US11098005B2

The present invention provides methods of synthesizing (6S,15S)-3,8,13,18-tetraazaicosane-6,15-diol and salts thereof.
US11098004B2

Provided is a method of refining 1,5-diaminopentane, the method including preparing a fermented broth including a carbonate salt of 1,5-diaminopentane; preparing a first composition by heating the fermented broth; preparing a second composition and an evaporation residue by evaporating the first composition; preparing a third composition by adding water to the evaporation residue and evaporating the water; and recovering 1,5-diaminopentane by distilling the second composition and the third composition.
US11098002B2

This invention provides compounds of Formulae (IA), (IB), (IC), (ID), (IE), (IF), (IG), (IH), (IJ), (IK), (IL), (II), (III), (IIIA), and (IIIB); pharmaceutically acceptable salts and solvates thereof; and compositions thereof. This invention further provides methods for treating a disease, including but not limited to, liver disease or an abnormal liver condition; cancer (such as hepatocellular carcinoma or cholangiocarcinoma); a malignant or benign tumor of the lung, liver, gall bladder, bile duct or digestive tract; an intra- or extra-hepatic bile duct disease; a disorder of lipoprotein; a lipid-and-metabolic disorder; cirrhosis; fibrosis; a disorder of glucose metabolism; a cardiovascular or related vascular disorder; a disease resulting from steatosis, fibrosis, or cirrhosis; a disease associated with increased inflammation (such as hepatic inflammation or pulmonary inflammation); hepatocyte ballooning; a peroxisome proliferator activated receptor-associated disorder; an ATP citrate lyase disorder; an acetyl-coenzyme A carboxylase disorder; obesity; pancreatitis; or renal disease.
US11098001B2

Treprostinil is a synthetic prostacyclin derivative with thrombocyte aggregation inhibitory and vasodilatory activity. Treprostinil can be administered in subcutaneous, intravenous, inhalable, or oral forms. Disclosed is a method for the preparation of treprostinil of formula I and its amorphous form, anhydrate form, monohydrate form, and polyhydrate form salts with bases. In the disclosed method, the chiral center in the 3-hydroxyoctyl substituent is formed at the end of the synthesis, so that the method is robust and well scalable. Also disclosed are treprostinil intermediates and the preparation of the intermediates.
US11098000B2

A process for recovering methacrolein and methanol from methacrolein dimethyl acetal. The method comprises a step of contacting a mixture comprising methyl methacrylate and methacrolein dimethyl acetal with a strong acid ion exchange resin in the presence of water. The mixture comprises no more than 0.2 wt % sodium methacrylate.
US11097997B2

By subjecting a starting material composition containing hexafluorobutadiene and at least one additional compound selected from the group consisting of octafluoro-1-butene, octafluoro-2-butene, heptafluoro-1-butene, and heptafluoro-2-butene to extractive distillation in the presence of an extraction solvent to reduce the concentration of the additional compound, hexafluorobutadiene with higher purity can be obtained.
US11097993B2

The present invention relates to improving the efficacy of man-made and/or natural organic-based animal manure fertilizers by administration of an organic solvent formula containing polyorganic acids and/or their salts. The formulation liberates nutrient(s) that are normally bound in the soil as insoluble salts and complexes. These delivery formulations also provide an environmentally sound and inherently safe solvating system that improves diffusion of polyorganic acids to the granule fertilizer. These delivery formulations enable safe storage, transport and subsequent application or blending with solid or liquid fertilizers. The combined formulation and fertilizer can be applied to soil to provide improved efficacy of fertilizer by liberating nutrients bound in the soil for uptake by plant life.
US11097990B2

A method for preparing organic multi-micro-fertilizer with water retention function is provided, including: effectively remixing substance containing organic multiple trace elements, attapulgite powder, sodium p-toluenesulfonate, vermiculite and perlite under certain conditions. The present invention has obvious effects on enhancing soil water-holding performance, preventing physiological diseases of crops caused by lack of trace elements, and promoting growth and development of the crops.
US11097986B2

A process of forming a Si-containing ceramic comprises forming a Si-based polymeric composition. The process includes neutralizing a charge of said Si-based polymeric composition. The process includes adding thermal energy under a controlled atmosphere to the Si-based polymeric composition. A turbine engine component comprises an airfoil and the airfoil comprises a Ceramic Matrix Composite (CMC) material.
US11097981B2

Disclosed are asphalt binder compositions and methods for making such compositions with pure sterol:crude sterol blends. The sterol blends improve various rheological properties.
US11097977B2

A method including digital printing a heat curable aqueous composition onto a substrate, wherein the composition includes: (a) at least one water soluble synthetic alkali metal silicate; and (b)(i) at least one pigment or (b)(ii) at least one additive selected from aluminum oxide, ceramic microspheres, recycled ground glass, or calcium carbonate; wherein the composition is substantially free of any organic solvent; and heating the composition bearing substrate thereby curing the composition, and wherein the substrate includes a material selected from glass, ceramic, textile, polymeric, metal, wood, or a combination thereof.
US11097974B2

A strengthened cover glass or glass-ceramic sheet or article as well as processes and systems for making the strengthened glass or glass-ceramic sheet or article is provided for use in consumer electronic devices. The process comprises cooling the cover glass sheet by non-contact thermal conduction for sufficiently long to fix a surface compression and central tension of the sheet. The process results in thermally strengthened cover glass sheets for use in or on consumer electronic products.
US11097972B2

