layer in alignment with the transparent semiconductor thin layer. Thus, the transparent nonvolatile memory TFT employs the organic ferroelectric thin layer, the oxide semiconductor thin layer, and auxiliary insulating layers disposed above and below the organic ferroelectric thin layer, thereby enabling low-cost manufacture of a transparent nonvolatile memory device capable of a low-temperature process.
US08198614B2

The present invention relates to a terahertz wave generator and a method of generating high-power terahertz waves using the terahertz wave generator. The terahertz wave generator includes a hollow spherical body, and a focusing lens installed in a cutout portion of the spherical body or an opening formed in the cutout portion, wherein an inner surface of the spherical body is coated with metal. In the method, frequencies having different levels are incident through the focusing lens or the opening to generate a plurality of air plasmas, and the air plasmas cause continuous focusing the metal-coated inner surface and hollow space of the spherical body, thus generating high-power terahertz waves. According to the present invention, a plurality of air plasmas is continuously generated, thus solving the problem in which the light intensity of terahertz waves generated using one air plasma is low.
US08198612B2

As disclosed herein, a device may comprise a substrate made of a material comprising silicon, the substrate having a first side and an opposed second side; an EUV reflective multi-layer coating overlaying at least a portion of the first side; an infrared absorbing coating overlaying at least a portion of the second side; and a system generating infrared radiation to heat the absorbing coating and the substrate.
US08198599B2

A detector system measures radioactive material. A fluid path receives at least one aliquot of radiopharmaceutical. The fluid path locates the aliquot within a positioner formed with a concave configuration. A detector is located at an axial distance from the concave surface and determines the level of radioactivity of the aliquot. Alternatively, the fluid path may be less concave and a variable attenuator may be placed between the fluid path and detector. The variable attenuator may have a concavity that is based on the concavity of the fluid path so that the detector's ability to read the radioactivity is optimized. A method for forming an aliquot of radiopharmaceutical in a concave fluid passage. Positioning a detector located a distance from the concave surface to optimize reading spectral energy of the aliquot and activity is determining activity regardless of the position of the aliquot in the passage.
US08198592B2

A measuring instrument has a light source for irradiating light including rays of light having the wavelength of excitation light, an objective lens for focusing light irradiated from the light source to a predetermined focusing position, a first mirror for directly reflecting light from the objective lens, a second mirror for reflecting light reflected by the first mirror, the second mirror having an aperture P, and a measuring device for measuring light generated from a sample and having a wavelength different from the wavelength of excitation light, and the sample being arranged between the first mirror and the second mirror, the focusing position of the objective lens being made to agree with the position of the aperture P, and the measuring device being adapted to measure light of a wavelength different from the wavelength of excitation light generated from the sample and passing through the aperture P.
US08198590B2

A method includes forming a plurality of mirror periods, stacking the mirror periods, and bonding the mirror periods together to form a high reflectance mirror. At least one of the mirror periods is formed by bonding a first semiconductor layer to a first side of a film layer (where the film layer is formed on a second semiconductor layer), forming an opening through the second semiconductor layer to expose the film layer, and cutting through the first semiconductor layer, the film layer, and the second semiconductor layer. The first semiconductor layer could include a high resistivity silicon wafer, the film layer could include an oxide film, and the second semiconductor layer could include a silicon wafer. The high resistivity silicon wafer could be approximately 110 μm thick, and the silicon wafer could be approximately 125 μm thick. The opening through the second semiconductor layer could be 1.25 cm to 1.75 cm in width.
US08198588B2

A computerized system for locating a device including a sensor module and a processor. A radioactive source, associated with the device, produces a signal in the form of radioactive disintegrations. The sensor module includes a radiation detector capable of receiving a signal from the source attached to the device. The sensor module produces an output signal. The processor receives output signal(s) and translates output into information relating to a position of source.
US08198586B2

A capillary column, and method for forming a capillary column, in which the capillary column comprises at least one porous segment at a terminus of the capillary column, wherein the at least one porous segment is formed by exposing the segment to one or more of a solution of acid, base, and a mechanical tool.
US08198579B2

A calibration device includes a structure, and a target object that is moveably coupled to the structure, the target object being a physical target towards which an alignment device can be aimed. A calibration device includes a block having a first opening, and a target object that is viewable through the first opening. A method of calibrating an alignment device includes determining a target position associated with a machine, placing a target object at the target position, and adjusting the alignment device using the target object. A calibration device includes a target object, the target object being a physical target towards which an alignment device can be aimed, wherein the target object comprises a first feature for indicating a first orientation of the target object.
US08198578B2

An apparatus includes an array of sub-diffraction limit-sized light receptors formed in a substrate having a light receiving surface. Each light receptor may be configured to output a binary valued bit element and to change state between an off-state and an on-state by the absorption of at least one photon. The apparatus further includes an optical filter structure disposed over the light receiving surface, the optical filter structure having of an array of filter pixels each having an associated passband spectral characteristic. A data element obtained from the array of sub-diffraction limit-sized light receptors is composed of a plurality of the bit elements output from a plurality of light receptors that underlie filter pixels having at least two different passband spectral characteristics.
US08198577B2

A pixel for the detection of electromagnetic radiation or impinging high energy particles, in particular for detecting X-ray photons, including a radiation receptor for converting the electromagnetic radiation or impinging high energy particles into a radiation signal, a converter for converting the radiation signal into a pulse train, and an analog accumulator for accumulating the pulses of a pulse train to an analog signal for readout. The analog accumulator is adapted such that the analog signal is non-linearly proportional to the pulse count. Such non-linear analog accumulator has the advantage of an large dynamic range.
US08198576B2

A 3-D LADAR imaging system incorporating stacked microelectronic layers is provided. A reference insert circuit inserts data into the FIFO registers at a preselected location to provide a reference point at which all FIFO shift register data may be aligned to accommodate for timing differences between layers and channels. The bin data representing the photon reflections from the various target surfaces are read out of the FIFO and processed using appropriate circuitry such as a field programmable gate array to create a synchronized 3-D point cloud for creating a 3-D target image.
US08198574B2

A digital camera includes a plurality of channels and a processing component operatively coupled to the plurality of channels. Each channel of the plurality of channels includes an optics component and a sensor that includes an array of photo-detectors. The processing component is configured to separately control an integration time of each channel, where a first integration time of a first channel is less than a second integration time of a second channel. The processing component is also configured to combine data from the plurality of channels to generate an image.
US08198572B1

A projectile has a pair of different parts with respective orientation sensors for detecting orientation, such as the roll position of the parts. The orientation sensors may be any of a variety of sensors, such as magnetometers, light sensors, infrared (IR) sensors, or ultraviolet (UV) sensors. Orientation events of the orientation sensors, such as maxima or minima of sensor output, are determined. The orientation events of the two sensors are compared to produce an alignment correction factor for correcting for misalignment of the parts relative to one another, that is to correct for differences in alignment between the sensors of the two parts. This allows (for example) instructions produced at one of the parts to be usable at the other of the parts.
US08198563B2

A socket structure includes a base; a slot, disposed on one end of the base and to be connected to one plug having one row of terminals; a tongue disposed on a front end of the base and within the slot so that chambers of the slot on two sides of the tongue may be normally and oppositely inserted and positioned into the slot; one row of first contacts separately arranged on one surface of the tongue, wherein each first contact is electrically connected to a first pin extending out of the base; and one row of second contacts separately arranged on the other surface of the tongue. Each second contact is electrically connected to a second pin extending out of the base. When the plug is inserted into the slot, the row of terminals of the plug are electrically connected to the row of first or second contacts.
US08198562B2

The invention relates to a vacuum switch, especially a vacuum circuit breaker, for medium and high voltages, comprising a mobile switch unit arranged inside a vacuum switch compartment (1) and provided with mutually mobile elements including a contact tappet (17), an insulator (18), and a driving or switching rod (11) introduced into the vacuum switch compartment (1) by means of metal bellows. Said vacuum switch also comprises a fixed contact inserted into the housing of the vacuum switch compartment (1). The upper end of the insulator (18) is fixed to the contact tappet (17), and the lower end of the insulator (18) is fixed to the driving or switching rod (11). The contact tappet (17) is connected to a conductor (8) by a flexible, electroconductive connection (20), said conductor being electroconductively connected to at least one laterally arranged output contact (6). The aim of the invention is to enable a simplified, more economical and improved design of a flexible conductive connection to the output contact. To this end, the inner cross-sectional surface of the vacuum switch compartment (1) is covered, at the level of the at least one output contact (6), around the contact tappet (17), by film-type or plate-type electroconductive covering elements (26) which are arranged over each other in layers and at least partially cover each other.
US08198557B2

An apparatus for preventing withdrawing and insertion of a carriage of a circuit breaker is disclosed. When a circuit breaker main body is inserted, an interlocking unit operates by interworking with the carriage withdrawing and inserting preventing apparatus, and while the circuit breaker is being closed, a withdrawal and insertion handle prevents a lead screw from being rotated by the interlocking unit. Thus, when the circuit breaker performs a closing operation, unnecessary withdrawing and inserting operation of the carriage is basically prevented to thus prevent various safety accidents, a contact resistance, a temperature increase, and damage to a device resulting from a breakdown.
US08198556B2

An installation switching device includes an insulating housing having a front face, and a switching handle disposed on the front face and configured to be operated by an operator and switched between a switched-on position and a switched-off position. The installation switching device also includes a slide fitted to the front face and moveable between a locked position and a released position. The slide is in the form of a frame and having at least one transverse web transverse to a movement direction of the slide and a holding projection configured to block any switching of the switching handle when the slide is in the locked position and to release the switching handle for switching when the slide is in the released position. The front face includes at least one structural element corresponding to the at least one transverse web. The installation switching device also includes a lead-sealing device configured to prevent movement of the slide from the locked position, wherein the at least one transverse web and the at least one structural element support the lead-sealing device.
US08198549B2

A multi-layer printed circuit board for mounting memories, includes: laminated wiring layers on which wiring is arranged; and a plurality of interlayer connection components which electrically connect at least two of the wiring layers. At least one of the plurality of interlayer connection components is a blind via-hole.
US08198547B2

A Z-directed signal pass-through component for insertion into a printed circuit board while allowing electrical connection from external surface conductors to internal conductive planes or between internal conductive planes. The Z-directed pass-through component is mounted within the thickness of the PCB allowing other components to be mounted over it. The body may contain one or more conductors and may include one or more surface channels or wells extending along at least a portion of the length of the body.
US08198546B2

A method of manufacturing a printed wiring board includes preparing a wiring substrate having a conductive circuit, coating a solder-resist layer over the conductive circuit, leveling a surface of the solder-resist layer so as to obtain a maximum surface roughness in a predetermined range, removing the resin film from the surface of the solder-resist layer, and forming multiple openings in the surface of the solder-resist layer to expose multiple portions of the conductive circuit so as to form multiple conductive pads for mounting an electronic components.
US08198542B2

An FPCB and a method of manufacturing the same, in which an electrical signal-conductive portion of the FPCB is subjected to little stress so as not to be broken by fatigue in spite of repeated bending of the FPCB, thereby increasing the lifetime of the FPCB.
US08198531B2

The present invention discloses a solar cell having a multi-layered structure that is used to generate, transport, and collect electric charges. The multi-layered nanostructure comprises a cathode, a conducting metal layer, a photo-active layer, a hole-transport layer, and an anode. The photo-active layer comprises a tree-like nanostructure array and a conjugate polymer filler. The tree-like nanostructure array is used as an electron acceptor while the conjugate polymer filler is as an electron donor. The tree-like nanostructure array comprises a trunk part and a branch part. The trunk part is formed in-situ on the surface of the conducting metal layer and is used to provide a long straight transport pathway to transport electrons. The large contact area between the branch part and the conjugate polymer filler provides electron-hole separation.
US08198526B2

Electronic game components are described. The electronic game components may define radiation striking zones in which user strikes may be detected. In response to detecting the strikes, control signals for an audio generator or gaming console may be generated. The electronic game components may be used to simulate percussive instruments, with the radiation striking zones corresponding to percussive components of the simulated percussive instrument.
US08198524B2

An apparatus for signal processing, wherein a disc is placed on a turntable and is provided with a groove which can be followed by the pick-up element, and employing a time-code signal wherein during use of the disc the said time-code signal controls the digital audio source.
US08198523B1

A universal music stand slip-cover combination pocket folder keeps music, papers, books and accessories securely on a music stand. One embodiment has a durable, sturdy yet pliant slip-cover (20) with an attached pocket folder (22) that fits onto a standard flat desk music stand. The slip-cover combination pocket folder has a stabilizer (16) sandwiched within the embodiment to help it maintain its shape. The front pocket folder (22) of the universal music stand slip-cover makes the placement of music, papers, books, and accessories on a music stand very convenient, so a transfer of loose music from book bag to music stand and back is unnecessary. The retaining straps (26a, 26b) attached to the pocket folder (22) keep viewable music on the stand. The slip-cover (20) has a tab flap (34) on the back panel (14) that allows it to adapt to any folding music stand design thus making it universal. The Universal Music Stand Slip-Cover Combination Pocket Folder fits easily into a backpack or can be carried with a carrying strap. The slip-cover gives a more formal appearance on the concert stage, extends the life of a music stand and covers up music stand imperfections. Other embodiments are described and shown.
US08198520B1

A novel maize variety designated X7S502 and seed, plants and plant parts thereof, produced by crossing Pioneer Hi-Bred International, Inc. proprietary inbred maize varieties. Methods for producing a maize plant that comprises crossing maize variety X7S502 with another maize plant. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X7S502 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby. This invention relates to the maize variety X7S502, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X7S502. This invention further relates to methods for producing maize varieties derived from maize variety X7S502.
US08198518B1

A novel soybean variety, designated XB27N10 is provided. Also provided are the seeds of soybean variety XB27N10, cells from soybean variety XB27N10, plants of soybean XB27N10, and plant parts of soybean variety XB27N10. Methods provided include producing a soybean plant by crossing soybean variety XB27N10 with another soybean plant, methods for introgressing a transgenic, mutant trait, and/or native trait into soybean variety XB27N10, methods for producing other soybean varieties or plant parts derived from soybean variety XB27N10. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XB27N10 are further provided.
US08198514B2

The invention provides seed and plants of melon hybrid Bucanero and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of melon hybrid Bucanero and the parent lines thereof, and to methods for producing a melon plant produced by crossing such plants with themselves or with another melon plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.
US08198508B2

The present embodiments relate to methods of identifying and creating human or humanized antibodies that possess a reduced risk of inducing a Human Anti-Human Antibody (HAHA) response when they are applied to a human host. Other methods are directed to predicting the likelihood of a HAHA response occurring. Methods for screening for anti-HAHA compounds are also included. Methods for determining if various conditions for administering an antibody to a subject enhance or suppress a HAHA response are also included. Some embodiments herein are directed to transgenic mouse embodiments relevant for HAHA responses.
US08198504B2

In a tampon pledget, a quantity of moisture activated material is positioned in contact with, or adjacent to a layer of absorbent material used in forming the pledget. Upon contact with menses, the moisture activated material reacts in one of an endothermic and exothermic manner so that in use, the pledget, when forming part of a tampon can thermally alert a wearer when the pledget has reached its absorbent capacity.
US08198502B2

The invention is an adsorptive separation process for producing a para-xylene product from a feed stream comprising para-xylene, at least one other C8 aromatic, and a C9 aromatic. An adsorbent comprising X or Y zeolite and a desorbent comprising para-diethylbenzene (p-DEB) are used in an adsorptive separation zone to produce an extract stream comprising para-xylene, p-DEB, and the C9 aromatic and a raffinate stream comprising the at least one other C8 aromatic, the C9 aromatic, and p-DEB. The extract stream is separated in an extract distillation zone to produce a second desorbent stream comprising the C9 aromatic and p-DEB and the raffinate stream is separated in a raffinate distillation zone to produce a third desorbent stream comprising the C9 aromatic and p-DEB. At least a portion of at least one of the second desorbent stream and the third desorbent stream is further separated in a desorbent distillation zone to produce a stream comprising the C9 aromatic.
US08198493B1

Improved, fuel-efficient systems are provided for the processing of biomass, such as wood or crop residues, food waste or animal waste in order to selectively obtain thermally processed final products, such as a combination of torrefied and carbonized final products. The processes involve thermally drying incoming biomass using a dryer employing the hot gas output of a fuel-operated burner. Next, the dried product is torrefied in an indirect torrefaction reactor so as to evolve light volatile organic compounds which are used as a gaseous fuel source for the burner. Some or all of the torrefied product can be recovered, or some or all of the torrefied product is then directed to a separate carbonization reactor coupled with a reactor burner. Carbonization serves to remove most of the remaining VOCs which are used as a gaseous fuel input to the dryer.
US08198487B2

The present invention relates to a process for lithium exchange reactions comprising mixing at least two fluids in a microreactor having at least two injection points.
US08198480B2

This invention provides a novel compound which can be properly used as a surfactant, a method of producing a fluoropolymer, surfactant and a fluoropolymer aqueous dispersions using the novel compound. This invention is a fluoroalkylcarboxylic acid derivative which is represented by the general formula (i): Rf1(OCH2CF2CF2)n1OCX1X2CF2(Rf2)n2COOM  (i) wherein Rf1 represents a straight or branched fluoroalkyl group containing 1 to 20 carbon atoms, which fluoroalkyl group may optionally contain 1 to 5 oxygen atoms in the principal chain thereof, Rf2 represents a straight or branched fluoroalkylene group containing 1 to 25 carbon atoms, said fluoroalkylene group may optionally contain 1 to 5 oxygen atoms in the principal chain thereof, n1 represents an integer of 0 to 3, n2 represents an integer of 0 or 1, X1 and X2 are the same or different and each represents hydrogen atom or fluorine atom, and M represents NH4 or a monovalent metal element.
US08198475B2

The present invention provides an efficient production method suitable to industrial-scale production not requiring column purification for adamantyl (meth)acrylates having an adamantine skeleton having utility in crosslinked resins, optical fibers, optical waveguides, optical disc substrates and other optical materials.
US08198474B2

The present invention provides methods for preparing TLR-4 receptor agonist E6020: and stereoisomers thereof, which compounds are useful as an immunological adjuvants when co-administered with antigens such as vaccines for bacterial and viral diseases. Also provided are synthetic intermediates useful for implementing the inventive methods.
US08198469B2

The present invention provides crystalline forms of Tigecycline, and methods of for preparation of crystalline forms and amorphous.
US08198466B2

The present invention relates generally to substituted benzofurans, benzothiophenes, and indoles and their use as tubulin polymerization inhibitors.
US08198462B2

The present invention relates to a dendritic photoactive compound that comprises oxime ester and a method for producing the same. Since the compound according to the present invention comprises two or more oxime ester groups and chromophores in one molecule at the same time, the solubility in respects to the organic solvent and the efficiency for producing a radical by absorbing ultraviolet rays are excellent. In addition, it can act as an effective initiator in respects to the photopolymerization of the unsaturated group, in particular, the acryl compound.
US08198461B2

The present invention provides compounds and methods that can be used to convert 1,2,4-triazole-3-carboxamides to the corresponding 3-cyano-1,2,4-triazoles reliably in one step, with high yields and without the need for elaborate purification.
US08198447B2

A fused tricyclic compound having aldose reductase inhibitory activity and shown by the following formula, wherein R1 represents 1 to 3 atoms or substituents selected from a hydrogen atom, a halogen atom, a substituted or unsubstituted alkyl, cycloalkyl, alkylene, or alkoxy group, and a protected or unprotected hydroxyl or carboxyl group, R2 represents a protected or unprotected carboxyl group, R3 represents 1 or 2 atoms or substituents selected from a hydrogen atom, a halogen atom, an oxo group, a substituted or unsubstituted alkyl or alkoxy group, and a protected or unprotected carboxyl group, A represents an alkylene group, and B represents an oxygen atom, a sulfur atom, or a group shown by the following formula, wherein R4 represents an alkyl or aryl group substituted by an aryl, cycloalkyl, or heterocyclic group, and X represents an oxygen atom or a sulfur atom, provided that, when B represents a group shown by the following formula: wherein R4 represents an alkyl or aryl group substituted with an aryl, cycloalkyl, or heterocyclic group, X represents a sulfur atom.
US08198444B2

Disclosed are methods for making aldehydes and ketones comprising allowing the corresponding primary or secondary alcohol to react in the presence of trichoroisocyanuric acid, a compound of formula R1SR2 and a base. In one embodiment, the alcohol is a compound of formula (I): wherein R3 is a protecting group. Also disclosed are methods for making 3-O-protected morphine dienol carboxylates comprising allowing a compound of formula (I) to oxidize in the presence of a chlorine-containing compound and a compound of formula R1SR2; and allowing the product of the oxidation step to react with an acylating agent.
US08198440B2

The present invention is directed to phosphonic acid compounds useful as serine protease inhibitors, compositions thereof and methods for treating inflammatory and serine protease mediated disorders.
US08198438B2

The invention provides compounds of formula I and pharmaceutically acceptable salts thereof. The formula I compounds inhibit tyrosine kinase activity thereby making them useful as anti-cancer agents and for the treatment of Alzheimer's Disease.
US08198435B2

The invention relates to a new crystalline form II of N-benzoyl-staurosporine; compositions containing the same; processes for the preparation thereof; and the use of crystalline form II of N-benzoyl-staurosporine in diagnostic methods or therapeutic treatment of warm-blooded animals, especially humans. The invention relates to the amorphous forms of N-benzoyl-staurosporine; compositions containing the same; processes for the preparation thereof; and the use of amorphous N-benzoyl-staurosporine in diagnostic methods or therapeutic treatment of warm-blooded animals, especially humans.
US08198434B2

The invention is directed to an improved process for preparing cefsulodin sodium. The process involves: (i) dissolving cefsulodin in a solvent comprising an organic solvent to provide a solution of cefsulodin, (ii) adding about 1 equivalent of a sodium salt of a base to the solution of cefsulodin to provide a solution of cefsulodin sodium, and (iii) separating the cefsulodin sodium from the solution of cefsulodin sodium.
US08198427B1

Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for CTNNB1.
US08198422B2

This invention provides compositions and methods for detecting HPV in a sample. This invention also provides related kits, systems, and computers.
US08198420B2

The present invention relates to synthetic compounds that are active on plants, especially as legume nodulation factors, and also as plant growth stimulators, and to methods for preparing such compounds, which are of formula (I).
US08198418B2

A novel nucleoside triphosphate derivative, a nucleic acid probe, and a multilabeled nucleic acid probe that can detect a target nucleic acid conveniently and with high sensitivity, as well as a method for producing the multilabeled nucleic acid probe, and a method for detecting a target nucleic acid using the multilabeled nucleic acid probe or the nucleic acid probe. A target nucleic acid can be detected conveniently and with high sensitivity by using a transglutaminase (TGase), and by using a multilabeled nucleic acid probe in which a plurality of labeling portions have been introduced in advance by covalent binding, or by introducing a plurality of labeling portions by covalent binding into a nucleic acid probe that has been hybridized with the target nucleic acid.
US08198416B2

Isolated monoclonal antibodies or an antigen binding portion thereof which bind to prostate specific membrane antigen in its native form occurring on the surface of tumor cells characterized in that it is linked to a label or a cytotoxic agent or constructed as a part of a bispecific antibody or a recombinant diabody.
US08198401B2

Antigenic peptides that bind to MHC Class II molecules with the shared epitope referred to as HLA-DR molecules are disclosed. More specifically, are citrullinated antigenic peptides having an increased affinity for HLA-DR molecules and associated with Rheumatoid Arthritis. These novel peptides provide the basis for new methods of diagnosis and treatment of Rheumatoid Arthritis.
US08198391B2

There is provided a pigment dispersion including water, an aqueous polymer and a pigment as essential components, wherein the aqueous polymer is a carboxyl group-containing polyurethane which is formed by reacting a diol compound, a diisocyanate compound and a reaction product, which is mainly composed of a compound represented by general formula (1) and prepared by reacting a diol compound having one or two carboxyl groups within each molecule with a diisocyanate compound and which also has a reaction index as calculated by (Formula 1) within a range from 0.95 to 1.10. Reaction index=(reaction rate of isocyanate group)×[(number of moles of diisocyanate compound(B))/(number of moles of diol compound(A))]  (Formula 1)
US08198387B2

Provided is a proton-conducting compound which provides proton conductivity without humidification and is suitable for electrochemical device materials such as solid electrolytes for fuel cells and electrolytes for batteries. Provided also is a proton-conducting polymer. The proton-conducting compound is composed of a melamine compound salt obtained from a melamine compound represented by the following formula (1) and a Bronsted acid and the proton-conducting polymer is obtained by homopolymerizing or copolymerizing the melamine compound salt. In formula (1), R1, R2, R3, R4, and R5 each is independently an alkyl group, an aryl group, an alkenyl group, a heterocyclic group, or a hydrogen atom; at least one of them is a group other than hydrogen; R2 and R3 or R4 and R5 may join together to form a heterocyclic structure; and the alkyl group, the aryl group, the alkenyl group, or the heterocyclic group may have a substituent. A melamine compound salt wherein R1 is CH2═CR6—CO—O(CH2)n— polymerizes to yield a proton-conducting polymer. In this particular R1 group, R6 is hydrogen or an alkyl group and n is an integer equal to or larger than 1.
US08198381B2

Disclosed is a phenol aralkyl epoxy resin having a structure wherein at least a phenol or a naphthol is bound by using an aralkyl group as a linking group and a structure represented by formula (1) below, while satisfying the condition 1 below. This epoxy resin is excellent in workability during production of a composition and is easy to control quality. Condition 1: The following relation (α) is satisfied with A being the hydroxyl equivalent (as measured in accordance with JIS K 0070) of a phenol-modified epoxy resin obtained by adding an equivalent molar amount of phenol relative to the epoxy equivalent of the epoxy resin, and B being the epoxy equivalent of the epoxy resin. 50≦1000×(A−B)/B≦250 (α).
US08198377B2

Disclosed are a thermal fluidity modifier for a powder coating material, which contains a polymer containing t-butyl(meth)acrylate units and having a glass transition temperature (Tg) of 20 to 120° C. as calculated by the following equation (1): 1/Tg=Σ(wi/Tgi)  (1), wherein wi represents a mass fraction of monomer i which constitutes the polymer and Tgi represents a glass transition temperature of a homopolymer of the monomer i; and a powder coating material containing the thermal fluidity modifier.
US08198372B2

Vulcanizable fluoroelastomer compositions comprising: A) a fluoroelastomer matrix based on vinylidene fluoride (VDF) with a Mooney viscosity (1+10) at 121° C. of less than 35 MU (Mooney Units) measured according to ASTM standard D 1646; and B) a semi-crystalline fluoropolymer, in an amount of from 20% to 70% by weight relative to the total weight of A)+B), the semi-crystalline fluoropolymer being constituted of tetrafluoroethylene (TFE) homopolymers and copolymers of TFE with one or more monomers containing at least one unsaturation of ethylenic type, in an amount of from 0.01 to 10 mol %, said semi-crystalline fluoropolymer having a mean particle size between 10 and 400 nm.
US08198370B2

The present invention relates to a substrate coated with a coating composition wherein the coating composition comprises a crosslinkable component and the crosslinkable component is a mixture of two different and optionally three different acrylic polymers. Each acrylic polymer has functional groups present that are reactive with a crosslinking component. The functional groups present on each polymer have different rates of reactivity with the crosslinking component.
US08198369B2

One exemplary embodiment of the invention includes grafting a thermoplastic hot melt adhesive material to a shape memory polymer surface.
US08198363B2

Biocompatible phase invertible proteinaceous compositions and methods for making and using the same are provided. Phase invertible compositions in accordance with the invention are prepared by combining a liquid proteinaceous substrate and a liquid crosslinking composition, where the liquid crosslinking composition includes a macromolecular crosslinking agent. Also provided are kits for use in preparing the subject compositions. The subject compositions, kits and systems find use in a variety of different applications.
US08198359B2

The present invention relates to a novel multi-functional nanocomposite additive made from rare earth element complex modified organic clay which is called MFNA and methods for making and using the same, particularly in applications of coating manufacture industry. Such MFNA-modified coatings have desired features and improved physical and mechanical properties comparing the current available coatings.
US08198357B2

Described is a method for producing a molded silicone rubber product using a liquid silicone rubber (LSR) base comprising at least one vinyl siloxane polymer, at least one hydride crosslinker, and optionally at least one injection molding inhibitor. The single LSR base is fed into a feed line, and into the feed line are fed an inhibitor master batch comprising at least one liquid injection molding inhibitor and at least one vinyl siloxane polymer, and a catalyst master batch comprising at least one catalyst and at least one vinyl siloxane polymer. The invention is further directed to: said LSR base; said inhibitor master batch; said catalyst master batch; and a molded silicone rubber article produced by the methods and compositions described herein.
US08198355B2

The invention is directed to nanocomposite compositions that contain at least one thermoplastic polyamide and unmodified sepiolite-type clay nanoparticles. It, also, includes articles containing such compositions.
US08198347B2

A high thermal-conductive, halogen-free and flame-retardant resin composition used as a dielectric layer of a printed circuit board comprises 5% to 70% of phosphorus-containing epoxy resin, at most 50% of multifunctional or bifunctional epoxy resin, 1% to 20% of curing agent, 0.01% to 10% of accelerant, at most 20% of inorganic powder, 5% to 85% of high thermal conductivity powder and 0.01% to 10% of processing aids, which resin composition has excellent thermal conductivity, heat resistance and flame retardancy as well as being environmentally friendly for free of halogen flame retardant and no toxic or corrosive gases when burning; the resin composition is used to form as a high thermal-conductive prepreg by impregnation or form as a high thermal-conductive coating by coating and then further used as a dielectric layer on a printed circuit board for demonstrating if electronic components formed thereon the printed circuit board has high thermal-conductivity and efficient heat dissipation capable of improving long service life and enhanced stability of electronic components.
US08198340B2

Alkenyl aromatic polymer foam comprising a polymer matrix containing one or more polymer and defining a plurality of cells having an average cell size wherein: (a) the alkenyl aromatic polymer foam has: —(i) an average cell size that is in a range of 0.02 and 5 millimeters; —(ii) a density of 64 kilograms per cubic meter or less; —(iii) an open cell content less than 30 percent; and —(iv) a cell size variation of 30% or less; and wherein the foam further comprises one or more fluorinated alkene blowing agent at a concentration of 0.03 moles or more and 0.3 moles or less per 100 grams of polymer foam.
US08198328B2

The present invention provides a method of treating cancer using benzoic acid derivatives, alone or in combination with standard treatments such as chemotherapy and radiotherapy. Also provided are methods of screening for benzoic derivatives based on their ability to inhibit the enzyme tyrosinase or to bind to and activate PXR/SXR xenobiotic receptors.
US08198325B2

Disclosed are unsaturated alkyl esters of 5-aminovulinic acid of the following chemical formula 1, or pharmaceutically acceptable salts thereof, a method for preparing the same, and uses thereof. [Chemical Formula I] NH2—CH2—CO—CH2—CH2—CO—O—R wherein, R is a group selected from a group consisting of 2-propenyl, 3-butenyl, 4-pentenyl, 5-hexenyl, cis-2-pentenyl, cis-3-hexenyl, cis-4-hexenyl, and trans-2-hexenyl. Also, a pharmaceutical composition comprising the unsaturated alkyl ester of 5-aminovulinic acid or a salt thereof as an active ingredient is provided. This pharmaceutical composition is easily absorbed transdermally and is of low cytotoxicity. Featuring no amino-protecting processes, the method guarantees high production yields.
US08198313B2

This invention is directed to indolone derivatives which are antagonists for the GALR3 receptor. The invention provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of the invention and a pharmaceutically acceptable carrier. This invention also provides a pharmaceutical composition made by combining a therapeutically effective amount of a compound of the invention and a pharmaceutically acceptable carrier. This invention further provides a process for making a pharmaceutical composition comprising combining a therapeutically effective amount of a compound of the invention and a pharmaceutically acceptable carrier.
US08198299B2

The present invention provides a compound of general Formula (I) having histone deacetylase (HDAC) inhibitory activity, a pharmaceutical composition comprising the compound, and a method useful to treat diseases using the compound.
US08198296B2

Compounds, pharmaceutical compositions including the compounds, and methods of preparation and use thereof are disclosed. The compounds are amide, ketone, and ester compounds prepared from certain azabicycloalkane carboxylic acids. The resulting compounds exhibit selectivity for, and bind with high affinity to, neuronal nicotinic receptors of the α4β2 subtype in the central nervous system (CNS). The compounds and compositions can be used to treat and/or prevent a wide variety of conditions or disorders, such as those disorders characterized by dysfunction of nicotinic cholinergic neurotransmission, including disorders involving neuromodulation of neurotransmitter release, such as dopamine release. CNS disorders, which are characterized by an alteration in normal neurotransmitter release, are another example of disorders that can be treated and/or prevented. The compounds can: (i) alter the number of nicotinic cholinergic receptors of the brain of the patient, (ii) exhibit neuroprotective effects, and (iii) when employed in effective amounts, not result in appreciable adverse side effects (e.g. side effects such as significant increases in blood pressure and heart rate, significant negative effects upon the gastrointestinal tract, and significant effects upon skeletal muscle).
US08198291B2

The present invention relates to pharmaceutical compositions for intranasal administration to a mammal that contain an effective amount of an opioid, a liquid nasal carrier for the opioid, and optionally a sweetener, flavoring agent or masking agent. In some embodiments of the present invention, the pharmaceutical compositions have improved bioavailability. In other embodiments of the present invention, the opioid compositions improve patient compliance.
US08198288B2

The subject invention provides compounds of formula (1): including monomers and multimers thereof that are inhibitors of human neutrophil elastase (HNE) activity and are useful in the treatment of diseases or conditions in which HNE plays a part.
US08198286B2

The present invention relates to sodium channel blockers. The present invention also includes a variety of methods of treatment using these inventive sodium channel blockers.
US08198285B2

The invention concerns pyrazine derivatives of the Formula I or pharmaceutically-acceptable salts thereof; wherein each of n, m and R has any of the meanings defined hereinbefore in the description; processes for their preparation, pharmaceutical compositions containing them and their use in the manufacture of a medicament for use in the treatment of bone-related disorders or conditions.
US08198282B2

This invention relates to substituted azaquinazolines, to a process for their preparation, to pharmaceutical compositions containing them, and to their use for the treatment and/or prophylaxis of diseases, especially for use as antiviral agents, in particular against cytomegaloviruses.
US08198278B2

Besylate salts of (6-(5-chloro-2-pyridyl)-5-[(4-methyl-1-piperazinyl) carbonyloxy]-7-oxo-6,7-dihydro-5H-pyrrolo[3,4-b]pyrazine) are provided.
US08198266B2

The present invention relates to uses, methods and compositions for treating immune-mediated glomerulonephritis, such as crescentic glomerulonephritis. More specifically, the invention relates to the use of an EFGR antagonist or of an inhibitor of EGFR or HB-EGF expression for the treatment of said diseases.
US08198262B2

Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed.
US08198258B2

The invention relates to a double-stranded compound, preferably an oligoribonucleotide (siRNA), which down-regulates the expression of a human TGaseII gene at the post-transcriptional level. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from a fibrotic disease such as pulmonary, kidney and liver fibrosis or ocular, scarring comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The invention also relates to treatment of fibrotic and other diseases by use of antibodies to TGaseII polypeptide.
US08198257B2

The invention relates to a viral vector for treating Alzheimers disease, which vector comprises a cholesterol 24-hydroxylase (CYP46A1) encoding nucleic acid. In a preferred embodiment, the viral vector may be an Adeno-Associated-Virus (AAV) vector, preferably an AVV5 vector. The vector may be useful for the manufacture of a pharmaceutical composition for the treatment of Alzheimers disease in a subject, wherein the vector is to be administered directly into the brain of the subject or by intravenous or intrathecal injection.
US08198251B2

Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
US08198244B2

The present disclosure is generally related to methods of inducing non-palmoplantar skin to develop a palmoplantar phenotype, for example, methods for increasing skin thickness, decreasing skin pigmentation, and/or decreasing hair growth. In particular, disclosed herein are methods of using topical administration of DKK1 to increase skin thickness, decrease skin pigmentation, or reduce hair growth. Also disclosed are topical DKK1 compositions for inducing non-palmoplantar skin to develop a palmoplantar phenotype.
US08198229B2

The present specification discloses TVEMPs, compositions comprising such toxins and methods of treating urogenital-neurological disorders in a mammal using such TVEMPs and compositions.
US08198226B2

A color change paint and varnish removal formulation is provided. The formulation comprises: at least one penetrant, at least one water insoluble carrier, at least one color visible colorant, at least one thickening agent, at least one wetting agent, and at least one activator, whereby the formulation is applied to the target area and as the surface of the formulation dries, the penetrant migrates away from the dehydrating surface and a surface crust of beads is formed; the beads have a particle size that allows the scattering of visible light into white light and produces the whitening and dilution of the visible color and thus, there is a color change to indicate that the stripping action of the formulation has ceased and is ready for the scraping and removal step.
US08198220B2

The disclosed compositions and methods utilize hydrophilic polymers modified by the incorporation of one or more hydrophilic side groups. The polymers may exhibit physical association in solution at a specific temperature so as to provide a significant increase in viscosity at the specific temperature. The viscosity of such systems is substantially increased by the further inclusion of one or more hydrophilic components that may exhibit physical association in solution at one or more temperature trigger points and also associate with the one or more hydrophilic polymers modified by the incorporation of one or more hydrophilic side groups.
US08198211B2

An acid-impregnated activated carbon matrix is formed from a carbonaceous material by the addition of a mineral acid, and may be used to chemisorb ammonia from a gas stream. The ammonia reacts with the acid to form a fertilizer salt. The spent matrix may be used as a fertilizer, or the fertilizer salt may be elutriated from the matrix.
US08198210B2

A method for producing a halogenated activated carbon material includes heating a natural, non-lignocellulosic carbon precursor in an inert or reducing atmosphere to form a first carbon material, mixing the first carbon material with an inorganic compound to form a mixture, heating the mixture in an inert or reducing atmosphere to incorporate the inorganic compound into the first carbon material, removing the inorganic compound from the first carbon material to produce an activated carbon material, and treating the activated carbon material with a halogen source to form a halogenated activated carbon material. The halogenated activated carbon material is suitable to form improved carbon-based electrodes for use in high energy density devices.
US08198209B2

A water absorbing agent of the present invention has an internal crosslinking structure obtained by polymerization of a water-soluble unsaturated monomer. The agent satisfies conditions (a) to (d): (a) the agent contains water-insoluble inorganic particles at an amount of from 10 ppm to 1,900 ppm inclusive; (b) the agent contains 5 mass % or less particles which have such a size that they can pass through a sieve having a mesh opening size of 150 μm; (c) the agent has an absorbency against a pressure of 4.83 kPa (AAP) of 18 g/g or more; and (d) the water-insoluble inorganic particles reside on a surface of the water absorbing resin or near the surface.
US08198208B2

A bromination process includes contacting fly ash with liquid bromine to increase the mercury adsorbing ability of the fly ash. The resultant brominated fly ash can be used to adsorb mercury in a high temperature combustion gas.
US08198191B2

Disclosed herein is a method of preparing a low resistance metal line, in which a wet plating technique is used instead of a vacuum film forming process in order to simplify the process and decrease the manufacturing cost. In addition, a self-assembled monolayer is formed that facilitates the increased adsorption density and strength of the metal catalyst resulting in the formation of a high-density metal catalyst layer, thereby obtaining a high-quality metal line. Also disclosed herein, are a patterned metal line structure, and a display device using the same.
US08198184B2

An integrated circuit having a gate dielectric layer (414, 614, 814) having an improved nitrogen profile and a method of fabrication. The gate dielectric layer is a graded layer with a significantly higher nitrogen concentration at the electrode surface than near the substrate surface. An amorphous silicon layer (406) may be deposited prior to nitridation to retain the nitrogen concentration at the top surface (416). Alternatively, a thin silicon nitride layer (610) may be deposited after anneal or a wet nitridation process may be performed.
US08198178B2

Normally-off semiconductor devices are provided. A Group III-nitride buffer layer is provided. A Group III-nitride barrier layer is provided on the Group III-nitride buffer layer. A non-conducting spacer layer is provided on the Group III-nitride barrier layer. The Group III-nitride barrier layer and the spacer layer are etched to form a trench. The trench extends through the barrier layer and exposes a portion of the buffer layer. A dielectric layer is formed on the spacer layer and in the trench and a gate electrode is formed on the dielectric layer. Related methods of forming semiconductor devices are also provided herein.
US08198175B2

A processing method for a package substrate having a base substrate partitioned by a plurality of crossing division lines to form a plurality of chip forming areas where a plurality of semiconductor chips are respectively formed and molded with resin. The package substrate has a resin surface and an electrode surface opposite to the resin surface. The processing method includes a warp correcting step of cutting the package substrate from the resin surface or the electrode surface along the division lines by using a cutting blade to form a cut groove, thereby correcting a warp of the package substrate, and a grinding step of grinding the resin surface of the package substrate in the condition where the electrode surface of the package substrate is held on a holding table after performing the warp correcting step, thereby reducing the thickness of the package substrate to a predetermined thickness.
US08198165B2

In a semiconductor device having a raised source and drain structure, in forming a raised region by etching, etching of an island-like semiconductor film which is an active layer is inhibited. In a method for manufacturing a semiconductor device, an insulating film is formed by oxidizing or nitriding the surface of an island-like semiconductor film, a semiconductor film is formed on a region which is a part of the insulating film, a gate electrode is formed over the insulating film, an impurity element imparting one conductivity type is added to the island-like semiconductor film and the semiconductor film using the gate electrode as a mask, the impurity element is activated by heating the island-like semiconductor film and the semiconductor film, and the part of the insulating film between the island-like semiconductor film and the semiconductor film disappears by heating the island-like semiconductor film and the semiconductor film.
US08198141B2

An intermediate structure for semiconductor devices includes a wiring board, a plurality of semiconductor chips mounted on the wiring board, and a sealing body for collectively sealing the plurality of semiconductor chips and having a region with a different thickness.
US08198137B2

Systems and methods for electrically isolating conductive members on an array of lead frames. In one embodiment, a system includes a stage for positioning the array to receive laser radiation, a computer system and electro-optical components. The system can sever conductive members from one another by laser ablation effected with programmable scanning of light from a laser. Software effects ablation paths along a plurality of lines across the array of lead frames. In a related method, the array is of a specified design and of the type formed on a sheet having a plurality lead frames interconnected through integrally formed dam bars. Reference information is provided to describe geometric or dimensional features, including predefined laser ablation scan paths for performing cuts along predefined cut lines on each lead frame. The cut lines are specific to the lead frame array design. Fiducial markings are located on the sheet. Laser ablation is performed to cut conductive members along the predefined cut lines, thereby completely severing at least some of the conductive members from an associated dam bar.
US08198133B2

Controlled collapse chip connection (C4) structures and methods of manufacture, and more specifically to structures and methods to improve lead-free C4 interconnect reliability. A structure includes a ball limited metallization (BLM) layer and a controlled collapse chip connection (C4) solder ball formed on the BLM layer. Additionally, the structure includes a final metal pad layer beneath the BLM layer and a cap layer beneath the final metal pad layer. Furthermore, the structure includes an air gap formed beneath the C4 solder ball between the final metal pad layer and one of the BLM layer and the cap layer.
US08198132B2

Semiconductor packages that contain isolated, stacked dies and methods for making such devices are described. The semiconductor package contains both a first die with a first integrated circuit and a second die with a second integrated circuit that is stacked onto the first die while also being isolated from the first die. The first and second dies are connected using an array of metal connectors containing both a base segment and a beam segment extending over the first die and supporting the second die. This configuration can provide a thinner semiconductor package since wire-bonding is not used. As well, since the integrated circuit devices in the first and second dies are isolated from each other, local heating and/or hot spots are diminished or prevented in the semiconductor package. Other embodiments are also described.
US08198125B2

A method of making a monolithic photovoltaic module having a flexible substrate is described. The method includes the following steps. First, a flexible substrate is provided, and a first adhesive layer, a metal layer, and a second adhesive layer are formed thereon. The second adhesive layer, the metal layer and the first adhesive layer are etched with at least one etching paste. In addition, a patterned semiconductor body layer patterned by an etching paste or a laser scribing is formed thereon. Furthermore, transparent top electrodes patterned by an etching paste or a cold laser scribing are formed on the patterned semiconductor body layer.
US08198122B2

A method for forming a thin film photovoltaic device. The method includes providing a transparent substrate comprising a surface region. A first electrode layer is formed overlying the surface region. A copper layer is formed overlying the first electrode layer and an indium layer is formed overlying the copper layer to form a multi-layered structure. The method subjects at least the multi-layered structure to a thermal treatment process in an environment containing a sulfur bearing species to form a bulk copper indium disulfide material. The bulk copper indium disulfide material comprises one or more portions of copper indium disulfide material and a copper poor surface region characterized by a copper-to-indium atomic ratio of less than about 0.95:1. The method subjects the copper poor surface and one or more portions of the bulk copper indium disulfide material to a chlorine species to convert the copper poor surface from an n-type characteristic to a p-type characteristic and to convert any of the one or more portions of the bulk copper indium disulfide material having the copper-to-indium atomic ratio of less than about 0.95:1 from a n-type characteristic to an p-type characteristic. A window layer is formed overlying the copper indium disulfide material.
US08198115B2

A method for manufacturing a solar cell, includes: forming, on a silicon substrate whose conductivity type is p-type or n-type, a silicon layer including a dopant whose conductivity type is different from that of the silicon substrate; and diffusing the dopant included in the silicon layer into the silicon substrate by heat-treating the silicon layer.
US08198113B2

Producing a semiconductor film containing a first semiconductor layer, an active layer, and a second semiconductor layer, each represented as AlxInyGazN, on a growth substrate, the layers arranged in this order from the growth substrate side. Producing a metal layer on the semiconductor film and/or a support and joining the semiconductor film and the support with the metal layer sandwiched between them. Irradiating the peripheral region of the growth substrate with a laser beam to separate the growth substrate from the semiconductor film in the peripheral region. Irradiating portions on the inner side of the peripheral region of the growth substrate with a laser beam, while leaving unirradiated portions, to separate and remove the growth substrate from the semiconductor film. Removing some portions of the semiconductor film where the growth substrate has already been separated and removed, to set up regions where semiconductor light emitting devices are to be produced.
US08198112B2

In accordance with one embodiment of the present disclosure, a process of manufacturing a semiconductor laser diode comprising a gain section, a QWI output window, and QWI waveguide areas is provided. The QWI waveguide areas are fabricated using quantum well intermixing and define a QWI waveguide portion in the QWI output window of the laser diode. The QWI output window is transparent to the lasing wavelength λL. The QWI waveguide portion in the QWI output window is characterized by an energy bandgap that is larger than an energy bandgap of the gain section such that the band gap wavelength λQWI in the QWI waveguide portion and the QWI output window is shorter than the lasing wavelength λL. The QWI output window is characterized by a photoluminescent wavelength λPL. The manufacturing process comprises a λPL screening protocol that determines laser diode reliability based on a comparison of the lasing wavelength λL and the photoluminescent wavelength λPL of the QWI output window. Additional embodiments are disclosed and claimed.
US08198107B2

A method for manufacturing a light emitting diode (LED) assembly comprises the steps of: covering a light-reflection layer onto a substrate layer, covering a light-emitting layer onto the light-reflection layer, and forming a P type electrode and an N type electrode extended from the light-emitting layer, perforating through the light-reflection layer, and exposed from the substrate layer to form an LED chip structure; packaging the LED chip structure with a light-transmissible packaging material and keeping the P type electrode and the N type electrode exposed from the light-transmissible packaging material to form a molded LED chip cell; and electrically connecting the P type electrode and the N type electrode of the molded LED chip cell to a circuit board, so as to manufacture the LED assembly.
US08198105B2

The present invention provides a reticle 100 for use in a lithographic process. The reticle, in one embodiment, includes a patterned layer 110 located over a reticle substrate. The reticle 100 may further include a test pattern 130 located over the reticle substrate, wherein a portion of the test pattern 130 is within a step-distance of a portion of the patterned layer. In this embodiment, a variance in the test pattern is indicative of a variance in the patterned layer.
US08198103B2

A chemical composition and method for providing uniform and consistent etching of gate stacks on a semiconductor wafer, whereby the composition includes an etchant and an added ballast gas added. The gate stacks are formed using this combined etchant and ballast gas composition. The ballast gas may either be similar to, or the equivalent of, a gaseous byproduct generated within the processing chamber. The ballast gas is added in either an overload amount, or in an amount sufficient to compensate for varying pattern factor changes across the water. This etchant and added ballast gas form a substantially homogeneous etchant across the entire wafer, thereby accommodating for or compensating for these pattern factor differences. When etching the wafer using this homogeneous etchant, a passivation layer is formed on exposed wafer surfaces. The passivation layer protects the lateral sidewalls of the gate stacks during etch to result in straighter gate stacks.
US08198098B2

An optical measurement method for determining a pH of a medium includes adding a fluorescent pH indicator to the medium. The pH indicator is based on naturally-obtained or synthesized ageladine A. The pH indicator is irradiated with light of at least one wavelength so as to provide fluorescence excitation of the pH indicator. An emitted fluorescence intensity of the pH indicator is detected as a measure for the pH of the medium.
US08198094B2

The invention relates to the use of gelsolin to treat inflammatory diseases (e.g., rheumatoid arthritis) and to the use of gelsolin to diagnose, monitor, and evaluate therapies of inflammatory diseases (e.g., rheumatoid arthritis).
US08198087B2

Cell cultures or tissue engineering supports, include at least a porous matrix based on a collagen sponge which defines first pores and a porous three-dimensional knit which defines second pores, the porous matrix filling the three-dimensional knit and all the first and second pores being at least partially interconnected with one another.
US08198085B2

The present invention generally concerns cell therapy and products for use in such therapy. Particularly, the invention provides a preserved cell preparation essentially free of one or more members of a group of cryoprotecting agents consisting of polyalcohols, DMSO and cryoprotecting proteins, the preserved cell preparation comprising somatic cells and at least one polyphenol, wherein upon reconstitution of cells in the cell preparation, at least a portion of said stem cells are viable, said portion being sufficient for use of the cell preparation in stem cell therapy. The invention also provides cells reconstituted from preserved somatic cells, and the use of the reconstituted cells in cell therapy. A preferred cell preparation in accordance with the invention comprises stem cells, preferably human stem cells.
US08198079B2

The present invention is directed at optimized expression vectors for the expression of native-like heterologous proteins in insect cells. Compositions of the invention are nucleotide sequences representing elements of an expression vector that when combined results in enhanced expression and secretion of heterologous proteins. The elements include sequences that define transcriptional activators, core promoters, secretion signals, and 3′ untranslated regions that are functional in insect cells. The elements contained in the optimized vectors are all synthetically derived or are modified variants of naturally occurring insect sequences. The expression vectors are useful for the expression of native-like proteins when protein encoding nucleotide sequences are operatively linked to the vectors. These vectors can be used to transform insect cells, which can then be cultured to produce the desired protein product. The expressed native-like proteins can be used in diagnostic, vaccine or other applications requiring large amounts of high quality proteins.
US08198075B2

A water quality analyzer for real-time detection according to the invention comprises a biased AC electro-osmosis (ACEO) cell for receiving a fluid to be analyzed having a plurality photosynthetic organisms therein, and concentrating the plurality photosynthetic organisms into at least one concentrated region. A photodetector is provided for obtaining a measured photosynthetic activity of the plurality of photosynthetic organisms in the concentrated region, wherein chemical, biological or radiological agents reduce a nominal photosynthetic activity of the photosynthetic organisms. An electronics package analyzes the measured photosynthetic activity to indicate a presence of the chemical, biological or radiological agents in the fluid.
US08198070B2

Apparatus and methods are described for detecting target DNA in a biological sample using capture probes and electrically-assisted hybridization. The reaction cell is formed with an attachment surface of aluminum oxide for better thermal and physical properties, and the aluminum oxide surface is coated with anti-DIG antibody to provide a convenient attachment layer for the capture probes allowing their correct orientation, while the capture probes are formed with a DIG-label so that they attach to the surface of the cell through an anti-DIG/DIG linkage.
US08198068B2

A method of forming localized variation of color density in the surface of a dyed cellulosic fabric with reducing back staining, with a composition comprising a cellulose having the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 75% sequence identity with SEQ ID NO: 2 is provided. A method for biopolishing a cellulose-containing fabric by using the new endoglucanase is also provided.
US08198067B2

A microbial biomass, made from algae, bacteria, fungi, yeast, or combinations thereof, provides a feed for animals raised either in agriculture or aquaculture. A feed additive, and a therapeutic composition can also be made from a microbial biomass of algae, bacteria, fungi, yeast, or combinations thereof. The feed, feed additive, and therapeutic composition can comprise one or more proteins, peptides, antibodies, antibody fragments, or a combination thereof, wherein said proteins, peptides, antibodies, antibody fragments, or a combination thereof are non-native to the microbes of the biomass. The biomass can have therapeutic, bioactive, nutritional, and/or immunogenic properties.
US08198066B2

Methods and materials related to producing 3-HP as well as other organic compounds are disclosed. Specifically, isolated nucleic acids, polypeptides, host cells, and methods and materials for producing 3-HP and other organic compounds are disclosed.
US08198056B2

Methods, enzymes, recombinant microorganism, and microbial systems are provided for converting polysaccharides, such as those derived from biomass, into suitable monosaccharides or oligosaccharides, as well as for converting suitable monosaccharides or oligosaccharides into commodity chemicals, such as biofuels. Commodity chemicals produced by the methods described herein are also provided. Commodity chemical enriched, refinery-produced petroleum products are also provided, as well as methods for producing the same.
US08198051B2