An arrangement structure for bubbling apparatuses of a furnace, comprising bubbling apparatuses disposed in a melting pool (11) of a furnace. Each bubbling apparatus comprises a bubbling tank (8) and a bubbling tube (9). The bubbling tank (8) is provided at the bottom of the melting pool (11) and disposed in recessed fashion. The bubbling tube (9) is mounted in the bubbling tank (8). The structure can efficiently enhance the physical effect of a bubbling gas on molten glass and improve the quality and production efficiency of the molten glass.
US11097963B2

The present disclosure relates to a method for treating a solvent in wastewater generated in a polycarbonate production process. More specifically, the present disclosure relates to a method for treating a solvent in wastewater generated in a polycarbonate production process, which can easily recover a high purity solvent regardless of the concentration of the solvent by using a membrane distillation method to reuse it, and contribute to energy savings.
US11097962B2

A desalination system that is deployable in a body of water having a surface and a seafloor and which includes a vessel structure that is capable of travel in water, a reverse osmosis system disposed within an internal space of the vessel structure and a tank connected to the reverse osmosis system, the tank configured to receive filtered water from the reverse osmosis system. A positioning system is provided for controlling the travel of the vessel structure, and a ballast system is configured to control the buoyancy of the vessel structure. A controller is operably associated with the positioning system and the ballast system to control the position of the vessel below the surface of the body of water.
US11097953B2

Synthesis of silanes with more than three silicon atoms are disclosed (i.e., (SinH(2n+2) with n=4-100). More particularly, the disclosed synthesis methods tune and optimize the isomer ratio by selection of process parameters such as temperature, residence time, and the relative amount of starting compounds, as well as selection of proper catalyst. The disclosed synthesis methods allow facile preparation of silanes containing more than three silicon atoms and particularly, the silanes containing preferably one major isomer. The pure isomers and isomer enriched mixtures are prepared by catalytic transformation of silane (SiH4), disilane (Si2H6), trisilane (Si3H8), and mixtures thereof.
US11097942B2

Integrated circuit substrates having through silicon vias (TSVs) are described. The TSVs are vias extending through the silicon substrate in which the integrated circuitry is formed. The TSVs may be formed prior to formation of the integrated circuitry on the integrated circuit substrate, allowing the use of via materials which can be fabricated at relatively small sizes. The integrated circuit substrates may be bonded with a substrate having a microelectromechanical systems (MEMS) device. In some such situations, the circuitry of the integrated circuit substrate may face away from the MEMS substrate since the TSVs may provide electrical connection from the circuitry side of the integrated circuit substrate to the MEMS device.
US11097938B2

A system and method for dispensing fluids is introduced. A preferred embodiment comprises a sealed tank, a bag containing fluid inside the sealed tank, an outlet for dispensing the liquid in the bag, and a pressure generating device to create pressure in the sealed tank.
US11097936B2

Apparatus for preparing and dispensing a diluted beverage has a mains water inlet, a valve for opening or shutting water flow, a food concentrate container, an outlet for the beverage, a user interface for commanding dispensing of the beverage, and a volumetric pump communicating with the valve outlet and the beverage outlet for drawing and mixing the food concentrate and water. A first conduit is connected to an outlet of the food concentrate container and the volumetric pump inlet. A second conduit communicating with the valve outlet and an intermediate portion of the first conduit. A control unit activates the valve and the volumetric pump. The second conduit has a section narrowing for regulating the outflow velocity of the water entering the first conduit. The control unit activates the volumetric pump to regulate the flow of food concentrate mixture and water in response to data from a water flow detector.
US11097934B2

A bottle assembly includes: a pressurized bottle of fluid having an elongated body and a neck extending contiguously from the body to a top portion including an outwardly projecting annular flange; and a bottle severing mechanism including a bottle striker carried by the bottle and residing below the top portion. The bottle striker includes: a frame mounted to move relative to the bottle in response to an impact by a saber while remaining coupled to the bottle; and a striking edge extending from the frame and aligned with a lower surface of the annular flange of the bottle, such that movement of the frame relative to the bottle causes the striking edge to strike the lower surface of the annular flange to sever the top portion of the bottle from the body.
US11097928B2

A winch assembly (50) including: a winch shaft (12) rotatably mounted within a bracket (18) and adapted for rotation about a first axis (68); a substantially right-angled drive transferring mechanism having a drive input coupled to a manual tool engagement device and drive output coupled to the winch shaft (12), the tool engagement device adapted for rotation about a second axis (72) extending substantially radially from the first axis (68), wherein manual rotation of the tool engagement device causes rotation of the winch shaft (12); and an anti-twist bar (64) attached to the bracket (18) to reduce twist during rotation of the winch shaft (12).
US11097927B1

A lifting machine with a counterweight includes a sensing system for assisting in ensuring proper operating conditions are reliably achieved. The machine includes a lifter for moving the counterweight from a lowered position to a raised position. A first sensor is associated with the lifter for sensing a parameter corresponding to an amount of the counterweight (such as a pressure value associated with the rod end of a lifting cylinder), and a second sensor is provided for sensing a condition of the lifter (such as the position or extended length of the lifting cylinder). The amount of counterweight present may be determined by the output of the first sensor when the lifter is in a pre-determined (e.g., midpoint) position. The operator may be polled to verify the amount of counterweight present, thus providing a check against unintended operating conditions and ensure that reliable operation of the lifting machine is achieved.
US11097921B2

One embodiment provides a method for optimizing schedules of a plurality of elevators in a building having a plurality of floors, including: receiving, from a user, an indication requesting that an elevator from the plurality of elevators stop at a particular floor, wherein each of the plurality of elevators has a schedule comprising floors where the elevator will stop; identifying the number of users in the elevator waiting area of each of the particular floors where an indication requesting a stop has been received; and updating, in view of the identified number of users at each of the particular floors, the schedule for the plurality of elevators to optimize the stops for the plurality of elevators, wherein the updating comprises dynamically routing the plurality of elevators upon (i) receipt of indications and (ii) identification of the number of users at each of the particular floors.
US11097919B2

A recording material processing apparatus includes first teeth that are used for binding processing of a recording material bundle; second teeth that move along a linear route toward the first teeth and presses the recording material bundle located between the first teeth and the second teeth; and a guide portion that is disposed along the linear route and guides the second teeth moving toward the first teeth.
US11097918B2

Provided are a finisher, a non-transitory computer-readable recording medium and a method for controlling transportation of media sheets. The finisher includes a sheet transporter, a sheet cutter for dividing each printed media sheet into multiple cut media sheets by cutting, a sheet inserter that inserts insertion sheets into the sheet path, a sheet stacker for stacking the cut media sheets and the insertion sheets transported by the sheet transporter, a sheet buffer disposed on a branch line branching off from the sheet path, and a controller. The controller sets a sheet insertion mode to a pre-sheet insertion mode or a post-sheet insertion mode, and causes the sheet transporter to transport a part of cut media sheets or an insertion sheet into the sheet buffer and change the order of the sheets in the sheet path so that the insertion sheet is positioned between the cut media sheets.
US11097915B2

An image forming apparatus includes a first detection unit, a second detection unit, a first conveyance unit, a second conveyance unit, which is provided on downstream in the conveyance direction with respect to the first detection unit and is configured to convey sheets, and a control unit. When the first detection unit does not detect a trailing edge of a first sheet before a first timing, the control unit stops the drive of the first conveyance unit and continues drive of the second conveyance unit, and when the second detection unit detects the trailing edge of the first sheet before a second timing later than the first timing, the control unit re-drives the first conveyance unit or stops the drive of the second conveyance unit in accordance with a sheet length of the first sheet in the conveyance direction.
US11097902B2

A material processing unit includes a main frame and a pivot assembly pivotally mounted to the frame. The pivot assembly is movable between a first pivot position, where a portion of the pivot assembly extends below the main frame, to a second pivot position, where the pivot assembly is generally above the main frame. The pivot assembly includes a mount platform that is below the main frame when the pivot assembly is in the first pivot position. The pivot assembly includes a slewing bearing mounted on the mount platform. The pivot assembly also includes a carrier mechanism that is rotatably mounted to the slewing bearing. The carrier mechanism is configured to be rotated generally parallel to the mount platform via the slewing bearing. The material processing unit includes a discharge conveyor that is pivotally mounted to the carrier mechanism.
US11097901B2

An apparatus for guiding products along a conveyor in a conveying direction. The apparatus includes a first guiderail for at least partially forming a conveying path for articles on the conveyor. A guiderail adjuster includes a flexible or collapsible support, which make take the form of a linkage, and which provides support for the first guiderail along the conveyor. The flexible or collapsible support is adapted for being extended and retracted along a support rail extending in the conveying direction to selectively position the first guiderail relative to the conveyor, and thereby alter (increase or decrease) the width of the conveying path. Related methods are also disclosed.
US11097891B1

A roll-off tub style container is disclosed with the container having a floor with a forward end, a rearward end, a first side, a second side, an upper side and a lower side. The container has a front wall, a first side wall, a second side wall and a tail gate. The upper side of the floor has a plurality of elongated and horizontally spaced-apart rail members which are welded to the upper side of the floor. The rail members extend between the forward and rearward ends of the floor. In the preferred embodiment, the rail members are angle members which have an inverted V-shaped configuration. Rail members having different cross-sectional configurations may possibly be utilized. The rail members prevent materials in the container from freezing to the floor of the container and also act as slide members when the material in the container is being dumped therefrom.
US11097872B2

A composite lid of a cylindrical container includes an outer metal lid having an integral top wall and sidewall and an inner plastic lid having a top wall and sidewall fitted inside the outer metal lid such that a free end of the sidewall of the inner plastic lid extends beyond a free end of the sidewall of the outer metal lid. The composite lid can be fitted on a base having an integral bottom wall and sidewall such that the sidewall of the inner plastic lid frictionally engages the sidewall of the base. The outer metal lid can be formed by stamping sheet metal, the inner plastic lid can be formed by molding a polymer material and the base can be formed by molding a polymer material. The outer metal lid can be adhesively bonded or mechanically fitted to the inner plastic lid.
US11097870B2

What is disclosed is a container for transporting and storing goods, having a floor and side walls extending from the floor. In accordance with the invention, at least one of the side walls or a part thereof is formed by a grid-like structure which is extensible and compressible or able to be pulled apart and squeezed together at least in one direction and within the side wall plane so as to demarcate or to close the container toward the side in a first position and to release the container toward the side in a second position.
US11097867B1

A blank for forming a closed box for shipping and for permitting separation of one portion of the closed box from another portion of the closed box to form a tray for displaying product is provided. The blank includes a bottom part, a back part and a top part. The blank may include three distinct tear lines. One of the tear lines is located on the back part, and two of the tear lines are located on the bottom part.
US11097858B2

Embodiments described herein include a satellite cover panel for covering a satellite, particularly a payload bay of a satellite comprising an energy storage module, at least one energy generating module defining, at least partially, a first outer surface of the satellite cover panel, and a logic board defining, at least partially, a second outer surface of the satellite cover panel, wherein the first outer surface and the second outer surface face away from each other and from the energy storage module.
US11097854B2