A thermocycler comprising a temperature control block (1,2,3) which is designed to receive several specimens and which is fitted with a control unit (6) that in consecutive cycles applies the different temperature levels (40° C., 70° C., 95° C.) of a PCR procedure to said block, said thermocycler being characterized in that said temperature controlling block is sub-divided into thermally separate segments (1,2,3) each of which is controlled separately and receives several specimens, the control unit (6) being designed to drive the said segments at different cycling rates (nine, seven, four).
US08198047B2

The invention concerns recombinant gelatins with unevenly distributed RGD motifs that are of particular use in several applications involving cell attachment such as in cell culture work and applications involving cell cultures of anchor dependent cells and also in a variety of medical applications.
US08198046B2

The invention relates to a fusion DNA construct comprising a KEX2 region comprising a KEX2 site and a KEX2 site pre-sequence immediately 5′ to the KEX2 site, a fusion polypeptide, vectors and cells comprising the fusion DNA construct, methods for producing desired proteins from filamentous fungal cells and methods for enhancing the secretion and/or cleavage of a desired protein from a cell.
US08198042B2

The susceptibility of human macrophages to human immunodeficiency virus (HIV) infection depends on cell surface expression of the human CD4 molecule and CC cytokine receptor 5. CCR5 is a member of the 7-transmembrane segment superfamily of G-protein-coupled cell surface molecules. CCR5 plays an essential role in the membrane fusion step of infection by some HIV isolates. The establishment of stable, nonhuman cell lines and transgenic mammals having cells that coexpress human CD4 and CCR5 provides valuable tools for the continuing research of HIV infection. In addition, antibodies which bind to CCR5, CCR5 variants, and CCR5-binding agents, capable of blocking membrane fusion between HIV and target cells represent potential anti-HIV therapeutics for macrophage-tropic strains of HIV.
US08198040B2

The present invention provides for a method of distinguishing dead cells from live cells using phenanthridium derivatives with a 2+ charge or higher.
US08198038B2

The present invention relates to a plasma biomarker for diagnosing hepatocellular carcinoma (HCC), in particular to the discovery of a protein in plasma using 2-D fluorescence differential gel electrophoresis (2-D DIGE), immunoprecipitation and Nano-liquid chromatography mass spectrometry (Nano-LC-MS/MS) system that was unknown on the basis of conventional techniques. By demonstrating the presence of liver carboxylesterase 1 (hCE1) in human plasma and confirming that its secretion level is higher in patients with HCC than in healthy volunteers, this invention may be used as a screening method to diagnose HCC at an early stage.
US08198037B2

The invention provides methods and compositions for simultaneously detecting the activation state of a plurality of proteins in single cells using flow cytometry. The invention further provides methods and compositions of screening for bioactive agents capable of coordinately modulating the activity of a plurality of proteins in single cells. The methods and compositions can be used to determine the protein activation profile of a cell for predicting or diagnosing a disease state, and for monitoring treatment of a disease state.
US08198036B2

A device and method for detecting the presence of hemoglobin in a biological sample, more particularly, the presence of blood in a fecal sample as an indicator of upper or lower gastrointestinal tract bleeding.
US08198032B2

A multi-analyte column is disclosed. The column may contain at least one unit of resin having ochratoxin specific affinity and, for each unit of resin having ochratoxin specific affinity, the column further contains about 0.95 to 1.05 units of resin containing antibody having specificity for zearalenone, about 1.9 to 2.1 units of resin containing antibody having specificity for aflatoxin, about 2.35 to 2.65 units of resin containing antibody having specificity for fumonisin, about 2.8 to 3.2 units of resin containing antibody having specificity for T-2 (and/or HT-2) and about 4.7 to 5.3 units of resin containing antibody having specificity for deoxynivalenol. One unit of resin is the quantity of resin containing antibody that will bind 50 ng of aflatoxin, 500 ng of deoxynivalenol, 3300 ng of fumonisin, 50 ng of ochratoxin, 830 ng T-2 (and/or HT-2) or 1140 ng of zearalenone, respectively.
US08198026B2

Methods of amplifying specific fragments of DNA or RNA with the aid of a polymerase chain reaction in real time are disclosed. The methods include providing a first oligonucleotide primer that comprises a donor fluorescent dye and a second oligonucleotide primer that comprises an acceptor fluorescent dye; allowing the primers to anneal to a target nucleic acid at positions abutting to each other or overlapping; carrying out a polymerase chain reaction which allows for a fluorescent resonance transfer of energy between the donor dye and the acceptor dye; detecting an increase of fluorescent emission of the acceptor dye; and correlating the increase in the emission of the acceptor dye with the accumulation of the specific fragment of DNA or RNA. In one embodiment, the primers comprise a fluorescent dye and a universal quencher.
US08198025B2

This invention relates to a composition, kit, or DNA chip comprising polynucleotides and antibodies as probes for detecting, determining, or predicting the presence or metastasis of esophageal cancer, and to a method for detecting, determining, or predicting the presence or metastasis of esophageal cancer using the same.
US08198024B2

A method of predicting clinical outcome in a subject diagnosed with colorectal cancer comprising determining evidence of the expression of one or more predictive RNA transcripts or their expression products in a biological sample of cancer cells obtained from the subject.
US08198023B2

The present invention provides compositions and methods for reducing steric hindrance in the product of nucleic acid polymerase reaction. Methods and compositions of the invention encompass application of exonucleases, endonucleases, and uracil-DNA glycosylases to a nucleic acid polymerase reaction such that newly formed nucleic acid strands are modified (e.g., cleaved) while the polymerase reaction continues to proceed.
US08198009B2

The object of the present invention is to provide a process for forming a resist pattern that is capable to utilize excimer laser beam, the thickening level of the resist pattern is controllable uniformly, constantly and precisely, without being affected substantially by environmental changes such as temperatures and humidity, and storage period, and space pattern of resist may be formed with a fineness exceeding exposure limits or resolution limits of available irradiation sources. The process for producing a semiconductor device is characterized in that forming a resist pattern on a surface of workpiece, coating a resist pattern thickening material on the resist pattern, thickening the resist pattern to form a thickened resist pattern, and patterning the surface of workpiece by etching using the thickened resist pattern as a mask, wherein the resist pattern thickening material comprises a resin, and exhibits a pH value of above 7 and not over 14 at coating or after coating on the resist pattern.
US08198003B2

Photosensitive paste compositions, barrier ribs of plasma display panels (PDPs) including the same, and PDPs including the barrier ribs are provided. More particularly, a photosensitive paste composition includes an organic component and an inorganic component, where the organic component and the inorganic component each have an average refractive index of less than 1.5. The organic component used in the photosensitive paste composition is not harmful to the human body, is inexpensive, is generally easily obtained, and succumbs readily to thermal decomposition. Accordingly, using such an organic component, barrier ribs of PDPs having high resolution and high compactness by exposure to light only once can be prepared.
US08198000B2

A method for producing a toner is provided. The method comprises the steps of (1) dispersing a water-soluble polyvinyl alcohol having a degree of polymerization of 1,500 to 2,500 and a degree of saponification of 75 to 98% in an aqueous medium to prepare an aqueous dispersion of the polyvinyl alcohol, (2) preparing a mixture of monomers, (3) mixing the aqueous dispersion with the monomer mixture, and (4) polymerizing the monomers.
US08197993B2

The present invention is a method of manufacturing a transfer mask with use of a mask blank in which a thin film for pattern formation and a chromium-based thin film made of a material containing chromium are stacked on a transparent substrate in this order. The thin film for pattern formation is made of material containing silicon and a transition metal other than chromium. The chromium-based thin film is made of a material containing chromium. Exposure light having a wavelength of 200 nm or less is applied to the transfer mask. In the manufacturing method, the transfer mask is produced by performing, in the following order, a process of forming a resist film having a transfer pattern on the chromium-based thin film, a process of forming a transfer pattern in the chromium-based thin film with use of a mask of the resist film having the transfer pattern, a process of forming a transfer pattern in the thin film for pattern formation with use of a mask of the chromium-based thin film having the transfer pattern, and a process of removing the chromium-based thin film by etching. The manufacturing method further includes a cleaning process of at least one of alkali solution cleaning, hot water cleaning, and ozone-containing water cleaning on the produced transfer mask until a width of the transfer pattern of the thin film for pattern formation is reduced by 4 nm or a space width of the thin film for pattern formation is increased by 4 nm.
US08197990B2

A fuel cell, having improved sealing against leakage, includes a sealant disposed over the peripheral portions a membrane electrode assembly such that the cured sealant penetrates a gas diffusion layer of the membrane electrode assembly. The sealant is applied through liquid injection molding techniques to form cured sealant composition at the peripheral potions of the membrane electrode assembly. The sealant may be thermally cured at low temperatures, for example 130° C. or less, or may be cured at room temperature through the application of actinic radiation.
US08197978B2

A solid oxide fuel cell (SOFC) system includes at least one oxygen partial pressure sensor or at least one open circuit voltage fuel cell (OCVFC) sensor which is fluidly integrated with said SOFC system. Further embodiments include methods of operating a fuel cell system including the steps of providing the fuel cell system including a fuel cell stack and at least one open circuit voltage fuel cell sensor fluidly integrated with said fuel cell stack, supplying fuel to the system thereby causing the system to generate electrical energy, and using the signal from the sensor to monitor or adjust performance of the system.
US08197964B2

A battery capable of improving the cycle characteristics even if the thickness of an anode active material layer is increased is provided. The battery includes a cathode, an anode and an electrolytic solution. The anode has an anode active material layer on an anode current collector, and the anode active material layer contains a carbon material and has a thickness of 30 μm or more. The electrolytic solution contains a solvent and an electrolyte salt, and the solvent contains at least one of sulfone compounds such as a cyclic disulfonic acid anhydride.
US08197962B2

In an assembled battery (2), batteries (3) are arranged in such a manner that sealing plates (13) for sealing openings of battery cases (10) face the same direction. Terminal (10) of first electrodes of the batteries (3) are connected to a first electrode connecting pieces (33) arranged near the sealing plates (13), and terminal (13) of second electrodes of the batteries (3) are connected to a second electrode connecting pieces (27) arranged near the sealing plates (13). The first electrode connecting pieces (33) are connected in parallel with each other, and the second electrode connecting pieces (27) are connected in parallel with each other. The first electrode connecting pieces (33) and the second electrode connecting pieces (27) are stacked on the sealing plates (13) with an insulating member (32) interposed therebetween.
US08197945B2

The invention relates to a mechanical piece having a structure comprising a substrate (1) and at least one surface coating layer (3) of nanometric thickness, for improving mechanical resistance, characterized in that it comprises between the substrate and the surface coating layer an essentially non ceramic, non porous adhesion layer of nanometric size; and said surface coating layer is an essentially non porous barrier layer (2) consisting essentially of an essentially stoechiometric titanium nitride layer.
US08197944B2

The invention relates to a one-component structural adhesive having a flow limit of at least 1500 Pa and an initial adhesion of more than 30 g/cm2, which contains at least one thickening agent and/or at least one filler. The invention further relates to the manufacture of such one-component structural adhesives and to the use of one or more thickening agents and/or one or more fillers for the manufacture of solid to kneadable one-component structural adhesive compounds having high initial adhesion.
US08197940B2

The durability of a transparent pyrolytic spray applied coating is improved by providing a spray solution of metal acetylacetonates having different particle size distribution. More particularly, the particle size distribution of each of the metal acetylacetonates is a function of its melting temperature, and optionally of its melting temperature and solubility.
US08197939B2

The present invention relates to a method for producing a flexible elastomeric composite polyurethane skin comprising a first and a second flexible polyurethane layer obtained by spraying a first and a second polyurethane reaction mixture onto one another. The first reaction mixture is an aliphatic polyurethane reaction mixture which is free of lead and formulated to produce a polyurethane elastomer having a flexural modulus smaller than 35 MPa. The second reaction mixture is an aromatic polyurethane reaction mixture producing a polyurethane elastomer having a smaller flexural modulus. The thickness of the aliphatic polyurethane layer could be made so small with respect to the thickness of the aromatic polyurethane layer that the composite skin has an average flexural modulus smaller than 30 MPa. Notwithstanding the lower reactivity of the aliphatic polyurethane reaction mixture, especially when using a higher NCO-index to reduce the “rubbery feel” and the emission of VOCs and/or a flexibiliser to achieve a higher flexibility, sufficiently short cycle times can be achieved due to the accelerated curing observed when spraying the aromatic polyurethane sufficiently early against the aliphatic polyurethane layer.
US08197938B2

Use, as adhesion promoter intended for application to the surface of a substrate S1 made of thermoplastic elastomer polymer TPE which comprises a chain formed of an alteration of hard segments and of soft segments, for the purpose of the adhesive assembly of the said substrate S1 with another substrate S2, of at least one solvent of the hard segments and/or of the soft segments of the said thermoplastic elastomer polymer TPE.
US08197930B1

A three-dimensional ordered open-cellular structure. In one embodiment, the structure includes: a plurality of first truss elements defined by a plurality of first self-propagating polymer waveguides and extending along a first direction; a plurality of second truss elements defined by a plurality of second self-propagating polymer waveguides and extending along a second direction; and a plurality of third truss elements defined by a plurality of third self-propagating polymer waveguides and extending along a third direction. The first, second, and third truss elements interpenetrate each other at a plurality of nodes to form a continuous material, and the three-dimensional structure is self-supporting.
US08197925B2

A heat-scalable, composite film said film comprising a polymeric substrate layer having a first and second surface and disposed on a surface of the substrate layer a water-soluble barrier layer, wherein (i) the substrate layer has one or more venting means therein; and (ii) the thickness of the barrier layer is from about 0.05 to about 40 μm; a process for the manufacture thereof; and use thereof as a self-venting film in the packaging of an ovenable meal.
US08197924B2

A compostable interior panel for use in a vehicle includes an injection molded compostable polymer. A layer is disposed about the compostable polymer and comprises a composting-resistant polymer having a thickness ranging from 10 μm to 175 μm. The compostable polymer and the composting-resistant polymer are substantially insoluble in one another when liquid.
US08197923B2

An optical recording medium having a substrate and an optical recording layer on the substrate. The optical recording layer is formed of an optical recording material containing at least one heterocyclic compound represented by general formula (I): wherein Z1 represents oxygen, sulfur, —CR5R6—, etc. (R5 and R6 are each a substituent, e.g., an alkyl group or an aralkyl group, or are taken together to form a ring); R1 and R2 each represent hydrogen, etc.; R3 and R4 each represent an alkyl group having 1 to 8 carbon atoms or are taken together to form a heterocyclic ring having no multiple bond; Y1 represents a hydrogen atom, an alkyl group having 1 to 8 carbon atoms, a metallocene substituent, etc.; Anq− represents a q-valent anion; q represents 1 or 2; p represents a number necessary to neutralize an electric charge; and n represents a number of 1 to 4.
US08197912B2

A method for manufacturing thin film panels comprises providing a laser patterning system, depositing a base layer on a glass substrate, separating the base layer by scribing a plurality of separation lines corresponding with a predefined scribe pattern, depositing a functional layer on the base layer, determining a first base layer separation edge, moving the translation stage by a first distance, activating the laser array and moving the translation stage by a second distance, deactivating the laser array, determining subsequent separation edges of the base layer and scribing lines therein, depositing a top layer on the functional layer, determining a first functional layer separation edge, operating the stepper motor to move the translation stage by a third distance, activating the laser array and moving the translation stage by a fourth distance, deactivating the laser array, and determining subsequent separation edges of the functional layer and scribing lines therein.
US08197902B2

A pigmented, aqueous coating composition comprising i) an aqueous dispersion of non-crosslinkable addition oligomer of weight average molecular weight of from 5000 to 15000 Daltons and calculated Fox Tg greater than 0° C. and less than 50° C. ii) an aqueous dispersion of addition polymer of weight average molecular weight greater than 53,000 Daltons, calculated Fox Tg greater than 10° C. and less than 40° C. and mean particle diameter of less than 150 nanometers, where the ratio of i):ii) is from 0.25:1 to 2.70:1, based on % weight dispersion solids.
US08197895B2

In a method for the cold-gas spraying of particles having different solidities and/or ductilities and in a cold-gas spraying device (11) suitable for use in with the method, in order to obtain a comparatively high proportion of particles (23) having higher solidity and/or smaller ductility in comparison to the other particles (22), these particles are fed into an area (21) of the stagnation chamber (15) of the cold-gas spraying device which is very distant from the nozzle (14). Advantageously, the particles (23) have to cover a longer course through the stagnation chamber and are thus preheated. In this way, the deposition of these particles (23) on a substrate (25) is improved. Particularly metals having a transition temperature ranging between brittle and ductile behavior can be provided with ductile properties by the preheating process, thereby simplifying the deposition process.
US08197894B2

In various embodiments, sputter-target formation includes application of a layer having an intermediate coefficient of thermal expansion between the backing plate and the target material.
US08197893B2

The present invention relates to roofing materials for roofs, sidewalls and other exterior surfaces exposed to the weather such as, but not limited to, asphaltic and non-asphaltic roofing materials, wherein color coated metal flakes cover up to 100% of the weathering surface of the roofing materials. The metal flakes are coated with a colored coating material by fluidizing the flakes in an air stream, spraying pressurized air and colored coating material, and curing the coated metal flakes. The present invention also relates to methods of making roofing materials.
US08197881B2

The present invention relates to method and apparatus for dispensing a beneficial agent into an expandable medical device. The method includes the step of placing an expandable medical device on a support and dispensing a beneficial agent into a plurality of openings in the medical device with a shield gas for controlling a local environment surrounding the dispenser.
US08197880B2

A method of using a biocompatible polymer is used. Biocompatible polymers are manufactured to include an ammo acid mimetic monomer and one or more hydrophobic acrylate monomers. The amino acid mimetic monomers are selected to mimic the side chain of the amino acids asparagine or glutamine. The amino acid mimetic monomer can be a methacryloyl or acryloyl derivative of 2-hydroxyacetamide, 3-hydroxypropionamide, alaninamide, lactamide, or glycinamide. These amide functional groups offer the advantage of moderate hydrophilicity with little chemical reactivity. The amino acid mimetic monomer can be copolymerized with one or more hydrophobic acrylate monomers to obtain desired coating properties.
US08197873B2

A method of enhancing the flavor of food by exposing the food to acoustic waves from a low frequency sonic transducer immersed in liquid is provided. The liquid may be the food itself and/or the food may be positioned within a range between about ¼ inch and about 20 feet from the liquid-containing container, and is preferably exposed to waves at a frequency ranging between about 1 Hertz to about 1000 Hertz, optimally 600 Hz for approximately one minute to 24 hours, optimally about 30 minutes. The acoustically-treated food is also provided.
US08197868B2

An extract of Scutellaria barbata D. Don is effective in the arrest of cancer cell growth in the G1 phase, the induction of apoptosis in cancer cells and the shrinking of solid cancers. The extract may be prepared as a pharmaceutical composition for administration to mammals for the treatment of solid cancers, such as epithelial cancers. Such epithelial cancers include breast cancer and ovarian cancers. The extract is obtained from Scutellaria barbata D. Don by contacting aerial portions of a plant from the species Scutellaria barbata D. Don with an aqueous or alcoholic solvent.
US08197862B2

In accordance with this invention, new processes for making an all-natural, hydroxytyrosol-rich, non bitter olive juice extract and its distillate is presented. Also as part of this invention are novel juice extract distillate and compositions containing this novel olive juice extract distillate.
US08197861B2

An anti-inflammatory and anti-fibrotic antioxidant formulation for treatment of hepatic oxidative stress and cirrhosis is disclosed. The antioxidant formulation can further include at least one of a hepatitis C virus-specific or a non-alcoholic steatohepatitis-specific formulation comprising one or more compounds to retard the progression of liver fibrosis and possibly reverse an established fibrosis. Methods of treatment or therapies for treating chronic liver disease and chronic hepatitis are also provided.
US08197859B2

To provide a lipolysis agent, a slimming agent, and a cellulite-ameliorating agent, which stimulate decomposition of fat accumulated in the adipose tissue, to thereby exhibit body-slimming effect and which is effective for inhibition or prevention of obesity and amelioration of prone to obesity. The lipolysis stimulator of the invention contains, as effective ingredients, a plant Huang Hua Cai or an extract thereof, and a xanthine derivative.
US08197858B2

Novel etiology underlying certain types of seizures and migraines is presented, whereby changes in endocrine levels result in changes in osteoclast activity levels which in turn result in elevated extracellular Ca2+ levels which in turn result in systemic alterations in nerves muscles, including increased nerve membrane depolarization, enhanced calcium channel mediated neurotransmitter release, and increased muscle contractility via sarcoplasmic reticulum calcium release channel mediated tropomyosin block removal, which in turn result in increased seizure risk in people with low seizure thresholds. Treatment methods are provided that modulate the bone microenvironment to provide an etiology based seizure treatment method that simultaneously reduces nerve sensitivity and muscle contractility. Preferred embodiments include use of SERMs such as raloxifene, testosterone, estrogen, calcimimetics such as cinacalcet, RANKL inhibitors such as denosumab, and bisphosphonate such as risedronate.
US08197848B2

A pharmaceutical composition comprises a solid amorphous dispersion of a cholesteryl ester transfer protein inhibitor and a concentration-enhancing polymer.
US08197845B2

The invention relates to powdered preparations containing tiotropium for inhalation, processes for preparing them as well as their use in preparing a pharmaceutical composition for the treatment of respiratory complaints, particularly for the treatment of COPD (chronic obstructive pulmonary disease) and asthma.
US08197844B2

A transdermal medicament patch includes a biocompatible substrate having a therapeutic face on one side configured for disposition against the skin of a patient, a biocompatible adhesive on the therapeutic face, a planar medicament matrix covering a portion of the therapeutic face, and a release liner covering the portion of therapeutic that is not obscured by the medicament matrix. An aperture formed through the release sheet affords direct access by medicament to the entire surface of the medicament matrix opposite from the therapeutic face of the substrate. An active electrode positioned between the medicament matrix and the therapeutic face of the substrate includes an electrically conductive backing layer positioned against the therapeutic face of the substrate and a pH-control layer covering less than all of the side of the backing layer opposite from the therapeutic face of the substrate. One active electrode design criterion relates the relative size of the pH-control layer to the size of the backing layer; another relates the size of portion of the area of the backing layer that is free of the pH-control lawyer to the size of the pH-control layer. The pH-control layer is made of an electrically conductive material capable of moderating changes in the hydrogen-ion concentration in the medicament matrix during iontophoretic current flow. An electrical contact electrically coupled through the substrate to the backing layer includes a hollow, electrically conductive snap fitting having an open end and a cooperating stud that is inserted into the open end of the snap.
US08197832B2

We search for a cultivation method for reducing the amount of mycotoxin contamination in wheat which has been an important pending question for the quality in actual producing field of wheat and the health hazard risk for customers.The present invention discloses a method of reducing the contamination amount of mycotoxin in cereals characterized in that one or more compounds A selected from the group consisting of ammonium salts, primary to quaternary ammonium salts, alkali metal salts, alkaline earth metal salts and polyvalent metal salts of phosphorous acid and phosphite ester are given to the cereals.
US08197827B2

A derivative of a 55 kDa extracellular protein from Photobacterium damselae subsp. Piscicida is the basis for a vaccine against Photobacterium infection, and thereby protects fish from pasteurellosis.
US08197825B2

The present invention relates to recombinant vaccinia viruses derived from the modified vaccinia virus Ankara (MVA) and containing and capable of expressing foreign genes which are inserted at the site of a naturally occurring deletion in the MVA genome, and the use of such recombinant MVA viruses for the production of polypeptides, e.g. antigens or therapeutic agents, or viral vectors for gene therapy, and the use of such recombinant MVA viruses encoding antigens as vaccines.
US08197824B2

Described is a method of identifying an immunologically active antigen of a virus that attacks skin, as well as a method of enriching a population of lymphocytes for T lymphocytes that are specific to a virus that attacks skin. Also provided are HSV antigens and epitopes that are useful for the prevention and treatment of HSV infection that have been identified via the methods of the invention. T-cells having specificity for antigens of the invention have demonstrated cytotoxic activity against cells loaded with virally-encoded peptide epitopes, and in many cases, against cells infected with HSV. The identification of immunogenic antigens responsible for T-cell specificity provides improved anti-viral therapeutic and prophylactic strategies. Compositions containing antigen or polynucleotides encoding antigens of the invention provide effectively targeted vaccines for prevention and treatment of HSV infection.
US08197822B2

The invention relates to novel insertion sites useful for the integration of HIV DNA sequences into the MVA genome, and to the resulting recombinant MVA derivatives.
US08197821B2

The present invention relates to protein-protein interactions involved in AIDS. More specifically, the present invention relates to complexes of polypeptides or polynucleotides encoding the polypeptides, fragments of the polypeptides, antibodies to the complexes, Selected Interacting Domains (SID®) which are identified due to the protein-protein interactions, methods for screening drugs for agents which modulate the interaction of proteins and pharmaceutical compositions that are capable of modulating the protein-protein interactions.
US08197818B2

The present inventors found that a fusion gene present in some cancer patients is an oncogene. The present invention relates to a polypeptide as a novel fusion protein, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, a transformed cell comprising the vector, a method for detecting the fusion protein or polynucleotide, a method for screening a therapeutic agent for cancer, and a method for treating cancer that is shown to be positive for the fusion gene. Further, the present invention relates kit, primer set, and probe useful in the detection of cancer that is shown to be positive for the fusion gene.
US08197817B2

The invention relates to compositions and methods used to assess and alter the expression and activity of MINK in cells of the immune system, particularly thymocytes and T lymphocytes. The methods and compositions are used in a variety of clinical applications including vaccination, treatment of cancer, infectious disease, allergy, and transplantation. Screening methods are provided to identify inhibitors of MINK and susceptibility to effects of under- or over-expression of MINK.
US08197813B2

Human antibodies, preferably recombinant human antibodies, that specifically bind to human tumor necrosis factor α (hTNFα) are disclosed. These antibodies have high affinity for hTNFα (e.g., Kd=10−8 M or less), a slow off rate for hTNFα dissociation (e.g., Koff=10−3 sec−1 or less) and neutralize hTNFα activity in vitro and in vivo. An antibody of the invention can be a full-length antibody or an antigen-binding portion thereof. The antibodies, or antibody portions, of the invention are useful for detecting hTNFα and for inhibiting hTNFα activity, e.g., in a human subject suffering from a disorder in which hTNFα activity is detrimental. Nucleic acids, vectors and host cells for expressing the recombinant human antibodies of the invention, and methods of synthesizing the recombinant human antibodies, are also encompassed by the invention.
US08197805B2

Disclosed is a method of diagnosing autoimmune diseases, such as multiple sclerosis and systemic lupus erythematosus, which involves detecting the presence of small intestinal bacterial overgrowth (SIBO) in a human subject having at least one symptom associated with a suspected diagnosis an autoimmune disease. Also disclosed is a method of treating these autoimmune diseases, which involves at least partially eradicating a SIBO condition in the human subject. The method includes administration of antimicrobial or probiotic agents, or normalizing intestinal motility by employing a prokinetic agent. Also disclosed is a kit for the diagnosis or treatment of autoimmune diseases.
US08197798B2