An aircraft light comprises at least one light source; at least one sensor, an operating mode selector, and a transmitter. The sensor is configured for detecting current operational conditions and providing at least one corresponding sensor signal. The operating mode selector configured for determining a suitable light emission of the at least one light source based on the at least one sensor signal. The operating mode selector is further configured for determining the amount of electrical power needed for generating the determined light emission. The transmitter configured for transmitting a power request signal indicating the determined amount of electrical power to a power supply.
US11097847B2

An oxygen supply device for an aircraft has a reaction tank for chemical oxygen generation and a pressurized tank filled with oxygen. The oxygen supply device also has an energy converter for converting thermal energy into electrical energy and also a control unit for setting a first amount of oxygen, provided by the reaction tank to a consumer unit, and a second amount of oxygen, provided by the pressurized tank to the consumer unit. The energy converter is designed to convert a thermal energy, generated by the chemical oxygen generation in the reaction tank, into electrical energy and to provide the electrical energy. The control unit is designed to set the second amount of oxygen, provided by the pressurized tank to the consumer unit, by using the electrical energy provided by the energy converter. The invention also relates to a method for supplying a passenger cabin of an aircraft with oxygen.
US11097837B2

A gimbal joint may employ a plurality of wear sleeves, each disposed between a pin or pin receptive bore of a first structure and a corresponding bore or pin of a second structure and between another pin or bore of the second structure and a corresponding bore or pin of a third structure. Each of these structures may be adapted to rotate in a single plane, with one structure adapted to also tilt about a first axis, and one other structure adapted to tilt about a second axis. Each integral flanged wear sleeve may comprise a right circular hollow cylindrical body portion, which may be interiorly sized to be retained on one of the pins and externally sized to be retained in one of the pin receptive bores, and a flange portion may radiate from one end of the cylindrical body portion.
US11097834B2

Aircraft fly-by-wire systems and related vehicle electrical systems are provided. In one embodiment, an electrical system suitable for use with a control surface of a vehicle, such as an aircraft, is provided. The electrical system includes an asynchronous intermodule bus arrangement, a first vehicle control module, and a second vehicle control module. Each vehicle control module includes a respective interface arrangement to obtain and exchange data from different sensing arrangements with a first frequency, and a respective processing system to obtain the sensed data and determine actuator commands based on the sensed data with a lower frequency.
US11097833B2

A crank device provided with an upstream lever and with a downstream lever. The crank device includes a phase shifter system connected to the upstream lever and to the downstream lever so that movement in rotation of the upstream lever about an axis of rotation induces movement in rotation of the downstream lever about the axis of rotation, the phase shifter system comprising a linear actuator mechanism carried by the upstream lever, the linear actuator mechanism having an outlet rod, the outlet rod having only one degree of freedom of movement in translation relative to the upstream lever, the outlet rod being connected via an outlet helical connection to the downstream lever so that movement in translation of the outlet rod generates movement in rotation of the downstream lever about the axis of rotation.
US11097828B2

A shroud for an aircraft configured to at least partially surround a noise source including a propeller. The shroud includes an outer layer and two or more sound absorbing materials located inside the shroud. The outer layer is configured to transmit noise from the noise source into the inside of the shroud and/or includes a recess located and sized to partially surround at least a part of a tip of at least one blade.
US11097827B2

Provided are insulating apparatuses, and methods of operation, for thermal insulation and drainage of cooling system tubing. An example insulating apparatus comprises an elongated strip including a first end and a second end. A medial portion, a first edge, and a second edge, each run from the first end to the second end. The first and second edges curl around respective longitudinal axes toward the medial portion to form a first wrap portion with a first cavity defined by an interior surface of the first wrap portion, and a second wrap portion with a second cavity defined by an interior surface of the second wrap portion. A channel above the medial portion is defined by an exterior surface of each of the first and second wrap portions. The first and second cavities are interconnected with the channel through a first gap and a second gap, respectively.
US11097824B1

An apparatus is for steering an outboard motor with respect to a marine vessel. The apparatus includes a transom bracket configured to support the outboard motor with respect to the marine vessel; a tiller for manually steering the outboard motor with respect to a steering axis; a steering arm extending above the transom bracket and coupling the tiller to the outboard motor such that rotation of the tiller causes rotation of the outboard motor with respect to the steering axis, wherein the steering arm is located above the transom bracket; and a copilot device configured to lock the outboard motor in each of a plurality of steering positions relative to the steering axis. The copilot device extends above and is manually operable from above the steering arm.
US11097814B2

The present invention provides a water surface cleaning machine, comprising a hull, a cleaning device provided at the bottom of the hull for collecting and storing water surface floating debris, a propulsion device provided at the front end and/or the back end of the hull for propelling the hull to travel on the water surface, a steering device provided at the corner portion between the front end and the side edge of the hull, wherein steering device causes the hull to rotate relative to an obstacle for adjusting traveling direction of the hull when the hull comes into contact with the obstacle during traveling on the water surface, and a power unit provided inside the hull for providing power to the propulsion device and the steering device.
US11097810B1

A tackle storage and organization system for a boat, such as a bass boat, is disclosed. A set of supports is installed in a deck compartment of the boat. The supports may be rails installed specifically for the tackle storage and organization system, or they may be the upper edges of existing partitions for subcompartments within the deck compartment. A box or tray is installed on the supports so as to be slideable horizontally along the supports, but is also removable from the supports. The box or tray may be subdivided into any number of compartments, and in some cases, the dividers used may be removable and repositionable in order to adapt to different types of items. The box or tray may have engaging structure to mount a number of accessories, including a spool accessory.
US11097804B2

A lever device for hydraulically actuating the brake or clutch of a vehicle equipped with a handlebar may have a pump assembly with a pump body connected to the handlebar of a vehicle. The pump body may have a cavity, a piston operatively associated with the pump body so as to be adapted to slide inside the cavity along a direction of thrust (X-X). The lever device may have a control lever assembly rotatably associated with the pump body so as to rotate about a pivot axis (Y-Y), the control lever assembly may have at least one control level. The piston defines a stroke free play between an end position and a first operating position. The lever device may have a stroke free play adjustment device which is adapted to adjust the distance along the direction of thrust (X-X) between the end position and the first operating position.
US11097801B2

The invention relates to a scooter, comprising a standing surface, at least one rear wheel articulated to the standing surface, and at least one front wheel articulated to the standing surface, which scooter can be moved in a direction of travel, wherein the scooter also comprises an element that is connected in an articulated manner to or can be attached to the standing surface, which element can be transferred from a first position as a seat element to a second position as a holding bar for a person standing on the standing surface, wherein, in the case of use, the scooter can be moved in the same movement direction in the case of a first position of the element and in the case of a second position of the element.
US11097800B1

A bag that can be releasably attached to and detached from a seatback having at least one supporting post is disclosed. It includes a bag body having a top and bottom, and a pair of straps disposed laterally with respect to each other on the bag body. Each of the straps is connected to the bag body at an upper connection point near the top, and a lower connection point near the bottom. A zipper is provided for selectively connecting and separating the straps from each other, by selectively zipping and unzipping the zipper. At least one bag connector is disposed on the bag near the bottom, and a strap connector is disposed on at least one of the straps at a point closer to the lower connection point than the upper connection point. The bag connector and strap connector are adapted to be releasably connected to each other. The bag is configured to be attached to the seatback by wrapping the straps around the seatback, zipping the straps together, and applying the strap connector to the bag connector around the at least one supporting post, to thereby trap the supporting post between the bag connector and the lower connection point.
US11097799B2

A wing member includes a first wing, a second wing, and a connection section connecting one-end sides of the first wing and the second wing. Both the wings are disposed with a spacing therebetween in the longitudinal vehicle direction, and the first wing is located on a vehicle body front upper side relative to the second wing. The connection section connects the one-end sides of both the wings that extend from a cowling toward a transverse-directionally outer side. A front edge of the first wing is inclined such that its transverse-directionally outer side portion is located on the vehicle body rear side relative to its transverse-directionally inner side portion, in plan view of the vehicle body. A rear edge of the first wing is inclined such that its transverse-directionally outer side portion is located on the vehicle body front side relative to its transverse-directionally inner side portion, in plan view.
US11097798B1

A platform fixture for displaying a wheeled good includes a frame, a rail, a wedge stop, and a mounting bracket. The rail extends across a top of the frame. The wedge stop is configured to selectively receive one or more wheels of the wheeled good and includes longitudinal flanges and two coupling flanges. Each of the two longitudinal flanges extends downwardly from a V-shaped top surface of the wedge stop. Each of the two coupling flanges extends inwardly from a different one of the longitudinal flanges. The mounting bracket is coupled to the rail and includes two T-shaped side segments defining a base portion and a cross bar that is wider than the base portion. Each of the two coupling flanges includes a cutout. The wedge stop is coupled to the mounting bracket by placing each base portion within the cutout of a different one of the two coupling flanges.
US11097787B2

A lower vehicle-body structure allows miniaturization of an undercover and prevents an increase in minimum ground clearance. In the lower vehicle-body structure, a vehicle body floor includes step-up portions connected to a floor tunnel on opposite sides of the floor tunnel in a vehicle width direction at least in regions where first and second cross members are disposed on the vehicle body floor. The lower vehicle-body structure includes a mount member that faces the floor tunnel and connects the step-up portions on the opposite sides of the floor tunnel, and includes first and second undercovers that cover a lower side of the mount member so as to be continuous with a bottom surface of the vehicle body floor on outer sides of the step-up portions in the vehicle width direction.
US11097770B2

An electric power steering apparatus including a torque sensor to detect a steering torque and a motor control unit to control a motor that applies an assist torque to a steering system of a vehicle, including: a function to switch a control system of the motor between a torque control system to control a motor output torque and a position/speed control system to control a steering angle of a steering in accordance with a predetermined switching trigger. The fade processing time from the torque control system to the position/speed control system and the fade processing time from the position/speed control system to the torque control system are individually set.
US11097769B2

A steering control device includes a control unit, and the control unit includes a target steering angle calculating unit configured to calculate a target steering angle based on a steering torque and is configured to calculate a target reaction torque based on execution of feedback control for causing the steering angle to match the target steering angle. The control unit includes a plurality of axial force calculating units configured to calculate a plurality of kinds of axial forces acting on a turning shaft based on different state quantities and a grip state quantity calculating unit configured to calculate a grip state quantity based on the plurality of kinds of axial forces. The target steering angle calculating unit is configured to calculate the target steering angle in consideration of the grip state quantity.
US11097750B2

A cable transportation system for transporting people or goods defines an advancing path extending between two end stations and having a designated length L, and has a hauling cable looped into a closed ring and having a forward branch and a return branch, which extend between the end stations; at least one vehicle configured to be alternately advanced between the two end stations, and selectively and alternately clamped to the forward branch and the return branch of the hauling cable at the end stations; and a drive member for advancing the hauling cable along the advancing path and selectively stopping the hauling cable when the vehicle clamped to the hauling cable is at one end station.
US11097747B2