The invention provides a hair treatment composition comprising a combination of a sugar, an aliphatic amino acid and a basic amino acid. The composition is particularly suitable for the treatment of hair which is dry, damaged and/or prone to manageability problems.
US08197793B2

The invention relates to conjugates of formula (V) or (VI): wherein X is —CO—NH—, —NH—, —O—, —NHCONH—, or —NHCSNH—; their use as radiopharmaceuticals, processes for their preparation, and synthetic intermediates used in such processes.
US08197792B2

Reformation of natural gas without excessive production of ammonia, even if the natural gas includes as much as 14% nitrogen, is achieved in reformers including tubes (75) having outer chambers (78) with catalysts therein, a first stage (80) of catalyst having between about 10% and about 25% nickel, a second stage (81) of catalyst having less than 10% nickel, and a final stage (82) having 2% or less rhodium catalyst of a low concentration.
US08197787B2

A method includes producing an isolation atmosphere in a phase changing area above a reactant liquid and then injecting a feed material into the reactant liquid. The feed material includes a carbon-bearing material. The method further includes maintaining the molecules of the injected carbon-bearing material and any reaction products in contact with the reactant liquid for a period of time sufficient to liberate carbon atoms from the carbon-bearing material or reaction products from that material, and place the liberated carbon atoms in an excited state. Liberated carbon atoms in the excited state are then allowed to traverse a surface of the reactant liquid and flow along a particle formation path through the phase changing area so that the liberated carbon atoms may phase change to the ground state while suspended in the phase changing area.
US08197785B2

Systems and methods for contacting a liquid, gas, and/or a multi-phase mixture with particulate solids. The system can include a body having a first head and a second head disposed thereon. Two or more discrete fixed beds can be disposed across a cross-section of the body. One or more unobstructed fluid flow paths can bypass each fixed bed, and one or more baffles can be disposed between the fixed beds.
US08197778B2

Sulfur dioxide (SO2) is removed from a carbon dioxide feed gas by maintaining the feed gas at elevated pressure(s) in the presence of oxygen (O2), water and NOx for a period of time sufficient to convert SO2 to sulfuric acid and NOx to nitric acid and produce SO2-depleted, NOx-lean carbon dioxide gas. The invention resides in separating the sulfuric and nitric acids from said SO2-depleted, NOx-lean carbon dioxide gas, and then neutralizing the acids by reaction with an alkaline sorbent in an acid/sorbent reactor system to produce sorbent-derive sulfate. The method has particular application in the removal of SO2 and NOx from flue gas produced by oxyfuel combustion of a carbonaceous fuel.
US08197777B2

The invention describes combustors and steam reformers and methods of combustion and steam reforming. For example, integrated combustion reactors are described in which heat from combustion is transferred to an endothermic reaction. Thermally efficient reactors and methods of alcohol steam reforming are also described. Also described is an integrated combustor/reformer containing a methanation catalyst.
US08197775B2

The present invention provides a detection article including at least one fluid control film layer having at least one microstructured major surface with a plurality of microchannels therein. The microchannels are configured for uninterrupted fluid flow of a fluid sample throughout the article. The film layer includes an acquisition zone for drawing the fluid sample into the plurality of microchannels at least by spontaneous fluid transport. The film layer also includes a detection zone having at least one detection element that facilitates detection of a characteristic of the fluid sample within at least one microchannel of the detection zone. The detection article may be formed from a plurality of film layers that are stacked to form a three-dimensional article.
US08197773B2

The present invention provides a microfluidic device with a micro-pump system in which the production process is simplified and the device is further downsized. A microfluidic device 1 has a gas generation portion 3. The gas generation portion 3 has a substrate 10 and a gas generation layer 20. The substrate 10 has a first main surface 10a and a second main surface 10b. The substrate 10 has a micro-channel 14 with an opening at least on the first main surface 10a. The gas generation layer 20 is disposed on the first main surface 10a of the substrate 10 so as to cover an opening 14a. The gas generation layer 20 generates gas by receiving an external stimulus.
US08197770B2

A fluid handling module is configured for removable engagement with a reusable main fluid handling instrument. The module includes a module housing and a first fluid passageway extending from the module housing. The first fluid passageway has a patient end remote from the housing. The first fluid passageway is configured to provide fluid communication with a bodily fluid in a patient. A fluid component separator is in fluid communication with the first fluid passageway. The fluid component separator is configured to separate at least one component from a portion of the bodily fluid drawn from the patient. A spectroscopic sample cell is configured to hold at least a portion of the first component.
US08197765B2

A waste gas purification apparatus comprises: a heater, which heats waste gas mixed with reaction air to separate it into a solid reactant and a vapor purification gas; a water reserve tank unit, which has a water reserve tank communicated with the heater; a dust collector unit, which comprises a dust collector collecting the purification gas inflowed from the first process unit, and a water reserve tank communicated with lower portion of the dust collector; a scrubber unit, which comprises a scrubber inhaling the purification gas inflowed from the dust collector unit, and a reserve tank communicated with lower portion of the scrubber; and a collector, which has an adsorber and a remover filtering the purification gas inflowed from the scrubber unit, a water distributor being installed in upper portion of the remover and lower portion of the adsorber.
US08197762B2

A method of dispensing a volatile material comprises the steps of providing power to a volatile material diffuser having a diffusion element. The method further includes the step of operating the diffusion element for a randomly determined period of time, wherein the diffusion element is continuously activated and deactivated during the period of time at a randomly determined duty cycle.
US08197759B2

The invention relates to compositions and methods useful in the labeling and identification of proteins. The invention provides for highly soluble zwitterionic dye molecules where the dyes and associated side groups are non-titratable and maintain their net zwitterionic character over a broad pH range, for example, between pH 3 and 12. These dye molecules find utility in a variety of applications, including use in the field of proteomics.
US08197736B2

A method for providing an antislip tread and an antislip tread provided with the method. The tread has a plurality of antislip inserts made of fabric or nonwoven fabric which emerge from the surfaces intended for contact with the ground. The inserts made of fabric or nonwoven fabric may also form a substantially continuous surface with the surface made of rubber or plastic material.
US08197733B2

The invention is the provision of an elongated imitation wood product or component which has a plastic core and a plastic coating on at least one surface with the coating, which is of two different colours and which has a randomly swirled pattern, giving a realistic appearance of the wood grain of natural wood to the product. The invention further is in the method and equipment for producing such a realistic imitation wood product or component made of plastic.
US08197731B2

Granules for a friction material is produced by: granulating a mixture including a friction modifying granular material and a resin binder in a fluidized bed under a presence of a liquid including a water-soluble or water-dispersible binder. The granules have a particle size of from 100 to 2000 μm, an angle of repose of 40° or less, and a compression breakage strength of 10 MPa or less. The friction material is obtained by using the granules.
US08197728B2

The present invention discloses a molded article with an antimicrobial property, and a manufacturing method thereof. The molded article can prevent contact of bacteria or viruses by combining the Kimchi lactic acid bacteria culture fluid having antibacterial and antivirus effects with a raw material. The molded article needing the antimicrobial effect is provided with the antimicrobial property, by incorporating the Kimchi lactic acid bacteria culture fluid with a wide antibacterial spectrum singly or in combination with nano metal particles. The Kimchi lactic acid bacteria culture fluid is combined in the molding step of the article, for reducing the manufacturing time and simplifying the manufacturing process.
US08197700B2

A method and software for sizing three-phase separators utilizing an iterative approach is provided. The proposed computational method for sizing three-phase separators uses an iterative technique that calculates the optimum vessel dimensions for each service over a range of length to diameter ratios. The method starts with the smallest vessel dimension depending on the service and the selected vessel type and then tries to satisfy all the requirements for vapor/liquid and liquid/liquid separation. The vessel dimensions, i.e., length and diameter, are incrementally changed until all the requirements are met. The method and software are not restricted to any fixed value for the length to diameter ratio. The method and software select the smallest sized three-phase separator required for each service.
US08197698B2

A method for removing undesired substances from liquid water may comprise the steps of: subjecting an oxygen-containing substance to an environment; increasing a temperature within said environment; ionizing said oxygen-containing substance; forming an electrostatically enhanced oxygen species; transferring at least some of said electrostatically enhanced oxygen species to said liquid water; processing said liquid water by action of said electrostatically enhanced oxygen species; creating a charged negatively electrostatically enhanced water species by the presence of said electrostatically enhanced oxygen species in said liquid water; and removing said undesired substances from said liquid water through action of said charged negatively electrostatically enhanced water species in said liquid water, perhaps with the goal of purifying water. Such water may be used in a variety of manners, including but not limited to reuse of the purified water in a closed loop system as a cleaning agent.
US08197690B2

A biological wastewater is mixed in an activated sludge tank with activated sludge that is concentrated in the activated sludge tank to a predetermined value. The mixture of wastewater and activated sludge running off in a drain of the activated sludge tank is then sieved to effect an incomplete solid/liquid separation that leaves a separated solid phase in the activated sludge tank. The liquid phase including a remnant of solids is then removed from the tank.
US08197683B2

The invention is a system and method for conditioning fluids utilizing a magnetic fluid processor or device that includes an elongated housing comprising a core enclosed by a magnetic component in combination with an electrical return path. The process utilizes said device to affect and electron configuration within fluids by generating a magnetic field, thereby separating, for example, metals and organic or inorganic materials from fluids, in order to achieve desired fluid composition and properties.
US08197676B2

A tailings solvent recovery vessel substantially without conventional internals utilizes nozzles for forming very fine solvent-containing hydrocarbon droplets from a solvent-containing tailings feedstream. The hydrocarbon droplets are discrete from water droplets. The hydrocarbon droplets are small enough to result in a large surface area and a desired fall residence time but sufficiently large that they are not entrained with the rising vapor in the vessel. The feedstream is introduced to the vessel with a pressure drop to result in an initial flashing of the solvent from the solvent-containing droplets. Heat from the vessel atmosphere or from steam flowing countercurrent to the falling hydrocarbon droplets is transferred to the falling hydrocarbon droplets resulting in vaporization of any residual solvent therefrom. A substantially solvent-depleted pool is collected in the bottom of the vessel and retained only so long as is required to pump the underflow stream from the vessel.
US08197674B2

This invention relates to thioetherification processes for the removal of mercaptans in charge gas streams. In particular, the invention relates to thioetherification processes for the removal of mercaptans using a catalyst comprising palladium and silver.
US08197663B2

Methods for the electrolytic preparation of tin coated metals are disclosed. Organic polybasic acids, such as methanedisulfonic acid [CH2(SO3H)2], 1,3-acetonedisulfonic acid [CO(CH2SO3H)2], anhydrides, and their water soluble salts, and mixtures thereof may be used as the electrolyte in the plating process or as the flux in the reflow process. Acetone, gamma-butyrolactone, or a mixture thereof, may be applied to a tin plated surface, either before or after reflow. The methods of the invention produce plated material that is free of blue haze.
US08197657B2

An arrangement of electrodes is provided in which there is a plurality of electrodes located in two planes and offset from one another in the direction of movement, and which within each plane are arranged in at least two electrically interconnected and alternating groups. A method is also provided for the movement or transport of drops of liquid utilizing the electrowetting effect and utilizing the above arrangement.
US08197653B2

Cartridge unit for an electrochemical sensor includes a cartridge (2) prefilled with electrolyte and having a first end closed by a selectively permeable membrane (7), and a second end (6) having a fastening device (11) arranged for fastening the cartridge to the electrochemical sensor (24). The cartridge unit further has a supporting member (3) to which the cartridge (2) is detachably fastened, and closing devices (4, 20) for closing the second end (6) of the cartridge (2). These closing devices (4, 20) are able to be opened by a user to allow the cartridge (2) to be fastened to the electrochemical sensor (24) and then to be detached from the supporting element (3).
US08197650B2

Described herein are substrates, sensors and systems related to measuring the concentration of an analyte such as hydrogen ion in a sample. Redox active moieties whose reduction and/or oxidation potentials are sensitive to the presence of an analyte are immobilized onto a silicon surface. Immobilized redox active moieties whose reduction and/or oxidation potential are insensitive to the analyte can be used for reference. Voltammetric measurements made using such modified silicon surfaces can accurately determine the presence and/or concentrations of analytes in a sample of interest. The silicon electrochemical sensors of the invention are robust and can be made so as not to require calibration or re-calibration.
US08197648B2

A method for producing a low-conductivity layer on at least one workpiece by vacuum coating is provided. The method includes operating an electrical arc discharge between an anode and a cathode of an arc source in an atmosphere containing a reactive gas. A small external magnetic field is generated to be essentially perpendicular to a target surface of a target, which is electrically connected to the cathode, to assist an evaporation process. A degree of recoating of the target surface by other coating sources in a vacuum coating installation is less than 10%, and the magnetic field is generated by a magnet system with an axially-polarized coil having a geometry similar in size to that of the target.Excitation current for the electrical arc discharge is supplied through the axially-polarized coil.
US08197638B2

Wafer contamination is prevented, while preventing damage to a high-frequency electrode and a susceptor. A main body 41 of the susceptor 40 of an MMT apparatus is composed of a heater arranging plate 42, an electrode arranging plate 48, and a supporting plate 56 all made from quartz. A circular electrode arranging hole 49 with a fixed depth is concentrically formed on the upper surface of the electrode arranging plate 48, and quadrangular pillars 50 are formed protruding in a matrix on the bottom of the electrode arranging hole 49. Multiple insertion holes 52 are formed in a disk-shaped high-frequency electrode 51, and the high-frequency electrode 51 is installed in the electrode arranging hole 49 by inserting each pillar 50 into each insertion hole 52. The gaps Sa and Sb are provided between the high-frequency electrode 51 and the electrode arranging plate 48. The pillar 50 boosts the strength of the electrode arranging plate 48. Damage to the high-frequency electrode is prevented even if the thermal expansion coefficient of the high-frequency electrode is larger than that of the electrode arranging plate, since the gaps absorb the thermal expansion differential.
US08197636B2

Embodiments described herein relate to a substrate processing system that integrates substrate edge processing capabilities. Illustrated examples of the processing system include, without limitations, a factory interface, a loadlock chamber, a transfer chamber, and one or more twin process chambers having two or more processing regions that are isolatable from each other and share a common gas supply and a common exhaust pump. The processing regions in each twin process chamber include separate gas distribution assemblies and RF power sources to provide plasma at selective regions on a substrate surface in each processing region. Each twin process chamber is thereby configured to allow multiple, isolated processes to be performed concurrently on at least two substrates in the processing regions.
US08197635B2

A diameter of a mounting unit of the stage of an ashing processing apparatus is less than a diameter of a mounting unit of the stage of an etching processing apparatus, and the diameter of the mounting unit of the stage of the etching processing apparatus is less than a diameter of an objective item.
US08197629B2

A method of the present invention for producing a polarizing plate including a polarizer and a transparent protective film provided on one side of the polarizer with an adhesive layer interposed therebetween, include the steps of: (A) irradiating at least one side of a polarizer with vacuum ultraviolet rays to treat a surface of the polarizer; (B) bonding a first transparent protective film to the side of the polarizer, which has been subjected to the surface treatment step (A), with a first adhesive layer interposed therebetween to produce a temporary polarizing plate; and (C) peeling off the first transparent protective film and a surface layer of the polarizer, which has been subjected to the surface treatment, from the temporary polarizing plate. A thin polarizing plate in which shrinkage-induced bending is reduced may be obtained by the method.
US08197626B2

An apparatus for use with multiple individual chips having a rigid plate, and a deformable membrane located on the plate, the deformable membrane having a thickness sufficient to allow the deformable membrane to peripherally conform to each of the individual multiple chips irrespective of any difference in height among the multiple individual chips and to prevent each of the multiple individual chips from moving in a lateral direction, the deformable membrane being configured to uniformly transfer a vertical force, applied to the rigid plate, to the chips so as to bring, under pressure, a bonding surface of each individual chip into contact with a bonding surface of an element to which the individual chips will be bonded during a connect and release cycle without causing damage to the individual chips or bonding surface.
US08197621B2

A planar heating element using for carbon micro-fibers and its manufacturing method have developed. The high-resistant carbon micro-fibers and carbon powder are efficiently coated to completely replace a conventional heating element using resistance heat of a nichrome wire. A single heating element is possibly formed to have a large width and an ultra thin heating element without temperature restriction by overcoming drawbacks of a carbon powder printed heating element serving as an initial module of the planar heating element. Thus, it is possible to produce the various convenient heating elements or heating modules using DC and AC electricity without restriction by solving problems in installation and use, for example, space restriction, thereby various convenient heating elements.
US08197619B1

A process for making metal-organic frameworks and metal-organic frameworks having host-guest complexes of either liquid energetics, solid energetics, or solid oxidizers.
US08197615B2

Mechanical hooks made of bulk-solidifying amorphous alloys, wherein the bulk-solidifying amorphous alloys provide ruggedness, durability, higher service loads, excellent resistance to chemical and environmental effects, and low-cost manufacturing are provided. In addition, methods of making such mechanical hooks from bulk-solidifying amorphous alloys are also disclosed.
US08197606B2

Disclosed is a substrate cleaning method for prevent damage to a pattern formed on a substrate. The substrate cleaning method includes cleaning the substrate by striking cleaning particulates carried in a flow of dry air or inert gas against a surface of the substrate, and removing the cleaning particulates.
US08197605B2

The present invention relates to the use of at least one alkanesulfonic acid of formula R—SO3H, in which R represents a saturated, linear or branched, hydrocarbon chain containing 1 to 4 carbon atoms, as agent for cleaning cement, mortar, concrete, lime, laitance and other derived products. The invention also relates to a method of cleaning cement, mortar, concrete, lime, laitance and other derived products using at least one alkanesulfonic acid.
US08197590B2

Disclosed is a composition containing a fluorine-containing urethane compound (A) and a fluorine-containing polymer (B) having a repeating unit derived from a fluorine-containing monomer represented by the following formula (I): CH2═C(—X)—C(═O)-A-Rf  (I) (wherein X represents a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a CFX1X2 group (wherein X1 and X2 respectively represent a hydrogen atom, a fluorine atom or a chlorine atom), a cyano group, a straight or branched chain fluoroalkyl group having 1-20 carbon atoms, a substituted or unsubstituted benzyl group, or a substituted or unsubstituted phenyl group; A represents a divalent group; and Rf represents a straight or branched chain perfluoroalkyl group having 1-6 carbon atoms).
US08197589B2

The present invention relates to the use of a (1→3)-β-D-glucan as an emulsion stabilizer. The present invention further relates to emulsions comprising a (1→3)-β-D-glucan in an amount of 0.01 to 10 wt. %, based on the total weight of the emulsion. The present invention also relates to bitumen binder compositions comprising a (1→3)-β-D-glucan in an amount of 0.005 to less than 0.1 wt. %, based on the total weight of the bitumen binder composition. The present invention further relates to emulsions comprising a novel biodegradable emulsifying agent, in particular in combination with a (1→3)-β-D-glucan.
US08197583B2

Disclosed is an electroless plating solution exhibiting a good plating metal filling performance even for larger trenches or vias of several to one hundred and tens of μm, in a manner free from voids or seams, and allowing maintenance of stabilized performance for prolonged time. The electroless plating solution contains at least a water-soluble metal salt, a reducing agent for reducing metal ions derived from the water-soluble metal salt, and a chelating agent. In addition, the electroless plating solution contains a sulfur-based organic compound as a leveler having at least one aliphatic cyclic group or aromatic cyclic group to which may be linked at least one optional substituent. The aliphatic cyclic group or the aromatic cyclic group contains optional numbers of carbon atoms, oxygen atoms, phosphorus atoms, sulfur atoms and nitrogen atoms.
US08197577B2

A passive hydrocarbon containment system for containing hydrocarbons in a fluid comprises a subsea separator dome, an oil pathway in fluid communication with a hydrocarbon collector disposed within the collection dome, and a gas outlet pipe having a discharge height dimensioned and adapted in relation to the height of the oil pathway sufficient to keep a portion of the oil pathway submerged into a fluid such as seawater present in the collection dome interior void. The hydrocarbon containment system can be moored subsea and used to collect oil and gas coming out of the ocean floor. One advantage of the hydrocarbon containment system is that there are no moving parts. A further advantage is that the hydrocarbon containment system requires limited maintenance to pump out the collected oil as needed.
US08197575B2

A process for heap leaching a laterite that includes providing a primary and a secondary heap, with the primary heap comprising predominantly a nickel and cobalt containing sulfide or saprolitic type ore, and the secondary heap comprising predominantly a nickel and cobalt limonitic type ore; leaching the primary heap with a sulfuric acid solution to generate a solution that includes ferrous ions; and using the solution that includes the ferrous ion as the lixiviant to leach the secondary heap, to produce a pregnant leach solution that includes nickel, cobalt and manganese ions.
US08197565B2

A system of the interrelated chemical engineering processes that continuously and simultaneously gasify and utilize of an organic-inorganic raw material or municipal solid waste (MSW) and completely or entirely decompose and transform said raw material, synthesize synthetic gas (syngas) and water steam gas mixture, and melt inorganic materials that are made further treatment and correspondingly processed into following consumable and fully marketable materials or products: syngas fuel, electricity, methanol or gasoline, chemical materials, glassy slag and concrete/road filling materials, multi-metal alloy and cast metal goods, greenhouse made green mass, and hot water; said system of chemical engineering processes does not need or use fossil fuel and electric power supplied from external sources; and said system of processes excludes an emission of nitrogen oxide, carcinogenic, and hazardous gases, and air pollutant particles, excludes production of ash or secondhand waste, and makes unsubstantial a carbon dioxide emission.
US08197560B2

Disclosed is a fuel for fuel cells which contains at least one organic compound selected from the group consisting of methanol, ethanol, dimethyl ether and formic acid, and 1-200 ppm of a hydrocarbon compound in terms of a single component as determined by gas chromatography mass spectrometry. Also disclosed are a fuel cartridge for fuel cells and a fuel cell.
US08197557B2

A method for producing a secondary cell having a flat wound electrode body that inhibits the bending of the electrode board caused by charging and discharging and inhibits resulting swelling of the cell and deterioration of cycle characteristics is provided. The method has the steps of: winding, with a winding core, a positive electrode board, a negative electrode board, and a separator provided between the positive and negative electrode boards, and fixing the winding end, thereby preparing an approximately cylindrical electrode body; after the step of preparing the electrode body, deforming the electrode body into a shape with an approximately oval cross section by pressing the approximately cylindrical electrode body from a direction perpendicular to the winding axis, and rotating the deformed electrode body in the winding direction, thereby relaxing the winding state; and after the relaxation steps, pressing the electrode body into the flat wound electrode body.
US08197556B2

A method for producing a non-aqueous electrolyte secondary cell by preparing a positive electrode by applying a positive electrode mixture onto a positive electrode core material, the mixture containing a positive electrode active material mainly made of a lithium nickel composite oxide and a binding agent containing polyvinylidene fluoride; measuring the amount of carbon dioxide gas generated when a layer of the positive electrode mixture is removed out of the positive electrode and the layer is heated to 200° C. or higher and 400° C. or lower in an inactive gas atmosphere; selecting a positive electrode satisfying the following formulas: y<(1.31x−258)/1000000(200≦x<300)  formula 3 y<1.20x−225/1000000(300≦x≦400)  formula 4 where x is a heating temperature (° C.) and y is the amount of carbon dioxide gas (mole/g) per 1 g of the lithium nickel composite oxide measured; and preparing the non-aqueous electrolyte secondary cell by using the positive electrode selected.
US08197552B2

Devices are provided for insertion into a Eustachian tube of an animal, e.g., a human being. The devices include an insertable member. The member has opposing surfaces and is formed at least in part from a biocompatible material that is degradable. The device may comprise a hole that is effective to provide sufficient fluid communication between the opposing surfaces of the insertable member to effect pressure equilibration therebetween. The device is able to be immobilized within the Eustachian tube for a predetermined period. Also provided are kits that include the device and methods for inserting the device into a Eustachian tube.
US08197551B2

Provided are apparatuses, systems, and methods for treating tissue at a tissue site in a mammal that includes a scaffold adapted to be disposed adjacent to the tissue site and to be fluidly coupled to a blood vessel of the mammal for receiving blood therefrom. Additionally, a scaffold is provided that includes a charged surface comprising a streaming potential.
US08197544B1

A system and method is provided for distracting opposite surfaces from the interior of a bone, such as a vertebral body. A working channel cannula provides a working channel through which an inserter and an injection cannula can simultaneously pass. The inserter transports a plurality of wafers into the interior of the bone to form a load-bearing stack bearing against the opposite surfaces. The injection cannula is used to inject a fluent material into and/or around the stack. In certain embodiments, the fluent material is a load-bearing or hardenable material, such as bone cement. In other embodiments, the fluent material can be a BMP, HAP, or other osteo-inductive, osteo-conductive, or pharmaceutical compositions. A syringe containing the fluent material is engaged to the injection cannula and is operable to inject the fluent material into the vertebral body under controlled pressure.
US08197543B2

A spinal prosthesis has a prosthetic vertebral body in the form of a hollow cylinder (1) with perforated wall and attached prosthetic intervertebral discs formed by springs (7,8) molded into silicone-rubber beads (9,10). Anchoring of the cylinder (1) to the damaged vertebra (II) is by means of entrapment of an elongate lug (12) of the cylinder 1 within a slot (16) of a plate (11) retained by screws (12) within a recess (13) of the damaged vertebra (II). The springs (7,8) of the resilient beads (9,10) are attached to the natural vertebrae (I,III) superior and inferior to the damaged vertebra (II) by fixing plates (3,4) which have flanges (20,21) that are held by screws (22) to those vertebrae (I,III). Where adjoining vertebrae are damaged, two or more prosthetic cylinders (1) for anchoring to the individual vertebra are used with interconnecting resilient beads (9;10).
US08197542B2

A self supporting breast implant includes a generally cone shaped partially absorbable medical mesh support member and a silicone shell defining a hollow core that is preferably filled or partially filled with a silicone gel. The support member is made of a polypropolene/poliglecaprone monofilament and may be attached to a patient's tissue by sutures or by absorbable hooks. A textured outer surface or shell is formed around the relatively smooth implant or inner shell and the inner shell is reduced in size to provide a small space between the inner shell and the outer shell to eliminate or at least minimize the adverse effects of capsular contraction.
US08197540B2

An ocular implant alters iris color for medical and cosmetic purposes and is made of an inert, nontoxic, foldable and preferably permeable to fluid flow material. It is an annular non-planar structure that fits over the iris yet leaves the natural lens uncovered and extends approximately to the iridocorneal angle. Two different kinds of arc sections of a non-uniform thickness make up the structure: passage arc sections and support arc sections. The passage arc sections permit humor aqueous flow under the implant. The support arc sections make contact with the iris and provide the necessary support for the passage arc sections. Auricles extend from the support arc sections and are configured to hold the implant in place by engaging the eye at the iridocorneal angle. The implant may include an artificial lens and preferably spurs on the support arc sections to anchor for the artificial lens.
US08197539B2