A traveling position of a host vehicle is controlled using barrier lines as a reference. Autonomous driving is executed by either a both-side recognition control in which the position of the host vehicle is controlled based on left and right barrier lines, or a one-side recognition control in which the position of the host vehicle is controlled based on either one of the left or right the barrier lines. A region currently being traveled in is stored as a steering-wheel-turned region when a steering wheel is turned in one direction and subsequently turned in a returning direction due to the switching of control between the both-side recognition control and the one-side recognition control, and autonomous driving under the control preceding the steering-wheel-turned region is continued when the steering-wheel-turned region is subsequently traveled in.
US11097738B2

A control apparatus for a vehicle includes an input-rotation limiting portion configured, when the vehicle starts running and is accelerated, to calculate an estimated speed value that is a speed value of an input rotational speed of an automatic transmission upon elapse of a predetermined length of time, and to calculate an estimated force value that is a force value of a piston pressing force acting on a piston in a forward direction in a released engagement device upon the elapse of the predetermined length of time, based on a centrifugal hydraulic pressure in a pressure chamber of the released engagement device and the centrifugal hydraulic pressure in a canceller chamber of the released engagement device. When the estimated force value is not smaller than a predetermined threshold, the input-rotation limiting portion restrains an increase of the input rotational speed.
US11097735B1

An example operation includes one or more of traveling, by a first transport, in a first lane, determining, by the first transport, that a speed of a second transport is greater than a speed of the first transport when the second transport is behind the first transport, determining, by the first transport, that no other transports are ahead of the first transport by a first distance in the first lane and beside the first transport by a second distance in a second lane, maneuvering, by the first transport, to the second lane allowing the second transport to pass the first transport in the first lane, and maneuvering, by the first transport, to the first lane when there are no other transports traveling in the first lane at a third distance behind the first transport and at or near the speed of the second transport.
US11097732B2

Systems and methods for operating a driveline of a hybrid vehicle are described. In one example, vehicle launch is controlled according to a linear quadratic regulator that provides feedback control according to torque converter slip error and vehicle speed error. The vehicle launch is also controlled according to feed forward control that is based on requested torque converter slip and requested vehicle speed.
US11097725B2

A vehicle control device causes a vehicle to autonomously travel, and, if at least one of one or more predetermined conditions is met, then requests the driver to perform manual driving. The vehicle control device is provided with a condition determination unit and a deceleration selection unit. The condition determination unit determines whether or not said one or more predetermined conditions are met. The deceleration selection unit then selects whether or not to decelerate the vehicle when requesting the driver to perform said manual driving, on the basis of met predetermined conditions (if any).
US11097723B2

Method and apparatus are disclosed for user interfaces for vehicle remote park-assist. An example remote park-assist system includes a mobile app. The mobile app includes an interface for a touchscreen of a mobile device. The interface includes a pushbutton for receiving a continuous stationary input and an input pad for receiving a dynamic input sequence. The example remote park-assist system also includes a communication module for communication with the mobile device and an autonomy unit to perform motive functions while the interface simultaneously receives the continuous stationary input and the dynamic input sequence.
US11097720B2

A control device for a hybrid vehicle includes: an engine; an output shaft connected to a drive wheel; a first motor generator generating electric power using a drive force from the engine; a second motor generator connected to the output shaft; a planetary gear mechanism mechanically connected to the engine, the first motor generator, and the output shaft; a battery charging the electric power generated by the first motor generator; and controllers controlling the engine, the first motor generator, and the second motor generator. Further, when a requested drive force for the hybrid vehicle is greater than a maximum drive force without battery charging, which represents a drive force which can be output when an output of the second motor generator is maximized and the battery is not charged, the controllers cause the hybrid vehicle to travel while charging the battery.
US11097719B2

Systems and methods for operating a driveline of a hybrid vehicle are described. In one example, a torque that is produced by an engine is adjusted responsive to a transmission oil temperature and a speed of a torque converter impeller so that temperature of oil in a transmission lube circuit may be maintained at a desired temperature.
US11097717B2

An electric vehicle can include an electric drive capable of moving the vehicles, together with a non-battery operative feature to enhance the performance of the vehicle, such as extending the range or increasing the power. The non-electrical enhanced feature is independent and not integrated with the electric drive, to enable the return of the vehicle design to pure electrical power with minimum modification.
US11097714B2

An apparatus for selectively sharing, towards separate users, the power of a multi-drive unit vehicle, includes a mechanical transmission, that connects propulsion units of the vehicle to at least one primary drive unit; a secondary power unit for service units, which is operatively positioned between the mechanical transmission and at least one service unit of the vehicle; as well as at least one of either a first or a second joint, that are mounted on the mechanical transmission on either side of the secondary power unit for service units and are switchable by operating suitable control means.
US11097696B2

Provided is a washer nozzle that since a plurality of stepped portions (stepped wall portions) formed in a stepped shape in a flow direction of the cleaning liquid are provided in a flow path between an inflow hole and a discharge port in a main body portion, it is possible to spread the cleaning liquid in a width direction of the flow path by causing the cleaning liquid flowing from an upstream side to collide with stepped surfaces of the plurality of stepped portions one after another. Therefore, even when a flow rate of the cleaning liquid is small, without increasing a discharge capacity of a washer pump, it is possible to disperse the cleaning liquid fully in the width direction of the flow path, and it is possible to uniformly discharge the cleaning liquid to substantially the entire surface of an imaging lens.
US11097692B2

An adapter (112) for connecting a wiper blade to a drive arm, the adapter comprising two substantially parallel walls (28) connected together by at least one connecting element (30), said walls comprising first inner side faces (28a) between which said at least one connecting element extends, and outer side faces (28b) comprising protruding sliding guide patterns (132), characterised in that said patterns are divided into lines and columns.
US11097684B2

The invention relates to a housing of a gas generator module for an airbag system of a motor vehicle, wherein the housing is of substantially tubular design and has a tube portion in which a plurality of stamped formations pointing into the interior of the housing are introduced over an external circumference of the housing, wherein the stamped formations in the interior of the tube portion have a stop for an internal component.
US11097683B2

An airbag includes a mounting portion, a top wall deployable towards a vehicle occupant, and a circumferential wall disposed between the mounting portion and top wall. An airbag base member for forming the airbag includes a top-forming panel for forming the top wall, and at least three circumferential panels that extend generally radially from the top-forming panel and form the circumferential wall by being joined together by adjoining edges thereof. Each of the circumferential panels is formed into a generally band-like contour which has a first and a second curving edges that make the circumferential panel enlarge in width from the leading end towards an intermediate portion and then narrow towards the top-forming panel. When the airbag base member is laid flat, adjoining edges of any two adjoining circumferential panels are generally symmetrical to each other in curving shape with respect to a line disposed there between.
US11097682B2

An airbag chute assembly for an automotive vehicle includes a rigid chute frame, a door, and at least one hinge interconnecting the door to the rigid chute frame, wherein, the rigid chute frame and the door are unitarily injection molded from a single material.
US11097678B2

A vehicle crush can adapted to couple a bumper beam to a side rail, including: a hollow box structure including front and rear portions, the front portion including or adapted to be coupled to a bracket assembly adapted to be coupled to the bumper beam, the rear portion adapted to be disposed within the side rail and defining a plurality of lateral holes; and one or more internal sleeves disposed within the box structure and defining a plurality of lateral channels aligned with the plurality of lateral holes of the box structure; the plurality of lateral holes of the box structure and the plurality of lateral channels of the one or more internal sleeves adapted to be aligned with a plurality of holes defined by the side rail when the rear portion of the box structure is disposed within the side rail and collectively receive a plurality of bolts therethrough.
US11097677B1

A bumper assembly includes an elongate shell formed of a wooden material and an elongate base. The elongate shell has an inner surface, an outer surface, a first shell edge, and a first flange protruding from the first shell edge in a direction toward the inner surface of the elongate shell. The elongate base includes a base body including a first base edge and a first latching element extending from the first base edge of the base body, the first latching element having a first inclined outer surface and a first shoulder. The elongate base is configured for insertion into the elongate shell with the first flange engaging the first shoulder of the first latching element.
US11097674B2

An in-vehicle communication network comprising at least one node connected to a bus, the network comprising: at least one memory comprising software having data characterizing messages that propagate over the network during normal operation and executable instructions for processing a message based on the data to determine if the message is normal or anomalous; a module operable to: process messages received from the in-vehicle network in accordance with the executable instructions and the data to identify an anomaly in communications over the in-vehicle communication network; accumulate and store information responsive to the processing of the received messages; instruct a communication interface, configured to support communication with an entity external to the vehicle, to upload the stored information or a portion thereof to the entity external to the in-vehicle network.
US11097668B2

A device for cleaning a camera lens (6), by means of a cleaning head, comprises a fixed cleaning head and a camera that is made mobile by means of drive means (10), the head being accommodated in a structural element (2) of the vehicle. The drive means are suitable for generating a relative movement of the camera in relation to the cleaning head, between a passive image capture position in which the camera is disposed accommodated in said structural element of the vehicle facing the cleaning head, and an active position in which the camera is deployed at a distance from the structural element of the vehicle to allow image capture. The device is particularly effective when applied to the cleaning of a reversing camera implanted in motor vehicles.
US11097665B2

A holding mechanism prevents a device at a back side of a held object from being hidden by the object. Even if a large smartphone is held, clamping with a fixed clamping part and a movable clamping part prevents the fixed part from being moved, wherein a device located back of the smartphone and at the side of the fixed clamping part cannot be hidden by the smartphone. Due to the movable clamping part being movable farther from a rotation axis than the fixed clamping part, a middle portion of the smartphone in the clamping direction substantially coincides with the rotation axis when holding a smartphone with a specified width, wherein the smartphone cannot be easily moved in a Y- and Z-direction when rotating a holding part to change orientation, and also at the back side, a device located at the side of the clamp cannot be easily hidden.
US11097663B2

A vehicular cargo assembly includes first and second panels disposed in a vehicle cabin. A plurality of grooves is provided for slidably coupling the first panel to the second panel. The first panel is movable between a first position, wherein the first panel is superjacent to the second panel, and a second position, wherein the first panel is adjacent to the second panel.
US11097658B1

Lighting may be provided using light sources such as lighting systems with arrays of light-emitting diodes. A lighting system may be integrated into a seat, a door panel, a dashboard, or other interior portions of a system such as a vehicle. The interior portions of the vehicle may be illuminated using lighting systems to provide ambient light, to provide custom surface textures and other decorative patterns, to provide icons, text, and other information, and to provide custom gauges and other illuminated regions. Illuminated regions may overlap sensors such as capacitive touch sensors, force sensors, and other sensors. The light-emitting diodes in a lighting system may supply light that passes through openings in a cover layer. The layer may be formed from fabric, leather, or other materials. Lens structures may guide light through the openings.
US11097655B2