An intraocular camera for retinal prostheses may include an optical imaging system comprising a set of optical elements for forming an image of the external world on an image sensor array, wherein the optical elements and the image sensor array may be enclosed in an implantable biocompatible housing that may employ haptic elements for stabilization within the eye. The set of optical elements may be designed to have a short focal length and to provide adequate resolution images that can be transformed into a set of stimulation signals applied to a pixellated microstimulator array. Transmission of the signals from the intraocular camera to a microstimulator driver circuit may be accomplished either by a wired or wireless communication device. Power and control signals may be provided to the intraocular camera by a wired or wireless communication device, or optically by means of ambient illumination or an optical beam.
US08197520B2

A bone loss plate for the rigid fixation of a bone having a bone gap where portions of the bone are absent, the plate includes an elongated fixation plate having a first plate side, a second plate side, a proximal portion, a distal portion, and a middle portion and a tubularly-shaped containment cage connected to the second plate side of the elongated fixation plate, the tubular containment cage having a length shorter than the elongated fixation plate.
US08197516B2

A lateral fixation assembly engages vertebrae in a spinal column. The lateral fixation assembly includes a housing having a first rod and a second rod supported thereon. The first rod is adapted to be secured to a first vertebra in the spinal column and is fixed in position relative to the housing. The second rod is adapted to be secured to a second vertebra in the spinal column and is movable relative to the housing. Respective pluralities of such first and second rods may be provided. Staples having varying thicknesses may be provided to facilitate the installation of the lateral fixation assembly on the vertebrae in the spinal column. A temporary blocking device can be used to prevent relative movement of the movable rod during the installation of the lateral fixation assembly.
US08197514B2

An implant includes two implant components, each having at least two adjacent support arms, which are connected to one another at one end by means of a bridge and can be spread apart at their free ends, and at least one of which support arms forms a support surface, such that with the free ends of their support arms both implant components are directed towards the free ends of the support arms of the respective other implant component, and that both implant components have slide faces for the support arms of the respective other implant component which are arranged and shaped such that as the two implant components approach one another, the support arms slide on the slide faces of the respective other implant component, and are pivoted thereby, so that the spacing of the upper and lower support surfaces is thereby increased.
US08197500B2

An aneurysm clip has a biological membrane and a metal clip. The membrane is harvested from an animal, crosslinked, and then has its antigens minimized. The membrane also has an active layer coupled thereto. The metal clip has a first clip bar and a second clip bar that are attached to each in a biased manner, a first clip arm that extends perpendicularly from the second clip bar, and a second clip arm that extends perpendicularly from the first clip bar. A first end of the biological membrane is coupled to the first clip arm, and a second end of the biological membrane is coupled to the second clip arm in a manner that defines a receiving portion.
US08197496B2

Disclosed is a closure catheter, for closing a tissue opening such as an atrial septal defect, patent foreman ovale, or the left atrial appendage of the heart. The closure catheter carries a plurality of tissue anchors, which may be deployed into tissue surrounding the opening, and used to draw the opening closed. Methods are also disclosed.
US08197495B2

A biopsy system comprises a control module, a localization assembly, a biopsy device, and a targeting cube. The biopsy device comprises a holster portion and a probe. The probe and/or other associated components are configured to selectively couple with a targeting cube that is configured to selectively couple with a grid plate having apertures for receiving the targeting cube. The targeting cube comprises a body defined by faces. The targeting cube further comprises guide holes that originate and terminate at the faces and pass through the body of the targeting cube to provide passageways through the targeting cube. The intersections of the faces of the targeting cube comprise edges that are comprised of elastomeric material. The elastomeric edges allow for compression and may thus provide a secure fit with a wide range of grid plates having openings of various shapes and sizes.
US08197494B2

A medical device position guidance system having a noninvasive medical device communicable with an invasive medical device. The system provides outputs useful to assess the position of an invasive medical device in an animal, such as a human. A magnetic field is used to gather information about the position of the invasive device. Radio waves are used to communicate this information between the noninvasive device and the invasive device.
US08197482B2

An apparatus and method for forming a tunnel in a bone. The apparatus is used to form a first tunnel in the bone, the tunnel having a longitudinal axis, inserting a first drill guide into the first tunnel, supporting a first tunnel-forming device along an axis defining a first offset relative the longitudinal axis of the first tunnel with the first drill guide, and forming a second tunnel alongside the first tunnel with the first tunnel-forming device, the second tunnel communicating with the first tunnel and defining a single elongated opening.
US08197478B2

An apparatus and method for electrically induced thrombosis. The surgical device includes a first electrode and a second electrode. The first electrode is for placement adjacent to, near, or within a treatment site of a patient. The second electrode can be movable with respect to the first electrode. When the electrodes are charged by an electricity source, negatively charged blood components are attracted to the positively charged electrode while being repelled from the negatively charged electrode. Due to the electric potential between the adjacent electrodes, thrombosis is induced. The negatively charged blood and components form a thrombus or a clot adjacent to the positively charged electrode. The surgical device can be used to induce the otherwise natural process of thrombosis. When the surgical device is used in a treatment site such as a puncture or incision, the thrombosis can seal the opening created by the treatment site.
US08197469B2

A controlled relative motion system comprising a base support, a manipulable support, and a plurality of hinged doubled pivoting links rotatably coupled to the base support and rotatably coupled to the manipulable support. A plurality of force imparting members has at least one coupled to one of the plurality of doubled pivoting links so as to be able to cause it to rotate. Also, at least one is coupled to the base support so as to be able to cause that base support to move toward or away.This joint can be used with a similar control joint, coupled thereto by coupling shafts held apart by a slidable separator, to form an extended length inserter for inserting an object positionable by the insertion joint in an obstructed location reached along a constricted passageway. These structures, positioned within a barrel, can rotate together but an activator slider, positioned at least partially about that barrel though not rotatable therewith, is coupled to the separator to cause sliding thereof.
US08197466B2

A connector includes a male connector section having a cavity, a female connector section having a cavity to which another male connector section the same as the male connector section can be connected, a male lock section or a female lock section, disposed adjacent to the male connector section so that the connection direction thereof is parallel to that of the male connector section, a female lock section disposed adjacent to the female connector section so that the connection direction thereof is parallel to that of the female connector section, and to which another male lock section the same as the male lock section can be coupled, or a male lock section disposed adjacent to the female connector section so that the connection direction thereof is parallel to that of the female connector section, and to which another female lock section the same as the female lock section can be coupled, and a seal member formed from an elastic material, for maintaining liquid-tightness of the connection between the other male connector section and the female connector section in a locked condition where the other male lock section and the female lock section are coupled to each other, wherein an unlocking sound, which enables recognition of unlocking, is generated at a time of unlocking when the locked condition is released.
US08197462B1

A medical practitioner can specify certain parameters for a procedure that involves delivering a therapeutic agent, while leaving other parameters open. The therapeutic agent can be sensitive to biomechanical forces (or other influences) associated with delivery. The procedure can involve regenerative medicine, for example delivering progenitor or stem cells to a diseased heart using a catheter, whereby unbridled transport in the catheter may compromise efficacy. The open parameters can influence efficacy of the agent and thus therapeutic outcome. A computer-based system can apply stored information, such as from databases, to narrow the possible values of the open parameters. From the narrowed possibilities, an optimization routine can determine suitable or optimized values for the open parameters. The determined values can manage biomechanical forces incurred by the therapeutic agent, thereby promoting efficacy and healing. The optimized parameters can guide the practitioner in the procedure.
US08197450B2

An injection device for injection of set doses of medicine from a cartridge has a nut that is screwed up along a threaded piston rod during a dose setting operation. The nut is screwed along the piston rod by rotating a dose setting member. A rotational coupling mechanism includes an axially displaceable coupling member which is rotated as a function of axial displacement. During dose setting, the nut is allowed to rotate relative to the coupling member. During injection, the coupling member is rotationally locked to the nut. This provides a dose setting and injection mechanism wherein the nut member is both rotated during dose setting and during injection.
US08197442B2

A system is provided that includes an elongated introducer navigable through body vessels of a human subject and a pusher component for incorporation within the introducer. The pusher component includes a tubular portion with a slotted section. A radiopaque marker is secured to at least a portion of the slotted section such that an outer surface of the radiopaque marker is substantially flush with an outer surface of the tubular portion immediately proximal and/or immediately distal the radiopaque marker. According to a method of manufacturing such a component, the slotted section is formed by a laser cutting operation and a pre-assembly radiopaque marker member is crimped onto the slotted section.
US08197439B2

A volume of fluid moved by a pump, such as a pump in an APD system, may be determined without direct measurement of the fluid, such as by flow meter, weight, etc. For example, a volume of a pump chamber (181) (having a movable element that varies the volume of the pump chamber) may be determined by measuring pressure in the pump chamber and a reference chamber, both while the two chambers are isolated from each other, and after the two chambers are fluidly connected so that pressures in the chambers may equalize. Equalization of the pressures may be assumed to occur in an adiabatic way, e.g., a mathematical model of the system that is based on an adiabatic pressure equalization process may be used to determine the pump chamber volume. In one embodiment, pressures measured after the chambers are fluidly connected may be measured at a time before complete pressure equalization has occurred, and thus the pressures for the pump and reference chambers measured after the chambers are fluidly connected may be unequal, yet still be used to determine the pump chamber volume.
US08197437B2

An injection system includes an injector for injecting a fluid into a patient and a controller in operative communication with the injector for control thereof. The controller controls a diagnostic injection of the fluid based upon at least one mathematical model individualized to the patient. The model(s) are determined by collecting data corresponding to a time response curve resulting from at least one test injection of the fluid into the patient. The time response curve represents a response of a region of interest of the patient over time due to the fluid passing therethrough. An imaging system having such an injection system is also disclosed, as is a system for effecting a medical procedure. A method of delivering such a fluid to a patient using such an injection system is also disclosed, as is a method of modeling propagation of such a fluid in a patient.
US08197427B2

Acoustical-based methods that increase tissue oxygenation, and equipment for carrying out the methods, are provided. The methods involve exposing tissue to low frequency sound in order to increase blood flow in the tissue, and hence oxygenation of the tissue. The methods may be used to treat or prevent disorders related to ischemia and low blood flow, such as shock, stroke and congestive heart failure.
US08197420B2

The present invention is directed to the parenteral procurement of bodily-fluid samples. The present invention is also directed to systems and methods for parenterally procuring bodily-fluid samples with reduced contamination from dermally-residing microbes. In some embodiments, a bodily-fluid withdrawing system is used to withdraw bodily fluid from a patient for incubation in culture media in one or more sample vessels. Prior to withdrawing bodily fluid into the one or more sample vessels for incubation, an initial volume of withdrawn bodily fluid is placed in one or more pre-sample reservoirs and is not used for the incubation in culture media.
US08197419B2

A biopsy device having a sample size control assembly for selecting the specimen size to be collected. The sample size control assembly includes a rotatable nose on the exterior of the biopsy device for actuating the operation of the sample size control assembly. A needle assembly of the biopsy device can extend through the rotatable nose. A tip protector can be coupled to the sample size control assembly, and can be engaged by a user to operate the sample size control assembly. Also disclosed is a method for making a biopsy device, including coupling a tip protector to a sample size control assembly.
US08197418B2

Microprobes in various designs are provided including microprobes having a bulk base and a thin probe extending from the bulk base and a Wheatstone-bridge sensor circuit for measuring strain in the thin probe, and microprobes with two thin probes extending from the bulk base with their respective integrated Wheatstone-bridges to eliminate common mode forces experienced by the two thin probes.
US08197414B2

Disclosed herein is a system for monitoring a patient that includes a cuff configured to inflate to at least partially occlude an artery of the patient and a cuff controller configured to control inflation and deflation of the cuff. The system also includes a sensor configured to receive a signal associated with the at least partially occluded artery and generate an output signal based on the received signal. Also included is a signal analysis module configured to receive the output signal and determine a first hemodynamic parameter based on a first set of data obtained during inflation of the cuff and a second set of data obtained during deflation of the cuff.
US08197410B2

An ultrasonic diagnosis device having a data collector that collects ultrasonic image data, obtained by scanning a predetermined site of a sample periodically moving, a strain gauge setting unit that sets a predetermined number of strain gauges which includes a plurality of segments connecting two end points one or more middle points existing between the end points in the interesting area, a motion vector information generator that generates motion vector information of the tissue including at least the strain gauges, an image generator that sets a predetermined number of strain gauges in the ultrasonic image data at different time phases during the period and generates a strain gauge image in which the strain gauges are overlapped at a corresponding position, by the use of a tracking process using the set strain gauges and the motion vector information of the tissue, and a display that displays the strain gauge image.
US08197401B2

A stroboscope module has a coupling with which the stroboscope module can be connected to a light connection of an endoscope. The coupling comprises a sleeve and a base, with the base being arranged in the sleeve displacable in an axial direction between a first position and a second position. An elastically deformable cuff having an internal diameter is arranged within the sleeve, into which cuff the light connection of the endoscope can be inserted in the first position. The sleeve and the base compress the cuff in the second position such that the internal diameter of the cuff is reduced and the light connection of the endoscope is locked in the coupling. The sleeve and the base can be locked in the second position.
US08197399B2

A method for displaying images includes adjusting at least one characteristic of an image from a first imaging device of an endoscope to match at least one corresponding characteristic of an image from a second imaging device of the endoscope. The at least one characteristic may be one or more of color, contrast and brightness. An endoscopic system includes an endoscope including a first imaging device and a second imaging device, and a display device that displays an image from the first imaging device of the endoscope and an image from the second imaging device of the endoscope, wherein the images are sized so that an object, when placed at the same distance from the imaging devices, appears to have about the same size in the images.
US08197394B2

It is disclosed a device (1) for altering the storage capacity of a tubular mesh bag of heat sealable material during the manufacture thereof and the bag (15) obtained from its using. The device comprises an expansion core (2) to which the tubular mesh is peripheral, which is essentially oblong and will be inserted vertically inside the tubular mesh, thus determining two from faces (21) and two side faces of said mesh as it passes over the expansion core. The device has a mechanism for inserting, in a variable way as the mesh passes over the expansion core, sections of the peripheral tubular mesh into it, thus accumulating a greater or smaller quantity of mesh in each longitudinal section of mesh corresponding with one bag unit.
US08197386B2

A power transmission device includes a friction clutch operable to selectively transfer torque between an input member and an output member. An actuator is operable to provide an actuating force to the friction clutch. The actuator includes an electric motor having an output shaft drivingly coupled to a pump. The pump is operable to provide pressurized fluid to a piston acting on the friction clutch. A controller that is switched on and off in response to an ignition signal estimates the temperature of the friction clutch at the time of being switched on based on a time the controller has been off. A method of estimating a temperature of the friction clutch is also disclosed.
US08197385B2

This invention relates to a control device for a vehicular power transmitting device. The control device has shifting-point altering means 108 operative such that when a second electric motor M2 is operated with priority to obtain a charging efficiency and/or electric power generating efficiency, a shifting point for a vehicle to run under a decelerating state (during a coast running state) is altered to a point on a higher vehicle speed than that at which a shifting point for a running-performance-conscious state is set. Therefore, when the second electric motor M2 is operated with priority for generating electric power, a downshift is initiated at a high vehicle speed than that at which the downshift is initiated at a shifting point for a running-performance-conscious state. This increases a rotation speed NM2 of the second electric motor M2, resulting in an increase in regeneration amount (electric power generation amount) of the second electric motor M2.
US08197382B2

A transmission is provided having an input member, an output member, four planetary gear sets, a plurality of coupling members and a plurality of torque transmitting devices. Each of the planetary gear sets includes first, second and third members. The torque transmitting devices may include clutches and at least one brake. The torque transmitting mechanisms are selectively engageable in combinations of at least two to establish at least eight forward speed ratios and at least one reverse speed ratio between the input member and the output member.
US08197374B2

An automatic transmission comprises a multi-plate brake to brake a specified rotational element of a transmission mechanism, which includes a plurality of frictional plates, a piston, a piston cylinder member comprising cylinder in which the piston slides, and oil-pressure chambers which are formed between the piston and the cylinder and bias the piston toward the frictional plates with an oil pressure supplied thereto, and a valve body to supply the oil pressure to the oil-pressure chambers. Herein, the valve body is provided in the vicinity of an outer periphery of the piston cylinder member so as to be connected to the piston cylinder member via a connection portion, and there is provided an oil passage to supply the oil pressure from the valve body to the oil-pressure chambers via the connection portion.
US08197363B1

The present invention is a training baseball. The training baseball includes elongated fins that cause the training baseball to have a curved flight when thrown in a straight-throw motion. The present invention also includes a method for using the training baseball.
US08197360B2

A multi-layered golf ball having an inner core, at least one intermediate layer, and outer cover is provided. The intermediate layer is made from a polyurea composition containing ultra-high molecular weight polyethylene powder particulate dispersed therein. The intermediate layer provides the ball with advantageous properties including improved durability, toughness, hardness, and impact-resistance.
US08197358B1

A golf club head having a face component, a crown, and a composite sole with one or more weight ports for receiving one or more weight inserts is disclosed herein. At least part of each of the weight ports is integrally formed in the composite sole, and each of the weight ports include a weight receiving region for receiving a weight and a screw receiving region for receiving a screw that secures the weight in the weight port.
US08197356B2

A golf club head with an improved sweet spot, defined as a portion of the striking face that has at least 99.7% of the maximum ballspeed is disclosed herein. More specifically, the present invention discloses a golf club head with a significantly circular sweet spot that encompasses at least about 1.5% of the total striking face. A golf club head in accordance with the present invention may generally have a improved face geometry with an elliptical factor of greater than about 0.5, a beveled transition portion around the striking face of the golf club head, a variable face thickness region with decreases thickness, or even a tilted bulge and roll radius all helping improve the performance of the golf club head.
US08197355B2

An iron-type golf club head having a coated stepped sole is disclosed herein. The coated stepped sole is stepped such that the sole surface furthest from the face is raised away from the turf to minimize the turf contact through a golfer's swing particularly for the longer, less lofted irons. The surface friction is reduced by applying a thin dense chromium coating thorough electroplating to the stepped sole.
US08197350B2

A ride-on activity device is disclosed, wherein the device includes a seat, a base and a connector for movably connecting the seat relative to the base. The connection between the seat and the base allows multiple degrees of freedom such that the seat is capable of bouncing and rotating relative to the base. The connection between the seat and the connector includes a rotation safety mechanism that allows rotation at the connection when the seat is occupied by a user and prevents rotation at the connection when the seat is unoccupied. Furthermore, the connector includes a resilient member that allows the seat to bounce vertically relative to the base.
US08197328B2

A game involves emulating spinning and randomly stopping virtual reels. If a special symbol is displayed in the matrix, and the special symbol is not used in a winning combination of symbols, then, for the next game, the special symbol is held in its position in the array, and all the reels are spun to randomly display symbols in all positions in the matrix other than in the special symbol position. If the special symbol is used in a winning combination of symbols, the special symbol is not held. The machine may hold the special symbol for an unlimited number of games as long as the player makes a maximum bet or an extra bet. Under certain conditions, an award for a winning combination using the held special symbol is enhanced the longer the special symbol is held without being used, so the player desires to not utilize the special symbol right away.
US08197327B2

Gaming machines, methods, and programs are provided for displaying gaming results through a player interaction process that provides multiple prize enhancements for a player and varies the prize enhancements during the course of play. One preferred game includes conducting multiple instances of a first game to obtain a number of first game outcomes. These first game outcomes will include a number of prize enhancer activating outcomes, which may cause a change in the game prize distribution. Each respective prize enhancer activating outcome prompts persistent display of a respective prize enhancer symbol. In some versions, one or more of the prize enhancer symbols are multiplier values. The symbols move in graphic sequence to a bonus round where they occupy spaces in a multiplier wheel, which is spun along with a prize wheel to determine a total prize.
US08197325B2

A process provides indicates, with a display module, on a display a first price category and a second price category in which an instant online lottery ticket can be purchased for an instant online lottery game and a supplemental game. The first price category is distinct from the second price category. The first price category corresponds to (i) a first known portion of an instant online linear prize and a first known portion of an instant online non-linear prize associated with the instant online lottery game and (ii) a supplemental game prize. The second price category corresponds to (i) a second known portion of the instant online linear prize and a second known portion of the instant online non-linear prize associated with the instant online lottery game and (ii) the supplemental game prize.
US08197322B2

Apparatuses and methods for facilitating access to a plurality of gaming activities via a processing arrangement involve facilitating player identification of a set of gaming activities selected from the plurality of gaming activities. A collection of references are assigned to the set of the gaming activities. Each of the references refers to at least one of gaming activities of the set of gaming activities identified by the player. The collection of references is stored in a computer-readable medium, and player access to the set of gaming activities is facilitated using the stored collection of references.
US08197321B2

A gaming system which provides the player a plurality of playing cards to form an initial primary poker hand and also displays one or more other poker hands. The player selects one or more of the initially dealt cards in the primary poker hand to hold or to discard. The held cards are also held in one, more or each of the other simultaneously displayed hands. The gaming device evaluates the held cards and determines which poker game outcomes are possible based on the held cards and the remaining cards in the deck. The gaming device utilizes a stored table of different distributions of poker game outcomes which would result in each payout amount and a table regarding which poker game outcomes are possible based on the player's held cards to determine a distribution of outcomes that provides a total payout equal to the payout of the predetermined game outcome.
US08197319B2

A gaming system having a multiple hand Blackjack game is provided. The Blackjack game includes four cards initial dealt to the player and four cards initially dealt to the dealer. First, the gaming system sets the four dealer cards to form a first two-card dealer hand and a second two-card dealer hand, according to a set of predetermined rules. Similarly, the player sets the four player cards to form a first two-card player hand and a second two-Card player hand. The gaming system reveals an upward in the first dealer hand and then enables the player to modify the first player according to predetermined Blackjack rules. The gaming device modified the first dealer hand according to predetermined Blackjack rules. If the first player hand beats the first dealer hand, the player wins an award. The gaming device resolved the second player and dealer hands in a similar fashion.
US08197312B2

An agricultural combine unloader extension is provided that can be used to extend the reach of conventional unloader tubes and for preventing the loss of crop material residing within the unloader tube from falling out and becoming waste. The unloader extension is hingedly connected to the unloader tube, wherein a drive mechanism is configured to rotate the unloader extension about a vertical axis from a discharging position to a closed or storage position.
US08197310B2

A dust box includes: an attachment portion configured to be attached to a dust-discharging nozzle extending from a housing of an electric tool; and a dust-collecting portion connected to the attachment portion and configured to store dust particles to be discharged from the nozzle. The dust-collecting portion mainly consists of a box which is made of synthetic resin and configured to be detachably connected to the attachment portion, and a paper bag received in the box and configured to store the dust particles to be discharged from the nozzle.
US08197309B2

The present invention discloses a grinding wheel assembly including a coupling member, two clamping disks and a grinding wheel. There is a plurality of bulged anchor rims around the coupling member. On both sides of the coupling member, there are two hollow ducts which are linked through a first shaft duct in the center and surrounded by a plurality of laterally penetrated ventilation openings. Two clamping disks are symmetrically mounted onto the grinding wheel. On one side of each clamping disk are anchor troughs, ventilation holes, cylinders and shaft ducts, and on the other side is a polygonal trough. There are cogs around the grinding wheel and there are clamping troughs and a plurality of mounting troughs on each side of the grinding wheel. In the center of the grinding wheel is a coupling opening whose inner wall has a plurality of concaved anchor openings. From above interrelated mechanical design, it tends to make the coupling member, two clamping disks and the grinding wheel tightly anchor with each other, so that the object of being installed or uninstalled easily, being steadily structured and being used for longer life time can be achieved.
US08197307B1

A surface polishing system leaving a surface free from streaks and swirls after the application of a polishing composition into a painted metallic surface includes a polish applicator having a vibrating motion attached to a pad assembly covered with a supersoft 100% polyester material and a polishing composition of 15-30% by weight of high purity aluminum oxide having a particle size of no greater than 0.3 micron or 300 nanometer and 3-20% by weight of calcined alumina comprising at least 70% α-aluminum oxide (Al2O3) with a low calcination degree and a primary crystal size of less than 1 micron, the combined high purity aluminum oxide and calcined alumina having a total concentration of 30-40% by weight of the polishing composition.
US08197305B2

A dynamic pressure in the coolant supplied between a rotating grinding wheel and a rotating workpiece is released by making at least one of oblique grooves on the grinding wheel pass vertically through a contact surface on which a grinding surface of the grinding wheel contacts the workpiece. Where one and the other side intersection points are defined as intersection points at which both ends of each oblique groove respectively cross extension lines of one and the other side edges parallel to a grinding wheel circumferential direction of the contact surface, the other side intersection point of each oblique groove overlaps the one side intersection point of an oblique groove next to each such oblique groove by a predetermined overlap amount in the grinding wheel circumferential direction, and the length in the grinding wheel circumferential direction of the contact surface is made to be shorter than the overlap amount.
US08197300B2

Correction of grinding spindle positions in double-side grinding machines for the simultaneous double-side machining of semiconductor wafers is achieved by torsionally coupling the two grinding spindles, each comprising a grinding disk flange for receiving a grinding disk, and providing a measuring unit with an inclinometer and two sensors for distance measurement, between the two grinding disk flanges such that the grinding spindles are essentially in the position they would have with mounted grinding disks during the grinding process, wherein the coupled grinding spindles are rotated while inclinometer and sensors determine radial and axial correction values of axial alignment to adjust the grinding spindles to a symmetrical orientation. The spindle positions may be corrected under the action of process forces.
US08197299B2

Milling strategies for machining dental ceramic materials are provided that reduce milling time while maintaining strength, accuracy and marginal integrity.
US08197298B2

A toy vehicle includes a central housing having first and second oppositely disposed sides. A first wheel is rotatably mounted on the first side of the housing and a second wheel is rotatably mounted on the second side of the housing. Each of the first and second wheels has a central hub. Each hub has a center disposed along a common first axis of rotation. A plurality of vanes are attached to the hub and form the first and second wheels. An end of each vane distal to the hub forms a circumferential surface portion of one of the first and second wheels. Each vane is individually and separately manually angularly repositionable about a second axis of rotation extending transversely with respect to the first axis of rotation.
US08197295B2

The present invention relates to a method for manufacturing a light-emitting device. At least one of a light-emitting film forming step, a conductive film forming step and an insulating film forming step is carried out while holding a substrate in a manner that an angle subtended by a surface of the substrate and the direction of gravity is within a range of from 0 to 30°.
US08197294B2

There is provided a method of producing an organic EL light-emitting device which enables prevention of crosstalk between adjacent pixels of the same color. Provided is a method of producing an organic EL light-emitting device which has banks provided in a row direction and in a column direction, and a plurality of organic EL light-emitting portions isolated from each other by the banks. The method includes the steps of forming banks such that a height of a bank portion of a row direction and a height of a bank portion of a column direction are different from each other; and applying an organic EL material in a continuous manner along the bank portion which is higher of the bank portion of the row direction and the bank portion of the column direction, between the banks of the higher bank portion.
US08197293B2

A mooring assembly for a vessel comprises a receiving vessel part, a geostationary part received rotatably in said receiving vessel part and a main bearing assembly connecting the geostationary part to the receiving vessel part. The main bearing assembly comprises at least two separate bearings which are manipulable such that the one or the other or both bearings are in an operative position, thus allowing the non-operative bearing to be replaced, overhauled, repaired and alike in situ.
US08197292B2

The invention concerns a marine vessel propulsion system that can be set into an opening of a boat's hull and which comprises a propulsion and steering unit (9) that can be rotated or swivelled about a vertical axis (z) and which is fixed to the hull by a securing mechanism (12) having a predetermined fracture point or level. It is proposed that a protective plate (13) is arranged on the boat's hull in the aft direction (opposite to the direction of travel F) and behind the propulsion and steering unit (9).
US08197278B2

A locking cord connector assembly may include a male housing and a female housing. The male housing defines a male interior chamber configured to house one of a plug or outlet portion of an extension cord. The male housing includes male threads outwardly extending from an outer surface, and at least one tab. The female housing defines a female interior chamber configured to house the other of the plug or outlet portion of an extension cord. The female housing includes female threads inwardly extending from an interior surface. The at least one tab cooperates with a portion of the female housing to provide a ratcheting mechanism configured to maintain a secure connection between the male and female housings.
US08197276B2

A low-profile electrical connector includes a housing having exterior perimeter sides and top and bottom surfaces, where the bottom surface is configured to extend along a user's body site and the top surface is spaced above the bottom surface. The connector also includes a side-entry guide channel disposed along the bottom surface. The channel includes an opening along the exterior perimeter side that is configured to receive an electrically conductive element. The channel is also configured to guide the electrically conductive element within the housing. The connector includes a receptacle positioned within the housing and forms an electrically conductive interface with the electrically conductive element.
US08197271B2

A lever engagement type connector includes a first connector housing having a retaining portion and a second connector housing. A lever formed with a cam groove is rotatably attached to the first connector housing. An engagement pin engaged with the cam groove is projected on the second connector housing. A wire cover is attached to the first connector housing. An engagement portion engaged with the retaining portion is provided in the wire cover. The lever is formed with a jig insertion hole at a position where an engagement area between the retaining portion and the engagement portion is covered by the lever in a state that the lever is disposed at a position other than a predetermined position.
US08197269B2

An electrical protection for mounting on a wire connector housing, wherein the wire connector housing comprises a fixed hole and a plurality of wire-lock apertures exposed on a top surface of the wire connector housing, and the electrical protection comprise an insulating body and an insulating protrusion located at bottom surface of the insulating body. The insulating body is used to cover the wire-lock apertures at the top surface of the wire connector housing, and the insulating protrusion is designed and constructed to fit into the fixed hole of the wire connector housing. The wire-lock apertures of the wire connector housing are all covered and insulated to prevent electrical shock from the electrical leakage through the exposed apertures.
US08197268B2

An electronic device includes a first opening disposed in a casing; a power source connector disposed opposing the first opening and to which a detachable power supply plug that supplies power from a power supply unit is attached; a second opening disposed in the casing; and a support member by which at least one interface connector among various types of interface connectors for communication with an external apparatus can be attached at the second opening, where the support member covers and hides the power source connector if among the various types of interface connectors, an interface connector having a power supply terminal is attached.
US08197263B2

An electric receptacle and junction box for a solar cell module includes an enclosure base and an enclosure cover. The base has a first connector element for electrically contacting a strip conductor of a solar cell module, and a first conductor rail electrically connected to the first connector element. The cover has a second connector element for electrically contacting an output line, and a second conductor rail electrically connected to the second connector element. The first connector element and the first conductor rail are rigidly mechanically connected to the base. The second connector element and the second conductor rail are rigidly mechanically connected to the cover. Electrical contact is made between the first connector element and the first conductor rail and the second connector element and the second conductor rail in response to the enclosure cover and the enclosure base being joined together.
US08197262B2

An electrical contact is provided for an electrical connector that is mounted on a printed circuit. The electrical contact includes a mating segment having a mating interface configured to engage a mating contact of another connector. The electrical contact also includes a tail segment having a mounting interface configured to be mounted to the printed circuit. An intermediate segment extends between and interconnects the mating and tail segments. The intermediate segment includes a base wall extending a length from the tail segment to the mating segment. The intermediate segment further includes a side wall extending outwardly from the base wall along at least a portion of the length of the base wall. The side wall extends outwardly at a non-parallel angle relative to the base wall for affecting at least one of an impedance, an insertion loss, or a reflection of the electrical contact.
US08197258B2

Computer-implemented method for enhancing the cognitive ability of a participant using face-name associations. A plurality of facial images of people are provided for visual presentation to the participant, each person having a name. A learning phase is performed, including concurrently presenting a first facial image of a person from the plurality of facial images, and the name of the person. A testing phase is then performed, including: presenting a second facial image of the person from the plurality of facial images, displaying a plurality of names, including the name of the person and one or more distracter names, requiring the participant to select the name of the person from the plurality of names, and determining whether the participant selected the name correctly. The learning phase and the testing phase are repeated one or more times in an iterative manner to improve the participant's cognition, e.g., face-name association skills.
US08197257B2

A dual-swing breach training system is provided that includes a door having a removable strike plate therein and a removable means for adjustably securing the door and the doorframe in a coaxial position, that is readily removable to meet various training needs. A base for the system that does not obstruct access to the door during training is also provided.
US08197251B2

The present invention provides a gas burner, preferably a premix burner, comprising a support having a central gas inlet port for supply of gas into a gas supply chamber. The gas supply chamber is enclosed by a first metal burner membrane at its side and an end cap opposite to said gas inlet port. The end cap is connected to the top of the first burner membrane. The burner membrane is connected at the bottom to the support through its base section. The end cap is formed by a second burner membrane. The exterior surface of the first burner membrane and the end cap is made of perforated heat-resistant sheet metal plate.
US08197250B2

Disclosed are heaters having at least one adjustable fired burner and an adjustable fired burner for use with various types of heaters. The heaters may be part of an industrial processes such as petroleum refining. The adjustable burners are configured to be adjusted and positioned in any direction and then be locked into place. The adjustable burners may be adjusted automatically or manually. The ability to quickly adjust the position of an adjustable burner results in substantially less or virtually no damage to elements in the heater and provides for a more even distribution of heat within the heater.
US08197247B2

A mold plate module includes a mold plate and an inserting block. The mold plate includes a first surface, a blind hole defined in the first surface, a through hole defined in a bottom surface of the mold plate in the blind hole, two mold cavities, and two first sub-runners. The two first sub-runners are defined in the first surface, and connect the corresponding mold cavities to the blind hole. The inserting block includes a second surface, a lateral surface, a block through hole defined in the second surface, and at least one second sub-runner defined in the second surface. The at least one second sub-runner communicates with the block through hole and extends toward and terminating at the lateral surface. The inserting block is detachably received in the blind hole and rotatable relative to the mold plate to switchingly couple the at least one second sub-runner with the first sub-runners.
US08197243B2

A head assembly (10) is provided for use in a rotary head extruder (12) for extruding a food product. The head assembly (10) includes an annular-shaped stator plate (20) and a rotating blade plate (22). The blade plate (22) preferably includes at least six blades, each with a wedge shaped profile, and the stator plate (20) includes extrusion channels that extend at an angle in the range of 20°-50° from tangent to a circle defined by an inner surface (30) of the plate (20).
US08197234B2

An electromagnetic actuator for a microfluidic pump of the type that causes periodic pinching and releasing against the walls of a fluidic channel, e.g., a tube. At least one permanent magnet is placed against the walls of the fluidic channel, and located in an area with magnetic fields, produced by coils that are radially symmetric to the channel. The permanent magnet is cause to press and release against the wall of the fluid channel to cause a fluid flow through the channel.
US08197232B2

A fluid pump kit is provided. The kit includes a magnetic driven member for coupling with and rotating a propeller, and a magnetic driver for magnetically coupling to and driving the magnetic driven member by a magnetic attraction force establishable between the magnetic driver and the magnetic driven member. A motor of the kit operates the magnetic driver. First and second casings are provided for housing the magnetic driver and the magnetic driven member, respectively. The first and second casings with housed magnetic driver and magnetic driven member, respectively, are detachably securable to opposite sides of a non-magnetic spacer solely by the magnetic attraction force establishable between the magnetic driver and the magnetic driven member sufficient to support the second casing and the housed magnetic driven member in a particular position without the use of mechanical aids.
US08197225B2

Slip joint clamps are installed against guide ears of diffusers at jet pump slip joints. Clamps may prevent vibration and/or movement in the slip joint while not being rigidly attached to the diffuser. Clamps include a compression flipper pressing against a guide ear of the diffuser in a substantially radial direction, a biasing member between the compression member and guide ear that presses the flipper against the guide ear, and supporting structures that hold the flipper and biasing member to the inlet mixer about the guide ear. Systems of slip joint clamps are installed against several guide ears of a single diffuser. Each clamp may radially stabilize the diffuser and inlet mixer while permitting upward relative movement of the inlet mixer. Placement and tensioning of clamps in such systems may be varied so as to prevent or reduce vibrations and/or oscillations between an inlet mixer and diffuser.
US08197224B2

To improve the fluid output flow characteristics (14) of a synthetically commutated hydraulic pump (1), it is suggested to use a plurality of different valve (10) actuation strategies. For every fluid flow demand region I to VI a certain actuation strategy is chosen.
US08197218B2

Thick airfoil families with desirable aerodynamic performance with minimal airfoil induced noise. The airfoil families are suitable for a variety of wind turbine designs and are particularly well-suited for use with horizontal axis wind turbines (HAWTs) with constant or variable speed using pitch and/or stall control. In exemplary embodiments, a first family of three thick airfoils is provided for use with small wind turbines and second family of three thick airfoils is provided for use with very large machines, e.g., an airfoil defined for each of three blade radial stations or blade portions defined along the length of a blade. Each of the families is designed to provide a high maximum lift coefficient or high lift, to exhibit docile stalls, to be relatively insensitive to roughness, and to achieve a low profile drag.
US08197214B2

A compact variable pitch fan has a hydraulic pitch change mechanism. A pitch change piston is constrained to follow reciprocating motion under hydraulic control within a peripheral hub from which fan blades extend outward. An additional feature is the use of separated guiding and seal surfaces. A still further feature is the use of a pitch sensor, particularly on the hydraulic line leading to the variable pitch fan.
US08197213B2

A turboprop including a rotary casing fitted with adjustable-pitch blades enabling thrust to be managed. Each blade is coupled, for the purpose of adjusting its pitch, to a control member of an annular actuator carried by the rotary casing.
US08197199B2

A turbocharger includes a center housing having a bearing surface configured to contact an inner surface of a unison ring. A conversion coating is impregnated onto at least the bearing surface of the center housing.
US08197193B2

An air distribution blower housing has an adjustable restriction in the interior of the blower housing. The adjustable restriction has the configuration of a rectangular plate. One edge of the plate is connected by a pivoting connection to an interior wall of the blower housing in the air flow path from the blower housing. The plate can be pivoted about the pivot connection through a plurality of adjusted angular positions of the plate in the air flow path. In each adjusted position of the plate, the length of the plate extends from the pivot connection in the air flow direction. A sliding connection is provided between the plate and at least one side wall of the blower housing. The sliding connection selectively holds the plate in its adjusted angular position and also provides a visual indication on the exterior of the blower housing of the adjusted angular position of the plate inside the blower housing.
US08197188B2

A compressor for compressing a gas comprises an impeller wheel mounted within a housing (2) defining an inlet (8) and an outlet (6). The inlet (8) has a plurality of apertures (20) in the form of bores or grooves defined in its surface that serve as an integral silencer. The inlet (8) may comprise a map-width enhanced structure (4) with the bores provided on one to a number of surfaces. The design provides for a compact and efficient compressor with noise reduction such that higher pressure ratio designs may be adopted. The apertures (20) may be provided in the housing (2) that defines the inlet (8) or in a separate insert.
US08197175B2

The light-weight live-floor module has a floor surface, parallel cables laid on the floor surface, a length of conveyor belt laid on the cables, a movable bulkhead and a winch system for moving the belt, the cables and the bulkhead back and forth in unison, such as a shuttle. The belt has just enough length to cover the return axis and the floor surface on which goods are transported, thereby reducing any unnecessary weight in the live floor structure. The cables and the belt are wrapped over different axes for eliminating relative movement between the cables and the belt. One axis is set higher than the floor surface for easily breaking static friction under the belt. In a method for breaking static friction between a conveyor belt and a floor surface, a first segment of the belt is jolted upwardly while tension is applied in the belt.
US08197167B2

A load indicating fastener comprising a load indicator, a fastener body, and a securing mechanism retaining the load indicator on the fastener body. The load indicator has integral protuberances struck and partially sheared from the load indicator to project from a face and leave corresponding indentations in an opposite face. The securing mechanism may be a member extending radially outward from the shank of the fastener body, such as a plurality of spaced apart tabs; at least one thread; at least one flare, stake, or form; a step ring; a series of bumps; a knurl; and one or more lobes. Alternative embodiments of the securing mechanism include a key-and-keyhole combination; an interference fit facilitated by a chamfer or by one or more lobes or by shaped surfaces of the fastener body and of the load indicator; one or more tack welded interconnections; and an adhesive patch.
US08197165B2

A fastening device for fastening a movable element to a structure includes a support member and at least one belt retractor having a retractable belt and a fitting. The belt retractor may be fastened to a support member. The belt retractor is arranged in such a way that, if the fitting couples the structure and the movable element, the retractor prevents unrolling of the belt by more than a predefinable range if an external force, such as sudden mid-air turbulence acts on the movable element. Thus, the movable element is secured.
US08197155B2

Disclosed is a connecting device of a parking cable for an electric parking brake, which connects an actuator for the electric parking brake with a parking cable. The connecting device includes a connector and a reaction force member. The connector includes a small diameter section having one side into which an outer peripheral surface of the parking brake is inserted, a large diameter section that extends from the small diameter section to have a diameter larger than that of the small diameter section, an axial cutout slit axially formed through upper and lower surfaces of an outer peripheral portion of the large diameter section such that protrusions circumferentially protruding from the actuator are inserted into the axial cutout slit through the large diameter section, a circumferential cutout slit that extends from an inner end of the axial cutout slit in a circumferential direction, and a cutout groove that axially extends from the circumferential cutout slit. The reaction force member is inserted into the large diameter section to press the protrusions such that the protrusions are seated in the cutout groove through the axial cutout slit and the circumferential cutout slit. According to the connecting device, the assembly work is facilitated, so the assembly efficiency can be improved and connection work using the connector can be easily performed.
US08197153B2

A self-retaining anti-rotation clip for a spherical-bearing rod end has two opposing spacer plates, each spacer plate having a curved edge portion for surrounding at least a portion of a ball of the rod end. A connector plate connects the spacer plates, such that the spacer plates are spaced from each other and generally parallel to each other. A retainer is carried on the clip and adapted for retaining each spacer plate in a position generally adjacent one side of a body of the rod end, such that the spacer plates are free from interference with the ball of the rod end.
US08197138B2

An evacuable container includes a first side wall having an interior surface and an exterior surface. The first side wall includes an aperture between the interior surface and the exterior surface. A second side wall has an interior surface and an exterior surface. The second side wall is connected to the first sidewall such that the interior surfaces of the first and second side walls form an interior of the container. A sheet has a first surface and a second surface. The first surface faces the exterior surface of the first side wall. The sheet is sealingly attached to the exterior surface of the first side wall so as to form a flow chamber between the first side wall and the sheet. The sheet includes (i) a plurality of flow channels disposed on the first surface, and (ii) an aperture between the first surface and the second surface. A check valve is disposed in fluid communication with the aperture in the sheet. An evacuation path can be formed from the interior of the container to an exterior of the container through the aperture in the first side wall, the flow chamber, the aperture in the sheet, and the check valve.
US08197117B2

A system and method for agitating pouched products traveling along a conveyor belt to facilitate heat transfer, blending, mixing and/or stirring of the contents thereof. An agitation station is located along the conveyor belt, and includes an agitator secured to one end of an arm, the arm being pivotally secured to the frame supporting the conveyor belt.
US08197115B2

Light sources in a luminaire attach to the luminaire by one or more tabs. Up to three axis of rotation are possible. Bendable tabs enable a first axis of rotation of the light source. Light sources are rotatable about a mounting point to the tab providing a second axis of rotation. Some tabs are twistable about a third axis of rotation. Some tabs also conduct heat away from the light source. Tabs can also be formed in a baffle plate for new luminaires or for the retrofit of existing luminaires. Multiple types of light sources can be combined to provide luminaires with custom light patterns and intensities.
US08197106B2

A hot-melt glass pillar lamp and a multi-channel heat dissipation method thereof; the pillar lamp comprises a base, a hollow steel frame which is mounted on the middle of the base, several sections of pillar-shaped hot-melt glass lamp which surround the steel frame and are sequentially arranged on the base from down to up in an overlapping manner, and a lamp cover with air outlets, wherein, each section of the pillar-shaped hot-melt glass lamp comprises a fixing framework which is composed of a plurality of supporting bars and a supporting board; each surface of the fixing framework is separately provided with a hot-melt glass lamp plate; an LED lamp plate is arranged at a certain distance from the inner side of each hot-melt glass lamp plate, and on the corresponding surface of the steel frame. The present invention integrates the semiconductor lighting and the crystal optical refraction technologies, has ideal lighting effect and landscape ornament effect; and the pillar lamp is internally provided with at least one air convection channel from down to up, thereby being greatly convenient for the air convection heat dissipation of the power part and the luminous body in the pillar lamp, ensuring a long-term safe use, and meeting the decorative lighting demands of modern high grade buildings.
US08197099B2

The invention provides an electronic component mounting module capable of increasing the adhesion between the board and the heat radiating member, improving the thermal conductivity, and effectively radiating heat generated from the LEDs being an electronic component. The LEDs are mounted on the surface of the ceramics board, and the rear surface 1b side of the board is disposed at the heat radiating member. A metallic fine particle layer having high thermal conductivity and flexibility is made to intervene between the board and the heat radiating member.
US08197097B2

The light source unit is provided with a substrate and a decorative cover having thermal conductivity. The substrate includes a circuit pattern area, in which a plurality of LED chips are disposed, at the middle part thereof, has thermal conductivity, and transmits heat from the circuit pattern area to an area in the outer circumferential direction thereof. The decorative cover encloses the substrate, is electrically insulated from the circuit pattern area, and is thermally coupled to the surface side of the substrate at the periphery of the circuit pattern area by being face-contacted thereto. Heat of the substrate can be radiated by the decorative cover while securing an electric insulation property with respect to the circuit pattern area.
US08197096B2

A light source device includes a light source unit emitting light of a first wavelength and a wavelength converting element converting light of the first wavelength into light of a second wavelength. An external mirror transmits light of the second wavelength toward an emission destination and reflects light of the first wavelength to resonate between the light source unit and the external mirror. A wavelength separating section transmits light converted from the first wavelength to the second wavelength while traveling from the external mirror to the light source unit and reflects light of the first wavelength in order to separate the different wavelength light. A turnback section reflects light of the second wavelength separated by the wavelength separating section toward the emission destination. In addition, the wavelength separating section reflects light of the first wavelength from the light source unit to travel toward the wavelength converting element.
US08197092B2

A lighting apparatus including a plurality of lighting members configured to be connected to each other in a series configuration and a plurality of retractable housing members each positioned between the plurality of lighting members and each configured to include retractable wires on opposed ends thereof. The plurality of lighting members are adapted to be selectively repositioned with respect to each other via the opposed retractable wires of each of the plurality of retractable housing members.
US08197090B2

The invention relates to an LED package having a large beam angle of light emitted from an LED, simplifying a shape of a lens and an assembly process, and to a backlight unit using the same. The LED package includes a housing with a seating recess formed therein and at least one LED seated in the seating recess. The LED package also includes a lens having a predetermined sag on an upper side thereof, covering an upper part of the LED. The LED package and the backlight unit using the same can emit light uniformly without bright spots formed in an output screen, uses a simpler shaped lens with an increased beam angle, and minimizes a color mixing region to achieve miniaturization.
US08197089B2

An LED lamp at least includes an LED lamp set and an adjustment assembly. The LED lamp set includes an LED set and a cooling set. The LED set includes at least one LED lamp element which is replaceable individually and a holder to hold the LED lamp element. The cooling set is fastened to the holder. The adjustment assembly includes an adjustment member and an adjustment holder that contain mating engaging portions engageable with each other. The adjustment member is coupled with the adjustment holder and the LED lamp set to provide adjustment function of light illumination angle. The invention further includes an assembly dock coupled with a plurality of LED lamp sets and adjustment assemblies according to requirements to enhance expandability and usability. The structure thus formed can be assembled and disassembled easily, and also provides greater expandability, replacement capability and practicality.
US08197088B2

A light-emitting display system has interlocking tiles. In an implementation, each tile has a portion of a clamp that joins with another portion of the clamp on another tile. A tile is removed from the display by unlocking the clamp portions. The tile is removed without affecting the position of the other tiles in the display.
US08197084B2

A mobile illuminating device includes a generally cylindrical housing including: illuminating elements in the form of light-emitting diodes (LED) fixed on a support plate, electrical/electronic control and/or connectors between the illuminating elements and a battery. An axially extending section of the housing forms an interior space divided into a plurality of receptacles occupying respective circumferentially adjacent portions of the axial section. A first of the receptacles contains the diodes and a second of the receptacles contains batteries.
US08197082B2

The present invention relates to a backlight unit with a light emitting diode block assembly connected thereto, and a liquid crystal display having the backlight unit. In one embodiment, the backlight unit includes a plurality of light source blocks each of which includes a substrate having a light source and an electrode portion formed thereon; a connector electrically connecting the light source blocks to each other, coupled to the light source blocks in contact with one side of the connector, and fastening the light source blocks to each other by cross-coupling the light source blocks; and a supporter disposed on the other side of the connector. In this manner, LED blocks can be simultaneously both electrically and mechanically coupled, using a relatively small and simple number of connectors, facilitating reliability and ease of manufacture.
US08197080B2

An illumination device for a multineedle sewing machine is disclosed. The sewing machine includes a plurality of needle bars having lower ends to which needles are attached respectively and a needle bar case supporting the needle bars so that the needle bars are movable upward and downward. The illumination device includes an illuminating member having a light source, and a support unit located in the needle bar case for supporting the illuminating member so that the illuminating member is switchable between an illuminating position where the illuminating member is located in front of the needle bars or the needles to illuminate a periphery of a needle point of the needle location point of the needle by the light source and a storage position where the illuminating member opens a front side of the needle bar or the needle and is located laterally with respect to the needle bar case.
US08197072B2

Provided is a light emitting device of an electronic device, provided with a DLP (Digital Light Processing) projector and a display unit, which is configured in such a manner that the light generated by the operation of the DLP projector can be re-used as a backlight light of the display unit. The disclosed light emitting device includes a first mirror for projecting a light of the DLP projector on a flat area provided ahead of the first mirror in an intermediate operation state of the first mirror; a light concentration mirror for converging the light projected on the flat area, the light concentration mirror being provided at a position adjacent to the flat area; and an optical fiber for transferring the light converged by the light concentration mirror to the display unit and enabling re-use of the transferred light as a light for a backlight of the display unit.
US08197069B2

A projection apparatus includes a projection unit which forms a picture corresponding to an input image signal and projects the formed picture onto an object, a specifying unit which specifies a region in the picture projected by the projection unit, and a projection control unit which causes the region of the picture projected by the projection unit to be limited according to the region specified by the specifying unit.
US08197068B2

A laser projection system is provided comprising a light source, a phase retarding element, and a beam scanning element. The light source comprises at least one frequency-converted laser source comprising a wavelength-tunable laser diode and a wavelength conversion device. The phase retarding element is configured to resolve the polarization of a frequency-converted laser beam into two orthogonal linearly polarized components such that one component of polarization is phase delayed relative to the other. Frequency-converted laser beam polarization in the 2D image frame is a function of the degree to which the respective components of polarization are delayed relative to each other and varies with wavelength variations in the output of the wavelength-tunable laser diode. Polarization variations of the frequency-converted laser beam in the 2D image frame are sufficient to scramble image speckle patterns across the 2D image frame. In another embodiment of the present disclosure a laser projection system is provided where the system comprises a wavelength-tunable laser diode comprising a phase control section. The laser projection system is programmed to apply a dither signal to the phase control section and the dither signal introduces wavelength variations in the output of the wavelength-tunable laser diode. The wavelength variations in the output of the wavelength-tunable laser diode reside within a FWHM conversion bandwidth of the wavelength conversion device and are at a rate that is sufficient to scramble pixel-specific polarizations and image speckle patterns across the 2D image frame. Methods of operating laser projection systems are also provided.
US08197067B2

A projection type display apparatus includes: a reflective polarizing plate for each color light which transmits each of R light, G light and B light therethrough, allows each transmitted light to enter a corresponding reflective liquid crystal panel for each color light, and reflects image light of each color which has been subjected to light modulation in accordance with an image signal of each corresponding color light by the reflective liquid crystal panel for each color light; an absorption type polarizing plate for R and G lights and a reflection type polarizing plate for B light, each of which removes an unnecessary polarized component from the image light of each color reflected by the reflective polarizing plate for each color light; a color combination optical system which subjects the image light of each color transmitted through the transmission type polarizing plate for each color light to color combination.
US08197060B2

A roll paper printer enables opening the cover and platen using a 4-part parallel linkage mechanism without interfering with the inkjet head. The cover unit for the roll paper compartment of the roll paper printer opens and closes by means of the parallel linkage mechanism. The back end part of the platen frame part of this linkage mechanism is connected to the top end part of the rear parallel links and so that the can move down.
US08197058B2

A method for inkjet printing includes, in order, the steps of a) providing an ink-receiver having an image thereon; b) forming on the ink-receiver a layer of a first curable liquid and curing the layer; and c) forming an outermost layer of a second curable liquid only on the cured first curable liquid and at least partially covering the image; wherein the second curable liquid contains an abherent agent which is absent in the first curable liquid and wherein at least one of the first and second curable liquids is inkjet printed. Also, a polymerizable abherent agent may be used in a curable liquid to prevent falsification of an ID document. Also, a set of curable liquids for inkjet printing includes a first curable liquid and a second curable liquid wherein the second curable liquid contains an abherent agent which is absent in the first curable liquid.
US08197052B2

A technique capable of efficient, high speed processing for the formation of an organic compound layer by using an ink jet method is provided. In the method of forming an organic compound layer by using the ink jet method, a composition containing an organic compound having light emitting characteristics is discharged from an ink head, forming a continuous organic compound layer. The organic compound layer is formed on pixel electrodes aligned in a matrix shape, and is formed in a continuous manner over a plurality of pixel electrodes. A light emitting device is manufactured using organic light emitting elements in accordance with this manufacturing method.
US08197051B2

Disclosed are an ink jet recording ink set which is suppressed in bleeding and shot droplet interference and can form a high quality image and an ink jet image recording method. The ink jet recording ink set has plural liquids including at least a first liquid and a second liquid. The second liquid contains a polymerizable compound and the first liquid contains a high-boiling point organic solvent and the high-boiling organic solvent meets any one of the following requirements (A) to (C) and an ink jet image recording method includes supplying a first and a second liquid simultaneously or sequentially to a recording medium such that both liquids are in contact with each other, to form an image: (A) it has a viscosity of 100 mPa·s or less at 25° C. and a viscosity of 30 mPa·s or less at 60° C. and has a boiling point of 100° C. or higher, (B) it is represented by the following formula (I), and (C) it is represented by the following formula (II):
US08197050B2

Provided are an inkjet printing apparatus and an inkjet printing method in which a high-quality image free of peeling of an image face can be printed, while an amount of a treatment liquid consumed is reduced. For that purpose, a group of pigment-based inks excellent in wettability with respect to the treatment liquid (small in contact angle with respect to the treatment liquid) are made relatively small in a proportion of the treatment liquid applied to a position to which the pigment-based ink concerned is applied. In contrast, a group of pigment-based inks poor in wettability (great in contact angle with respect to the treatment liquid) are made relatively great in a proportion of the treatment liquid applied to a position to which the pigment-based ink concerned is applied.
US08197046B2

In an ink-jet printer of the present invention, an ink circulation path 4 is formed by an ink head 2, a first tank 31, a second tank 32, and a pump 33. The ink-jet printer switches between an ink-circulation state and a no ink-circulation state during a printing operation, and is capable of performing printing in either of the states.
US08197043B2

An ink jet printing apparatus having reduced manufacture costs is provided. The ink jet manufacturing apparatus includes a diaphragm section configured to be able to change the volume of a subtank, and an atmosphere communication port configured to allow the interior of the subtank to communicate with the atmosphere. The ink jet printing apparatus further includes an atmosphere communication valve configured to be able to close the atmosphere communication port, and a driving mechanism configured to drive the diaphragm section and the atmosphere communication valve. The driving mechanism opens the atmosphere communication port and then reduces the volume of the diaphragm section. The driving mechanism subsequently allows the atmosphere communication valve to close the atmosphere communication port and then increases the volume of the diaphragm section. The driving mechanism thus supplies the ink accommodated in a main tank to the subtank.
US08197036B2

A liquid discharging head includes a plurality of nozzles for discharging liquid, a channel member formed of a metal plate, and a contacted member for being contacted by the channel member. The channel member includes a plurality of liquid chambers, each of which is connected to one of the plurality of nozzles, and a separation wall for separating adjacent liquid chambers from each other. The separation wall includes a center portion and a contact surface. The center portion is provided at a center of the separation wall in a long direction of the separation wall. The contact surface contacts the contacted member, and is tilted in a cross-section of at least the center portion of the separation wall taken in a short direction of the separation wall.
US08197029B2

Fluid ejection nozzles having a tapered section leading to a straight walled bore are described. Both the tapered section of the nozzle and the straight walled bore are formed from a single side of semiconductor layer so that the tapered section and the bore are aligned with one another, even when an array of nozzles are formed across a die and multiple dies are formed on a semiconductor substrate.
US08197018B2

A computer enclosure includes a housing, a cover, a lock rod and an operating member. The housing includes an upper plate and a bottom plate opposite to the upper plate, with two protruding bars respectively formed on opposite inner surfaces of the upper plate and the bottom plate. Each protruding bar forms a latch hook and defines a notch. The cover forms a limiting portion defining a receiving groove. The lock rod is moveably received in the receiving groove. The operating member is slidably assembled onto the cover and fixed to the lock rod. The operating member is capable of moving the lock rod to pass through the notch and latch to or detach from the latch hook, such that the cover can be assembled onto or disassembled from the housing.
US08197017B2

A drawer that includes a container and an activation member is disclosed. The container includes a receptacle and a lid. The lid moves between an open position allowing access to the receptacle and a closed position restricting access to the receptacle. The container further includes a fastener, coupled to the lid, to fasten the lid to the receptacle when the lid is in the closed position. The activation member moves radially around a longest axis of the activation member, and includes an actuator. When the activation member is rotated in a first direction, the actuator is placed into a first orientation relative to the fastener. When the activation member is rotated in a second direction opposite the first direction, the actuator is placed into a second orientation relative to the fastener such that the actuator actuates the fastener to cause the lid to move into the open position.
US08197014B2

A brake system for a vehicle includes a parking brake with an air-quantity-boosting-valve device for aerating and deaerating at least one spring brake cylinder of the parking brake, at least one electrically actuatable control valve for controlling the air-quantity-boosting-valve device, an electrical control device electrically coupled to the electrically actuatable control valve for controlling the electrically actuatable control valve, and an electrical actuating device coupled to the control device for actuating the parking brake. In order to be able to resort to available series-produced components, the air-quantity-boosting-valve device, the control valve, the electrical control device and the actuating device are, in each case, embodied as autonomous components arranged spatially separate from one another.
US08197009B2

Wheelchair seat back mounting hardware permits the seat back to be mounted on various wheelchairs. The mounting hardware may be in the form of two-point mounting hardware that connects the seat back to the wheelchair and permits the seat back height to be adjusted independently of the mounting hardware location on the wheelchair.
US08197005B2

An infant care apparatus includes a base; a drive mechanism disposed on the base; a controller electronically coupled to the drive mechanism; and a support device coupled to the drive mechanism. The support device is configured to be moved in both a horizontal and vertical direction relative to the base by the drive mechanism. The drive mechanism is controlled by the controller to move the support device in a plurality of motion profiles relative to the base.
US08196995B2

A diversion apparatus, adapted to be arranged at the tail end of a vehicle, includes a diversion assembly and a slide mechanism. The inside of the diversion assembly is hollow and formed an airflow channel. The slide mechanism is arranged fixedly at the tail end of the vehicle body and has slot tracks extended along the lengthwise direction of the tail end of the vehicle body. The diversion assembly arranged on the slot tracks can be moved and slid thereon. Therefore, the diversion assembly can be slid on the slot tracks and moved toward the front of the vehicle body to prevent the opening of the door leaf of the vehicle from being hindered by the diversion assembly.
US08196987B2

A storage panel assembly for a vehicle includes a panel having louvered exterior and internal surfaces. A vent structure is formed on a portion of the panel. At least one lug nut retention assembly is formed on the portion of the panel including the vent structure. The exterior louvered surface of the panel remains unblemished.
US08196986B2

A Rapid Deployment Modular Carrier (RDMC) that incorporates a unique locking system and auxiliary control systems for the loading, transportation, and unloading of Rapid Deployment Modules (RDM's). The locking system has a hinging powered arm, linear driven pin, and rotating locking clip. The auxiliary systems has an electronic control panel that manages the engagement and disengagement of the locking system. The control panel also manages the suspension components of the RDMC, adjusting ride height and handling characteristics as needed.
US08196984B2

An apparatus for removing earrings from a display card includes a pronged mechanism for slipping between the ornamental portion of the earring and the card. A user applies leverage to the pronged mechanism to separate the earring from the card. The pronged mechanism can be enhanced with a cover for preventing the earring from flipping away as it is removed from the card. The cover can be attached to the pronged portion using any suitable resources, such as a band, adhesive or hinge. When the pronged mechanism removes the earring from the card, the earring retainer on the back of the earring necessarily also separates from the card, so the device can be further enhanced with a cup for catching and containing the earring retainer. The apparatus can be a single, integrated device, and is of a sufficiently diminutive size to avoid unwieldiness of use and to prevent damage to the earring itself.
US08196980B1

A clean-up device for picking-up, containing, and disposing of pet waste. The device includes a handbag for housing a liner feeding mechanism, motor-vacuum, and suction hose. The liner feeding mechanism positions a liner over an opening of the handbag. The suction hose is actuated by the motor-vacuum and inwardly pulls the liner with waste into the suction hose. The motor-vacuum sanitarily shrink wraps the liner around the waste. Once wrapped, the waste is disposed of directly into a trash receptacle. The handbag includes a telescoping handle including buttons which electronically communicate with a control panel to actuate the motor-vacuum, suction hose, and liner feeding mechanism. While in use, a user simply places the opening of the handbag directly over waste and presses the buttons to pick-up, wrap, and dispose of waste in a safe, efficient, and sanitary manner.
US08196978B2

A carrier for a front end module as a front structure of a vehicle, and a front end module system, comprises a sub frame formed to extend horizontally across an opening of a quadrangular main frame in which a radiator is to be arranged, and air guides are formed on the main frame and the sub frame to project forward.
US08196971B2

A clamp connector for pipeline connecting pieces (5) has two clamping ring parts (1, 3) pivotably connected at one end between spread positions and clamping positions. A clamping device is situated at the opposite end of the clamping ring parts (1, 3) from the pivot connection (11). The clamping device has a clamping screw (19) pivotable from an active position with the clamping screw (19) interacting with the clamping ring parts (1, 3) to generate a clamping force pressing the clamping ring parts (1, 3) into the clamping positions, and a release position with the clamping screw (19) pivoted away from the clamping positions to release the clamping ring parts (1, 3). The clamping device has a locking device (25, 27) which, in its active state prevents the clamping screw (19) from being pivoted into the release position and which, as a function of the spread of the clamping ring parts (1, 3), passes through an opening angle from the active state into a release state in which the clamping screw (19) can be pivoted out.
US08196967B2

A fitting for making a metal-to-metal fluid seal between a first conduit and a second conduit and corresponding first and second fluid passages. The first conduit has a generally spherical-shaped exterior surface, and the second conduit has a generally conical-shaped interior surface for receiving the generally spherical-shaped exterior surface of the first conduit. A nut is engaged with a threaded exterior surface of the second conduit, tightening of the nut on the threaded exterior surface urging the first and second conduits axially together to apply increasing pressure. A ring can be positioned between the nut and the first conduit, the ring providing a lower net coefficient of friction during tightening of the nut compared to direct contact between the nut and first conduit. The ring can be radially spaced from a radially facing interior surface of the nut.
US08196949B1

A protective cover for use in connection with a weight distribution type towing hitch assembly includes means for encasing a weight distribution type towing hitch assembly, having both means for preventing contact injury to passersby and means for containing grease associated with the weight distribution type towing assembly; and means for securing the protective cover to the weight distribution type towing assembly. The cover is formed as a laminate of an outer layer, a grease barrier and a cushion located between the outer layer and the grease barrier. The outer layer forms a number of attachment flaps, which are provided and arranged such that in addition to providing a means for securing the protective cover to the hitch assembly also at least in part provide the means for containing grease.
US08196948B2

An elevating device for seat cushion of bicycle includes a cylinder having at least one level to expand or contract inside a frame tube of a bicycle frame, a stick for operating the cylinder, and a driving device for driving the stick. By the driving device, the stick below the seat cushion will press the cylinder so as to make an adjustment of the height of the seat cushion. Therefore, the elevating operation for seat cushion of bicycle is easy and convenient to adjust a proper height of the seat cushion for getting on/off the bicycle and also for comfortable riding.
US08196944B1

Wheeled carts, such as a wheel chair and similar devices have a steering wheel, with the steering wheel having a housing to receive the globular wheel, with a seal movably holding the globular wheel in the housing; and a series of friction-reducing bearings being positioned between the globular wheel and the interior of the housing, and held within the housing by the seal in combination with the globular wheel.
US08196943B2

An axle housing (110) for clamping with a clamp assembly (118, 218) to a spring (16, 216) of a suspension system (14) of a vehicle, the clamp assembly having at least two U-bolts (120, 220) each having a curved portion (136, 236) and two generally linear legs (128, 228) extending therefrom, and a clamping plate (122, 222) for receiving and attaching the legs of the U-bolts to form an enclosure that clamps the axle housing (110) to the spring (16, 216), the housing having a generally oval shape in cross section. The axle housing (110) has a generally planar fore side (132), a generally planar aft side (134), a generally rounded top surface (144) and a generally rounded bottom surface (146), wherein at least one of the top surface and the bottom surface are sized and arranged to mate flushly with the curved portion (136) of the U-bolts (120).
US08196941B2

A strut assembly includes a top mount assembly, a shock absorber, a multi-piece lower spring seat and a spring extending between the top mount assembly and the multi-piece lower spring seat. The multi-piece lower spring seat includes a spring seat belt holding the spring and a plurality of seating supports that are attached to the shock absorber and which support the spring seat belt.
US08196940B2

A suspension arm may include a metal ball housing, a metal bushing housing, a metal connecting portion including a ball housing annulus at an end portion thereof, wherein the metal ball housing is inserted and mounted in the ball housing annulus, and wherein the other end portion of the metal connecting portion is connected to the metal bushing housing, and a reinforcement member wrapping the metal ball housing, the metal bushing housing and the metal connecting portion.
US08196934B2

A slider seal assembly for a gas turbine engine includes a housing, a seal plate moveable relative to the housing and a retaining ring. The housing includes an outer surface, an inner surface, and a recessed opening between the outer surface and the inner surface. The seal plate is received within the recessed opening. The inner surface of the housing includes a curved portion which is curved in an outward direction toward the outer surface.
US08196929B2

The present invention provides a gaming machine game for providing an electronic game for play by a player using a plurality of cards. The game includes a wager placed by the player and a player hand including at least four cards. A player score is calculated for the player hand according to a set of cribbage rules. The player receives a payout based on the wager if the player score exceeds a predetermined total. The payout preferably increases as the player score increases based on the odds of achieving a given player score. The game may include an initial player hand, with the player replacing between none and all of the cards from the initial player hand to create the player hand. The game may be played using a video display or live.
US08196924B2

An upstream-side printing unit group and a downstream-side printing unit group, respectively, are driven by separate prime motors and synchronously controlled. In addition to rotary encoders for the upstream-side and downstream-side prime motors, rotary encoders are provided on a last impression cylinder of the upstream-side printing unit group and a first transfer cylinder of the downstream-side printing unit group to detect differences between rotational phases, which the upstream-side and downstream-side printing unit groups should have, and the actual rotational phase of the last impression cylinder of the upstream-side printing unit group or the first transfer cylinder of the downstream-side printing unit group. In accordance with the rotational phase differences, the rotational speeds of the prime motors are corrected.
US08196923B2

A sheet skew-correcting device includes a sheet-conveying rotation body for conveying a sheet, a skew-correcting member that contacts an end of the sheet conveyed by the sheet-conveying rotation body for correcting skew of the sheet, and a driving unit for moving the skew-correcting member. The skew-correcting member moved in a sheet-conveying direction by the driving unit contacts the end of the sheet conveyed in the sheet-conveying direction by the sheet-conveying rotation body, so as to correct the skew of the sheet.
US08196919B2

A lock mechanism is disclosed for a sheet store adapted for the dispensing or accepting of sheets. The sheet store comprises a container having a lid operable for access to the interior of the container and a shutter operable for the passage of sheets therethrough. The lock mechanism comprises: a locking plate movable relative to the container, the locking plate being operable to control a lid lock element and a shutter lock element; and an actuator arranged to control movement of the locking plate. The locking plate is movable between three positions, including: a closed position, in which the shutter lock element prevents opening of the shutter; a primed position, in which the shutter can be opened; and an open position which controls the lid lock element to permit opening of the lid.
US08196915B2

A sheet processing apparatus includes: a staple tray on which sheets are stacked temporarily and stapled after being aligned together and from which the stapled sheets are discharged to a discharge tray; a discharger to discharge the sheets to the staple tray; a rear end reference against which rear ends of the sheets are abutted to be aligned together; a returner to return the sheets discharged by the discharger and to align the sheets together in a conveying direction based on the rear end reference fence; a lifter to lift and lower the returner with respect to a sheet; and a guide configured to guide the sheets toward the rear end reference fence when the sheets are returned and to be lifted and lowered in synchronization with the lifting and lowering by the lifter.
US08196906B2

A fluid aerator (1) comprising a fluid vessel (2) and a pipe (4) extending from the interior of the fluid vessel (2) to the exterior. The pipe (4) has inlet means for permitting liquid to flow into the pipe (4) from the vessel (2) and is closed at its lowermost end but has one or more outlet holes (8) arranged in the wall of the pipe where the fluid exists from the pipe (4). The pipe (4) is movable relative to the vessel (2) between a first position in which the outlet holes (8) are distant from the vessel and a second position in which the outlet holes (8) are closer to the vessel. By means of the movable fluid supply pipe (4) the same fluid aerator can be used both in relation to delivering aerated fluid into a large bottle and to delivering smaller amounts of aerated fluid to a smaller container, such as a wine glass.
US08196903B2

An aromatic nebulizing diffuser includes a base panel (10), a power adapter (20), an electric fan (30), a shell (40), a fluid container (50), an oscillator (60) and a top over (70). The oscillator (60) oscillates an aromatic fluid in the fluid container (50) to produce a fine mist. The fluid container (50) has an air conduit (53) that reduces in direction from its bottom air inlet (531) toward its top air outlet (532) for causing acceleration of the speed of the induced flow of air to carrying the fine mist of aromatic fluid droplets out of jet holes (71) on the top cover (70). The fluid container (50) is detachably fastened to the base panel (10) by means of plugging bottom mounting rods (512) of the fluid container (50) into respective tubular upright posts (12) of the base panel (10), facilitating cleaning.
US08196899B2

A boat lift motor, comprised of a motor, such motor driving worm gear reducer which, in turn, rotates a tubular drive shaft, such shaft having radial splines running its full length, both outside and inside; wherein the opposite end of the splined tubular drive shaft overlays a spline shaft mounted on the center axle/bolt of a boat winch; wherein the winch is rotated to wind and unwind a cable, rope, cord or chain; and wherein the engagement or disengagement of the power supply to the boat lift is initiated by an electronic controller, which opens and closes a relay upon the user's command, communicated via a handheld remote control or otherwise.
US08196898B1

The present invention relates to a water-stop plug of the flush valve including a connecting sheet, a fixing component and a casing body. The connecting sheet includes a ring part and a pair of hook-hanging parts, and users are capable of choosing the ring part or the pair of hook-hanging parts to fix the water-stop plug to the overflow tube according to the original overflow tube structure, and thereby being able to replace different types of water-stop plugs of flush valves.
US08196897B2

A gas tap for controlling the flow of a gas to a cooking appliance. In one embodiment, the gas tap includes a body and a rotatable regulation member positioned within the valve body, the valve body having a stationary groove for the inlet of gas from an exterior wall surface to an interior wall surface of the body, the regulation member having a passage opening for the inlet of gas from an exterior surface to an interior cavity of the regulation member, the passage opening moving with an angular rotation of the regulation member. The groove and passage opening are shaped, dimensioned and positioned relative to one another such that the regulation of an intermediate gas flow Qgra (a flow between Qmax and Qmin) is proportional to the angular displacement of the rotatable regulation member.
US08196890B1

There is provided a display system that may be hung and that holds one or more pouches or bags containing an item to be used. The display is made from a blank having upper, middle and lower panels and an upper edge. There is a tab arrangement on the upper panel for holding the merchandise to be displayed. The bags are inserted from the back of the blank between the upper and middle panels and attached to the tab arrangement. After the bags are attached to the tab arrangement, the upper edge of the upper panel is inserted between the lower and middle panels and the lower panel is folded over the upper panel in order to hold the bags relatively firmly on the tab arrangement. The display may then be hung by the use of slots or hooks in the upper panel.
US08196889B2

Introduced Disposition In Support For Plasma Television Sets And Its Similar, idealized in the form of a practical and functional support kit for holding plasma or LCD (‘liquid crystal display’) television sets, belonging to the field of mechanics, and to which was given an original manufacturing disposition, by consisting of a set of television set (1) fixing elements, formed by two or more hinged disks (2), two or more supports (3) and two or more catches or wedges (4), besides the standard screws M4, M5, M6 or M8 (P), screws with corresponding sleeves and washers, that promote the installation in independent fixing points, thus making the model universal, easily adaptable, and not needing the previous determination of the perforations contained on the television set, in the VESA standards, at the time of acquisition of the support kit.
US08196886B2

A mechanism for gripping an article including a housing, a piston slidably housed within the housing, a plunger slidably housed within the housing, wherein the plunger is at least partially extendable out from the housing, the plunger including a gripping surface, at least one spring operatively arranged between the piston and the plunger for relating a change of a position of the piston to the plunger, and a cam eccentrically rotatable about an axis and operatively engaged with the piston for setting the position of the piston.
US08196882B2

A movable pole support includes an upper block and a lower block, each formed with a pole-receiving bore. The blocks are separated by a number of extension posts that maintain the blocks in a parallel position and spaced-apart to define a gap. The gap is sized to accept the edge of a table or counter, and the lower block is equipped with a locking screw that may be threaded into the lower block to secure the movable pole support onto a table or counter. The upper and lower blocks may be formed with a receiving groove shaped to receive a raised table rim, or a lower lip edge. A damage-resistant pad may be provided on any table-contacting surface to avoid damage to the table or counter being used. The movable pole support may also have a pole set screw insertable into the upper block to secure a pole securely within the pole-receiving bore.
US08196875B2

An exemplary support stand includes a base, a connecting assembly, a support bracket, two first hinge assemblies, and two second hinge assemblies. The connecting assembly is arranged between the base and the support bracket. The first hinge assemblies rotatably connect the connecting assembly to the base. The second hinge assemblies rotatably connect the connecting assembly to the support bracket. The connecting assembly comprises a connecting bracket and a connecting plate partially received in the connecting bracket. The connecting plate, the connecting bracket, one first hinge assembly, and one second hinge assembly form a quadrangle.
US08196874B2

The present invention is directed to a base member for a portable intravenous stand. The base member includes a plurality of segments configured to facilitate the close nesting or alignment of multiple portable intravenous stands; and thus reducing the amount of space required for storing the portable intravenous stands when not in use.
US08196871B2

A micro-electromechanical system (MEMS) dielectric barrier discharge (DBD) based aerodynamic actuator is configured to modify a shockwave boundary layer interaction and limit incident boundary layer growth caused by a reflected shockwave.
US08196862B2

A high-altitude aircraft powerplant including an engine, a two-stage turbocharger having an intercooler and an aftercooler, a cryogenic hydrogen fuel source, and a cooling system including a hydrogen heat exchanger. Aided by a ram-air cooler that cools a coolant to a near-ambient temperature, the heat exchanger is configured to heat the hydrogen using the coolant, and to cool the coolant to a temperature well below the ambient temperature during high-altitude flight. The intercooler and aftercooler use the sub-ambient temperature coolant, as does a separate sensor. The ram-air cooler includes a front portion and a rear portion. The cooling system includes three cooling loops which respectively incorporate only the front portion, only the rear portion, and both portions of the ram-air cooler.
US08196854B2

A vertical take-off aircraft comprising a main power plant 1 at the top of the aircraft which consists of an assembly of blades 2, 3, a rotor 4 and a main engine assembly 5. The main power plant is connected to the main body 6 of the aircraft by a tilt enabling joint 7. The tilt enabling joint is connected to the main body by a telescopic tube assembly comprising tubes 12 and 13. To counter the rotational force exerted on the main body 6 of the aircraft by the rotation of the blades 2, 3, an additional power plant 15 is attached to the main power plant. Tilting the main power plant causes tilting of the additional power plant.
US08196852B2

A crank assembly for a hose reel is provided. The crank includes an axle rod and a triangular frame assembly. The axle rod extends perpendicular to the triangular frame assembly. The axle rod extends from the medial portion of on of the three tubular members. In this configuration, and when the crank is in use, force is distributed to opposing sides of the axle rod. Further, the triangular shape provides a support for a flat plate upon which an indicia may be displayed.
US08196845B2

A nozzle includes an inlet at an upstream end of the nozzle, a discharge outlet at a downstream end of the nozzle, and a fluid delivery passage extending between the inlet and the discharge outlet. Exterior and interior walls of the nozzle have downstream tip ends that are relatively longitudinally movable at one or more interfaces. An internal insulating gap is interposed between the interior and exterior walls to insulate fuel from ambient temperature conditions exterior to the nozzle. One or more flexible seal structures internal to the nozzle isolate a portion of the insulating gap from any ambient fluid entering into the gap through the one or more interfaces while providing relative movement between interior and exterior walls of the nozzle.
US08196842B2

There is described a system and method for automatically discriminating between different types of data with an image reader. In brief overview of one embodiment, the automatic discrimination feature of the present image reader allows a human operator to aim a hand-held image reader at a target that can contain a dataform and actuate the image reader. An autodiscrimination module in the image reader in one embodiment analyzes image data representative of the target and determines a type of data represented in the image data.
US08196841B2

In a method of providing a packaging laminate with an identification code the packaging laminate is subjected to a magnetic field, thus magnetising a matrix of magnetic domains in the packaging laminate. Each magnetic domain is made up of a number of the magnetisable particles. A method of identifying a package is also disclosed. The package has walls of a packaging laminate comprising magnetisable particles. The method comprises the steps of subjecting the packaging laminate to a magnetising magnetic field, thus magnetising a matrix of magnetic domains in the packaging laminate, and detecting an emitted magnetic field emitted by the magnetic domains in the matrix. A package having an identification code is also described.
US08196834B2

A scan module in a reader for, and a method of, electro-optically reading symbols, include a light source for directing light at a symbol during reading, a light detector for detecting return light from the symbol during reading and for generating an electrical signal indicative of the detected return light, and an object sensor for sensing an object bearing the symbol and for generating a trigger signal for initiating the reading. The light source, the light detector and the object sensor are all supported by a common chassis.
US08196829B2

The invention refers to a chip module comprising at least one memory and/or microprocessor chip and at least one antenna element connected to said chip. Further the invention relates to a SIM card comprising a dielectric substrate, eight or more contact pads provided on one side of said dielectric substrate, at least one memory and/or microprocessor chip provided on the other side of the substrate and connected to said contact pads, a first antenna element provided on the same side of the dielectric substrate as the chip, wherein the first antenna element has at least one driving point and at least one termination point, a second antenna element provided on the same side of the dielectric substrate as the first antenna element, wherein the first antenna element is given in an area different from the area where the contact pads are arranged, and the chip can be accessed by a wireless communication link with help of the antenna operating at a frequency of more than 800 MHz.
US08196815B2

To provide alphanumeric data, such as a PIN code, to a smart card (2) a terminal (1) is used which is capable of communicating with the smart card. The terminal comprises a keypad (4) for entering the alphanumeric data and an associated keypad matrix (5) for producing key signals, which the keypad matrix (5) is scanned for any pressed keys using a scanning sequence so as to produce key signals. To securely enter the data without the risk of the terminal intercepting them it is proposed that said scanning sequence is determined by the smart card (2). In this way, the terminal has no knowledge of the actual keys pressed and the secrecy of the alphanumeric data is ensured.
US08196811B2

A multiple criteria buying and selling system and method is provided. A seller initially establishes a deal structure for a product, which provides seller defined selling criteria information relating to the purchasing of the product, such as volume per unit price, quality, delivery time and warranty information. A buyer will be able to review a list of deals if the seller's selling criteria matches a buyer defined buying criteria. The deal structure is preferably set up so as to provide buyers with both price and non-price criteria information that the buyer's would consider important in a purchase of the type of product being offered by the seller. The deal structure is electronically made available to potential buyers of the product. For example, the deal structure may be displayed on an Internet site.
US08196804B2

The invention relates to a method for soldering components, in particular heat exchanger, in particular made of aluminum materials, aluminum alloys or wrought alloys, in a soldering furnace, in particular a continuous soldering furnace or a batch-type soldering furnace, which comprises a muffle, which is flushed with protective gas in order to create a protective atmosphere. In order to make the production of soldered components easier, during the soldering of the components the muffle is supplied with such a greatly increased amount of gas, in particular protective gas or reaction gas, that a low-oxygen protective atmosphere is created.
US08196800B2

Friction welding systems and methods including a welding arrangement configured to impart kinetic friction between at least one surface of a first workpiece and at least one surface of a second workpiece to form a weld, a force providing mechanism arranged and disposed for applying a force to one or both of the first workpiece and the second workpiece, and a sensor arranged and disposed to measure a parameter of the welding arrangement, wherein an amount of vibration is determinable from the measured parameter.
US08196794B2

A multi-piece die and system for driving a self pierce rivet into a plurality of workpieces. The die includes an anvil and a collar affixed to the anvil. The anvil and collar cooperate to reduce stresses to reduce breaking of the die.
US08196790B2

A suction cup includes a suction cup main body, an attachment surface and a gel layer. The surface of the gel layer serves as a suction surface. In a method of manufacturing a suction cup, a cavity is formed in the inside of a common mold and a primary mold. Next, a synthetic resin material is injected into the cavity, to mold the suction cup main body. Subsequently, the primary mold is opened, to obtain the suction cup main body. Next, a secondary mold is mated to the common mold, whereby a cavity is formed in the inside of the common mold and the secondary mold. Subsequently, a gel is injected into the cavity, to mold the gel layer. Next, the secondary mold is opened, to obtain a suction cup composed of the gel layer and the suction cup main body, on the common mold.
US08196782B2

Device for ice cream distributor in cooled windows and similar, fit to prevent the ice cream melting in the outlet area comprises at least a duct with an outlet hole and control element of the ice cream flow. In the outlet duct (2) is inserted a piston (5) with a stem (6), or similar, which, at distributing position, is placed beyond the outlet hole (3) through which the ice cream exits. while, at rest position, is placed before the outlet hole (3), in such a way to block the ice cream exit. During the return motion, the piston (5) brings back the ice cream already in the duct into the inner portion of the cooled space, delimited by the dividing wall (4), or in same container (1), in such a way to avoid the ice cream melting at the end portion.
US08196779B1

A dispenser for a liquid in a container and for mounting to differently configured places. The dispenser includes a support, a valve body, and a mount. The support supports the container in an inverted position. The valve body is operatively connected to the support and dispenses the liquid from the container while simultaneously venting air to control flow of the liquid through the dispenser. The mount is operatively connected to the support and mounts the dispenser to the differently configured places.
US08196778B2

Systems for dispensing heated liquids, such as hot melt adhesives, with the assistance of process air. The dispensing system may include a control operative to independently control a characteristic of the process air dispensed by a first dispensing module compared to the same characteristic of the process air dispensed by a second dispensing module.
US08196771B1

A portable organizer for a food product, such as hot dogs or sausages, related food items such as buns, and related utensil and condiments, that is compact and easily carried. The organizer comprises a base and a lid, the base having a plurality of rows of compartments for food products and condiments. The organizer also has drawers for storing utensils. The organizer is of an appropriate size and made of an appropriate material to be stored in a cooler and may also have wheels and be used as a rolling serving tray.
US08196770B2

A fluid supply assembly. The fluid supply assembly includes a disposable cup and lid, and a reusable cup holder and outer lid.
US08196761B2

Shelving system has first and second lateral support elements for a plurality of shelves. The shelves formed from metal wire mesh structure and including a base wall and at least two mutually parallel side walls. The support elements and shelves including, respectively, elements and counter-elements for removably connecting shelves to support elements. The two side walls connected to the base wall and shaped for stacking one shelf on another with base walls of the shelves mutually superposed, one in contact with another, to reduce overall disassembled system size. Each shelf base wall lower face has at least one seat sunken with respect to side walls, to at least partly house at least a portion of one support element. The shelves shaped for housing, in the upper face of the base wall between the side walls, at least a portion of the other support element, to reduce overall disassembled system size.
US08196758B2

A frame assembly includes upper and lower frame units, four vertical frame rods, four pairs of top and bottom female connectors, eight male connectors, and first and second bolts. Each frame unit includes four rectangularly-arranged horizontal frame rods. Each female connector interconnects an adjacent pair of the horizontal frame rods, and includes two horizontal tenons engaging respectively the adjacent pair of the horizontal frame rods. The male connectors are connected respectively to opposite ends of the vertical frame rods. Each male connector includes a vertical tenon engaging a respective one of the opposite ends of the vertical frame rods, and an engaging block mating with a respective one of the female connectors. The first and second bolts are for securing releasably and respectively the female connectors to the male connectors.
US08196743B2

A needle-holding device (1) suitable in particular as a package comprises a flat needle carrier section (4) and an adjoining section that has a clamping lip (5) that is resiliently biased against the needle carrier section (4). The clamping lip (5) reaches around the stitch-forming sections of the needles (2) which are held lying next to each in contact with each other on the needle carrier section (4). The resiliently yielding clamping lip (5) permits the insertion and the pull-out of one, several or of all the needles (2).
US08196741B2

A package assembly includes a panel, an array of openings defined in the panel, and a plurality of syringe wells. The panel includes an upper surface. Each of the syringe wells is individually associated with a different one of the openings. The panel and the plurality of syringe wells are integrally formed as a unitary structure. Each of the syringe wells is configured to removeably receive a syringe assembly.
US08196735B2

The preferred embodiment of the trash-and-recyclables collection and lowering system includes a paternoster like structure that includes a frame, a vehicle subsystem that includes a plurality of trash and recyclables carrying gondolas, guiderails and a drive system, a pair of chains that is connected to the plurality of gondolas at the bottom mid point of the gondolas, and a control subsystem. The system is powered by at least one motor that includes a motor shaft equipped with a worm gear that rotates a shaft on which a pair of sprockets in the top segment of the structure subsystem is mounted. The structure subsystem faces a wall a multi-story building that includes a plurality of trash and recyclables disposal windows. The gondolas are normally kept immediately under the trash and recyclables disposal windows, and are periodically lowered, and their contents are emptied to the trash or recyclables bin at the bottom of the structure.
US08196731B2

A manufacturing chain includes a plurality of modular manufacturing stations positioned in series and defining a forward transport direction. An article transportation device of at least one modular manufacturing station is configured to move a carrier in a reverse transport direction while an article transportation device of at least one other modular manufacturing station is driven in the forward transport direction.
US08196730B2

Mobile bagging machine systems and methods may relate to a mobile bagging machine that includes a variable-width tunnel, a variable-speed rotor, a relatively narrow rotor of large diameter and increased effective surface area, at least one material reservoir, a material conveyor system capable of continuous material processing during exchange of unloading vehicles, and/or an overall width less than approximately three meters.
US08196729B2

A portable truck dump comprises a conveyor system mounted on an elongate frame to transport material from a first end of the frame to a second, opposite end of the frame. A grate is positioned over the conveyor system and is supported by first and second sides of the frame. A ramp extends generally perpendicular to the frame on each side of the frame next to the grate to provide a drive-over access for a material transport vehicle to deposit its load over the grate and onto the conveyor system and a portion of each ramp. A first end of each ramp immediately adjacent to the frame is pivotally connected to the frame to allow the ramp to be articulated towards the grate to move excess material off of the ramp and into the grate.
US08196725B2

A device for connecting, in a rotationally fixed manner, a shaft to at least one component which is rotationally supported on the shaft, such as a gear wheel of a gear in a transmission. The device includes an actuating element that is rotationally fixed, but axially slides on the shaft, such that when the element is actuated by an actor, the element actively, frictionally communicates with the component to at least approximately equalize a rotational speed difference, between the component and the shaft. The actuating element can be actuated by the actor with a force to frictionally connect the component to the shaft in a rotationally fixed manner. The device further includes a holding device, which retains the actuating element in a shift condition essentially equivalent to the rotationally fixed condition of the component without further actuation of the actor.
US08196718B2

A combined service brake and the stored-energy brake cylinder is provided, in which a ventilation valve which forms or shuts off a flow connection between the spring chamber and the service brake chamber of the brake cylinder ensures that disruptive noise is avoided while also preventing loss of air volume for building up the service brake force.
US08196713B2

To provide the mechanical type brake actuator for a drum brake that can reduce the number of operational steps and that assures the brake cable connection accuracy. In the mechanical type brake actuator having a strut engaging with one brake shoe and a plate-like brake lever engaging with the other brake shoe, a retaining member having a tongue is mounted in a portion of the strut so that the retaining member resiliently deforms toward a free end of the brake lever, and when the retaining member is resiliently deformed, a connecting-pin is capable of penetrating a by-pass hole of the retaining member to connect a brake cable and the free end of the brake lever, and the connecting-pin movement is restricted after releasing a resilient deformation of the retaining member after connecting the brake cable and the brake lever.
US08196712B2

A device for surveying an enclosed structure (10) includes a platform (24) configured to longitudinally traverse the structure (10), at least one first distance) sensor (48) connected to the platform (24) and configured to measure a lateral distance between a point on the platform (24) and a wall of the structure (10), at least one second distance sensor (50) connected to the platform (24) and configured to measure a longitudinal distance between a point on the platform (24) and a first end of the structure (10), and a transport machine (22) configured to move the platform (24) substantially longitudinally within the structure (10).
US08196711B2

An elevator system is obtained which is capable of assigning a suitable car by taking into consideration a change of a maximum speed or an acceleration according to the result of prediction of a change of a car load or a moving distance with respect to a hall call. In the elevator system having a group management control device (20), provision is made for a destination floor registration unit (11) that registers a destination floor according to a call into a call registration device (10) at the time of call registration, and an assignment control unit (21) that assigns a suitable car to a destination call registration request from the call registration device (10). The assignment control unit (21) includes a prediction time calculation unit (22), and calculates a change of the moving distance of each car after the call assignment based on the destination floor, and at the same time calculates each floor arrival prediction time of each car using a speed or an acceleration thereof according to a calculated value of the change of the moving distance.
US08196709B2

The invention relates to a lubricant distributor with a distributor plate (1, 21) and one or more injectors (2, 22) that can be connected to this plate and that are each formed from a housing (8, 28) defining a longitudinal axis with an inlet (11, 31) and an outlet (14, 34) that connect to corresponding connections in the distributor plate, and also from a dosing and reversing unit that is formed in the housing, wherein the inlets and outlets are arranged on the side of the housing facing the distributor plate (FIG. 1).
US08196697B2

The present invention provides a new hand-operated system for actuating acceleration and brake pedals in a vehicle. The system comprises main body adapted to be fixedly attached to the vehicle in the vicinity of the driver's hands, a handle connected to the main body wherein the handle is adapted to be moved forwardly and backwardly in order to operate the vehicle; two levers pivotally connected to the main body wherein the levers are engaged with the acceleration and brake pedals through connecting rods; and a cable connecting the lever that actuate the acceleration pedal.
US08196696B2

A vehicle frame structure includes a central frame member, extending in a vehicle longitudinal direction at a central portion of a body frame. The central frame member includes a front end joined to a second front cross pipe, and a rear end joined to a second lower crossmember behind the second front cross pipe. When viewed from the side, the central frame member extends in a substantially straight line along with the left and right front reinforcing pipes. The front end portion of the central frame member is joined to the second front cross pipe at a position inwardly of a joint between the left front reinforcing pipe and the second front cross pipe, and inwardly of a joint between the right front reinforcing pipe and the second front cross pipe. Such frame structure lowers level of a center of gravity of the vehicle, and enhances rigidity.
US08196678B2

A method of downlinking to a downhole tool located in a borehole is provided. The downhole tool detects transitions in the flow velocity of fluid circulating in the borehole at the downhole tool. To provide for the detection of the transitions fluid is pumped into the drillstring so that it circulates in the borehole at the downhole tool and the the pumping rate of fluid into the drillstring is either increased to a rate which overshoots a steady state pumping rate needed to produce a transition or is decreased to a rate which undershoots a steady state pumping rate needed to produce a transition.
US08196673B2

Apparatus for determining when a fastener has been tightened by an impact wrench comprises determining when the number of hammer impacts to advance an anvil of the impact wrench through a predetermined angle reaches a predetermined number. The cumulative angular displacement of the anvil from the first detected hammer impact is determined from the corresponding cumulative angular displacement of the hammer at the corresponding hammer impact from the first detected hammer impact. The cumulative angular displacement of the hammer is determined just prior to the direction of rotation of the hammer reversing at the corresponding hammer impact, and is determined by computing the difference between the cumulative angular displacements of the hammer at the corresponding and previous hammer impacts and subtracting an angle through which the hammer freely rotates between the two hammer impacts from the computed difference. The result is added to the cumulative angular displacement of the anvil computed for the previous hammer impact.
US08196672B2

A conservation tillage implement having three or more rows of individual coulter wheel assemblies laterally spaced apart and removably mounted on a cultivator frame, a coulter wheel assembly in a given row being staggered with respect to the coulter wheel assemblies in a longitudinally adjacent row. The coulter wheel assemblies may be laterally adjustable and may be mounted to the cultivator frame using a mounting means that permits rotation about a vertical axis. The coulter wheel assemblies may have a coil spring with a horizontal spring axis to permit upward deflection in response to impact with an obstacle. Leveling attachments may optionally be mounted to the cultivator frame, along with additional field working tools. The implement is used in the management of crop residue as part of a minimum tillage strategy. The implement is particularly resistant to plugging and can be operated at high speeds without undue damage upon impact with obstacles. Advantageously, the implement can be operated in standing water, as found in the growing of rice.
US08196666B2

Flexible riser, comprising a length of a flexible pipe with an upper end, a bend restrictor and a termination for hanging up on a vessel, a floating installation or a platform, distinguished in that the bend restrictor in the upper end is connected to an adapter pipe extending from a lower end at the bend restrictor to an upper end, to an end coupling to which the upper ends of both the flexible pipe and the adapter pipe are fastened, the flexible riser extending through the bend restrictor and the adapter pipe and the end connection comprising a means for hanging up at deck level of the vessel, the installation or the platform. Method for pulling-in and hanging up of the flexible riser.
US08196663B2

In some embodiments, apparatus useful for providing fluids or equipment into a subterranean well through a production tubing and associated dead string includes an injection system that is movable into and out of the well without removing the production tubing. The injection system includes a stopper that forms the seal that creates the dead string.
US08196660B2

A method and apparatus for the management of injection and production of well fluids in a subterranean well is described to optimize the use of stimulation fluids to enhance their compatibility with subterranean reservoirs and the surface environment and thereby reducing the damage said fluids induce in subterranean reservoirs and upon flow back to the surface reduce their damage to the environment is described. More specifically, this method is directed to the subterranean treatment of injection fluids.
US08196659B2

An aqueous, viscoelastic fluid gelled with a viscosifier, e.g. a viscoelastic surfactant, is stabilized and improved with an effective amount of a particulate additive such as alkaline earth metal oxides, alkaline earth metal hydroxides, transition metal oxides, transition metal hydroxides, post-transition metal oxides, and post-transition metal hydroxides. These fluids are more stable and have a reduced or no tendency to precipitate, particularly at elevated temperatures, and may also help control fluid loss. These particulate additives have unique particle charges that use chemisorption, “crosslinking” and/or other chemistries to associate and stabilize the VES fluids, and also help trap or fixate formation fines when placed in a gravel pack or a proppant pack in a fracture. Some of these effects may be more pronounced the smaller the size of the particulate additive.
US08196658B2

A method for treating a hydrocarbon containing formation includes providing heat input to a first section of the formation from one or more heat sources located in the first section. Fluids are produced from the first section through a production well located at or near the center of the first section. The heat sources are configured such that the average heat input per volume of formation in the first section increases with distance from the production well.
US08196657B2

In one embodiment, a pump assembly for pumping a wellbore fluid in a wellbore includes a pump, a fluid separator, a motor for driving the pump, and a shroud disposed around the fluid separator for guiding a gas stream leaving the fluid separator, wherein the gas stream is prevented from mixing with fluids in the wellbore.
US08196652B2

A radial expansion system.
US08196648B2

An air expandable bladder grips a beverage container within the vehicle and serves as a beverage holder. The container holder utilizes a hot air duct that receives its hot air from the heater core and its cold air from the evaporator, both of which may be located within the HVAC case. An air inlet duct receives the hot, cold, or blended air from an air mixing valve and directs the air into, and expands, the bladder. An exit orifice may exist in the bladder to release air from the bladder and provide back pressure in the bladder. A user-controlled switch permits a person to select whether hot, cold, or blended air will pass into the bladder inlet duct. The drink holder may be located within a center console, dash, door or other location within the vehicle interior.
US08196630B2

A system for controlling the strength of seals imparted to workpiece layers by a sealing roll and an anvil roll, the sealing roll and the anvil roll arranged on opposing sides of a conveyed web of workpiece layers, heating elements provided on at least one of the rolls, temperature sensors provided on the at least one of the rolls, and a controller in communication with the sensors and in operable communication with the heating elements. The sealing roll includes a textured sealing surface, the textured sealing surface being divided into a plurality of regions, the texture of a first of the regions being different from a texture of a second of the regions. By controlling the temperature of the respective regions, detrimental effects of anvil wear on the strength of the seal imparted to the workpiece layers may be offset, increasing the service life of rolls.
US08196629B2

A run-flat support system and method for installing the same are disclosed. In one embodiment, the run-flat support system includes a torque assembly removably coupled to a split wheel rim of a pneumatic tired wheel. Support segments are adapted for attachment to the torque assembly in order to support the pneumatic tired wheel in a flat condition such as an under-inflated condition or deflated condition. Lateral support structures, which may include the form of a wedge, are secured to the support segments to provide a bead lock between beads of the interior side walls of the pneumatic tired wheel and the split wheel rim.
US08196619B2

A load lock apparatus including a carry port provided on a side of a carry-in/out section for carrying a substrate in/out from/to the outside, and a carry port provided on a side of a processing section for processing the substrate, includes: a temperature controlling plate for controlling a temperature of the substrate, the temperature controlling plate configured including a plate body made of a porous material and a temperature controlling gas supply path for supplying a temperature controlling gas controlled in temperature to the plate body. The temperature controlling gas passes through the plate body, blows out from a surface of the plate body, and is supplied to the substrate.
US08196618B2

A dispenser and a refrigerator including the same are disclosed. The dispenser includes a first section of ice discharge duct that receives ice supplied from an ice supplier, a second section of ice discharge duct that receives the ice guided by the first section, and a third section of ice discharge duct that receives the ice guided by the second section. The third section guides the ice through an outlet positioned in front of a surface of a door of the refrigerator. The dispenser also includes a first coupling mechanism located at the second section and a second coupling mechanism located at the third section. The first and second coupling mechanisms are configured to engage and disengage with each other to enable removal of the third section from the second section and attachment of the third section to the second section.
US08196611B2

A pipe comprising an outer rigid conduit and an inner tubular structure, the inner tubular structure comprising a flexible hose, wherein the hose comprises a tubular body disposed between inner and outer gripping members, the tubular body including a sealing layer, and being formed of a material capable of withstanding cryogenic temperatures, wherein the inner tubular structure has insulation properties sufficient to protect the outer conduit from the low temperature of cryogenic fluid flowing within the inner tubular structure.
US08196595B2

Systems and processes may provide improved performance for a pneumatic positioner during a safety override. In certain implementations, a system and process may include may include the ability to receive an input control signal, power control circuitry of the pneumatic positioner using the input control signal, and generate a control signal for a signal-to-pressure converter with the control circuitry based at least partially on the input control signal. The system and process may also include the ability to detect an unsafe operating condition for the pneumatic positioner based on an input signal and modify the control signal in response to detecting the unsafe operating condition, to cause the converter to transition to a safe state. The system and process may additionally include the ability to allow the control circuitry to continue being powered by the input control signal while the converter is in the safe state.
US08196581B2

A mouthpiece supply valve which may be used in connection with a rebreather. An exemplary mouthpiece supply valve may include a housing, an inlet mushroom valve, an outlet mushroom valve, a supply gas regulator, an exhaust valve, and a mode selector. An exemplary mouthpiece supply valve may perform manual diluent valve, automatic diluent valve, overpressure relief valve, excess fluid ejection, and bail-out valve functions.
US08196575B2

A method and an apparatus for monitoring and controlling flows in medical equipment including an anesthetic machine and a ventilator for influencing a patient's respiratory system are disclosed. The apparatus includes a microprocessor and an airway system including drive gas conduits provided with an inhalation valve (2) and an exhalation valve (5) for gas discharging as well as a ventilator end flow sensor (3) for measuring the introduced or discharged drive gas flow through the valves. The airway system also includes patient end breathing tubing in which a patient end flow sensor (11) for measuring the patient's inspired and expired gas flow is provided. By comparing the measured values of the two flow sensors against the characteristic curve of the inhalation valve (2), the microprocessor can judge the operation states and accuracy of the respective flow sensors and the inhalation valve (2).
US08196570B2

According to one embodiment, a bow includes a handle portion and a bowstring. Compression members including primary compression elements and secondary compression elements are positioned on the ends of the handle portion. The compression elements are arcuate in shape and joined at the ends. As the bowstring is drawn, the compression members are compressed and energy is stored therein. The bow can include limbs that do not significantly deform or store energy as the bow is drawn. Upon release of the bowstring, the stored energy is rapidly returned to the bowstring.
US08196567B2

Fuel is evacuated from a fuel rail by directing liquid fuel from the fuel rail to a fuel tank and then by directing gaseous fuel from the fuel rail to a fuel vapor canister.
US08196566B2

A voltage generator used to generate a voltage for driving a vehicle fuel injector includes a microcomputer, a coil, and a capacitor. The microcomputer calculates an interval at which the fuel injector is driven. When the interval is less than or equal to a predetermined time period, the microcomputer causes a first current to flow through the coil so that the capacitor is charged to a first level by counterelectromotive force produced in the coil. When the interval is greater than the time period, the microcomputer causes a second current less than the first current to flow through the coil so that the capacitor is charged to a second level less than the first level. The fuel injector is driven by the capacitor voltage.
US08196561B2

A bottom face of a cylinder head (3) defining a combustion chamber (1) is formed substantially in a shape of a spherical shell, and ignition points (21) are arranged in three or more on a concentric circle of 55 to 70% of a diameter of a cylinder block (30) or the vicinity thereof, and combustion is performed with an air excess ratio of the combustion chamber (1) of 1.5 or more.
US08196555B2

An engine room for construction equipment is provided, which can minimize emission of noise generated in an engine room due to driving of an engine and a ventilating fan to an outside of the engine room by absorbing the noise through a noise trap, and can improve the cooling performance of corresponding components by smoothing inhalation/discharge of an external air to/from the airtight engine room. The engine room for construction equipment includes a radiator cooling water for cooling the engine, a muffler discharging an exhaust gas from an engine to the atmosphere, a first noise trap installed in an inlet port to absorb noise generated in the engine room and emitted to an outside, a second noise trap installed in an outlet port to absorb the noise generated in the engine room and emitted to the outside, a radiator fan inhaling the external air through the first noise trap and making the inhaled external air pass through the radiator and the circumference of the engine, a discharge fan discharging the air in the engine room to the outside through the second noise trap, and an outer wall forming an airtight space for accommodating therein the engine, the muffler, the radiator fan, the hydraulic pump, and the discharge fan that generate the noise.
US08196540B2

A harmonic apparatus designed to affect the performance of waterborne vessels. The vibratory generator is tuned with respect to the fundamental frequency of the vessel at the onset of planning, the various wave patterns generated by the moving vessel and the kinematics of the vortex sheet. As the vessel moves through water, vibrational reactions occur that assist the performance of the vessel. The harmonic apparatus can be reconfigured to operate on several different modalities.
US08196534B2

A volumetric meter for seed or fertilizer having a plurality of roller segments driven by a common drive shaft is provided with clutch mechanisms radially between each roller segment and the drive shaft to enable the roller segments to be individually shut-off to provide section or swath control to the machine.
US08196533B2

A method for operating a fluidized-bed reactor includes introducing an alkali-containing material into a fluidized-bed reactor and introducing hydrous clay into the fluidized-bed reactor, the hydrous clay having a moisture content of at least about 5% by weight. The method further includes heating at least a portion of the alkali-containing material and hydrous clay, such that at least a portion of the hydrous clay is at least partially calcined and the at least partially calcined clay adsorbs at least a portion of alkali present in the fluidized-bed reactor. The method further includes removing at least a portion of the at least partially calcined clay and adsorbed alkali from the fluidized-bed reactor.
US08196528B2

Fitted tablecloth covering may be affixed to a table for use in trade shows without the use of a tool or affixing devices. A tablecloth may conveniently and quickly be affixed to a table and provide an appealing visual presentation that does not require the use of installation tools and that will not damage the table.
US08196522B2

A running gear frame for a running gear of a rail vehicle with a frame body, which is configured to be supported at least on one wheel unit of the running gear. The frame body has two longitudinal beams extending in a longitudinal direction of the running gear and at least one transverse beam extending in a transverse direction of the running gear. The transverse beam substantially rigidly connects the two longitudinal beams to each other. The frame body is at least partially made of grey cast iron material.
US08196515B2

A power source for actuating a subsurface tool is described herein, the power source comprising thermite in a quantity sufficient to generate a thermite reaction, and a polymer disposed in association with the thermite. The polymer produces a gas when the thermite reaction occurs, the gas slowing the thermite reaction. The slowed thermite reaction enables a continuous pressure to be provided to the subsurface tool over a period of time, providing superior actuation over a conventional explosive power charge, through a non-explosive reaction.
US08196514B2

The invention relates to a warhead comprising a first and a second part, the parts being arranged relative to one another along a longitudinal axis, the first part comprising a first explosive section, a casing, and a plurality of projectiles enclosed in the casing. The second part comprises an element designed to control the working of the warhead as a function of a control signal. The fact that the functioning of the warhead can be controlled means that the warhead can defeat a plurality of different targets, which makes the warhead versatile.
US08196509B2

An apparatus for shelling boiled eggs is described. The apparatus includes a plurality of spaced-apart shelling rollers which are axially parallel to one another, are arranged in a circulating belt guided over end deflecting rollers in a conveying direction, and are driven in the same rotational direction. A plurality of longitudinal guides are arranged above a top strand of the circulating belt. Pairs of the longitudinal guides form a roof-like channel extending in the conveying direction and are moveable transversely to the conveying direction. A region of the top strand a first operating region breaking open eggshells, and a second operating region for shelling the boiled eggs.
US08196507B2

A pneumatic actuator is provided for an active bonnet. The pneumatic actuator includes, but is not limited to a cylinder and a piston transferable from a rest position to an extended position and lockable in its rest position. The piston, in its rest position, is held pre-stressed by a spring element in the direction of the extended state.
Patent Agency Ranking