A warning device for a vehicle comprising a number plate support portion for supporting a number plate. The warning device further comprises a warning indicator. The number plate support portion is movably attached to the warning indicator. The number plate support portion is moveable from a first position covering the warning indicator to a second position revealing the warning indicator. Further, the warning device comprises a number plate support portion pivotably attached to the warning Indicator such that the number plate support portion and the warning device fold together and fold apart when the number plate support portion is moved between the first position and the second position.
US11097653B2

A vehicle lamp system includes an imaging unit that takes an image ahead of a host vehicle, a luminance analyzer that detects luminance of each of areas ahead of the host vehicle, a target analyzer that detects objects ahead of the host vehicle, a tracking unit that determines a specific object from the detected objects and detects displacement of the specific object based on a detection result of the luminance; a setting unit that sets, based on the detection result of the luminance and a detection result of the displacement, an illuminance value for each area, which includes a specific illuminance for a specific area determined according to a position where the specific target is present, and a controller that controls the light source the illuminance of the light to be radiated from a light source to each area based on the illuminance values set by the setting unit.
US11097651B2

For vehicles having left and right headlights, a steering direction signal input indicative of a left or right steering direction is used to modulate a control signal of a liquid crystal beam broadening device to broaden horizontally the vehicle headlight beam when the steering direction signal input is indicative of a selected one of a left or a right steering direction and to maintain or reduce a horizontal spread of the vehicle headlight beam when said steering direction signal input is indicative of one of a left or a right steering direction opposite to the selected steering direction.
US11097647B1

A cargo body wall including an interior side defining an interior plane for facing a cargo receiving volume, and an exterior side. A primary logistics track is elongated in a first direction and situated in the cargo body wall, and a secondary logistics track is elongated in a second direction intersecting the first direction. The primary logistics track includes first and second inward expansions projecting inward of the interior plane, each of the first and second inward expansions having at least one opening therein providing access to a logistics fitting accommodation area within the cargo body wall. The secondary logistics track is arranged to cross the primary logistics track at a position between the first and second inward expansions.
US11097640B2

An article of upholstery covering is attached to an article of furniture, by steps that include inserting, into a channel around a frame of the article of furniture, an edge attachment article that is attached by an securement portion thereof along a periphery of the article of upholstery covering; and tensioning the article of upholstery covering to engage a catch portion of the edge attachment article under a lip of the channel.
US11097623B2

A switching power supply device includes a first switch, a second switch, a current sensing portion configured to sense current flowing in the second switch, and a controller configured to control the first and second switches in accordance with the current sensed by the current sensing portion. The controller includes an accumulating portion configured to accumulate information of the current sensed by the current sensing portion during a predetermined period of time while the first switch is in the off state, and reflecting portion configured to start the transmission of the current information accumulated by the accumulating portion before the first switch is changed from the off state to the on state so as to reflect the current information accumulated by the accumulating portion on the slope voltage, and controls the first and second switches in accordance with the slope voltage.
US11097617B2

A refuse vehicle including a chassis, a body assembly coupled to the chassis, the body assembly defining a refuse compartment, an electric energy system, an auxiliary power system comprising a reservoir to hold a hydraulic fluid, and a hydraulic pump powered by an electric motor, wherein the electric motor is powered by the electric energy system and the hydraulic pump pressurizes the hydraulic fluid to power one or more actuators, and wherein a prime mover of the refuse vehicle charges the electric energy system.
US11097609B2

A hybrid vehicle includes: an internal combustion engine; an electric motor; a transmission including an input shaft that receives power inputted from the internal combustion engine and the electric motor and an output shaft that outputs power to a drive wheel; and a power cutting-off mechanism configured to cut off a power transmission route between the internal combustion engine and the output shaft, wherein the electric motor is connected to a rotating member provided on the output shaft in such a manner that the electric motor transmits power to the output shaft at a location downstream of the power cutting-off mechanism.
US11097606B2

The present invention relates to a modular way to build a rolling chassis using composite materials without custom forming, and yielding appropriate weight distribution (centre of gravity) and torsional and bending rigidity.
US11097603B1

An emergency egress system for a multi-passenger vehicle such as a school bus (10) includes a housing (30) that operatively supports a ramp (34) in movable connection therewith. Opening an emergency exit door (18) of the bus causes a housing door (24) to open and the ramp to move outwardly from a retracted position toward an extended position. Opening the emergency exit door also causes the suspension of the bus to be automatically lowered to place the emergency exit opening (16) closer to the ground (166).
US11097590B2

Methods and systems are provided for controlling operation of a stabilizer bar of a vehicle. In one example, a stabilizer bar includes two shafts joined together by a gas-actuated decoupler. The decoupler may be actuated in order to enable each of the shafts to twist relative to each other.
US11097589B2

Embodiments of a suspension for a vehicle is provided. The suspension includes, for example, a frame and a locking assembly. The locking assembly inhibits tipping of a frame of the vehicle when tipping of the frame is detected.
US11097588B2

An air suspension system which includes the ability to adjust the working air volume, pressure, and spring rate of one or more air springs to reduce or eliminate various types of vehicle oscillations. Switchable or variable volume air spring assemblies have the ability to change air spring volumes, which results in changes in air spring rates, and therefore changes in normal loads applied to each wheel. Changes in wheel normal loads change wheel traction (slip) and vehicle dynamics (pitch, roll, yaw displacement, rate and acceleration). The spring rate of one or more of the air spring assemblies is adjusted automatically when a vehicle oscillation is detected. This vehicle oscillation is calculated from the raw vehicle signals, or another vehicle module may detect the oscillation and send a command to the air suspension module to change the spring rates. This changes the natural frequency of the vehicle, dampening the oscillation.
US11097584B2

A four-point link for a vehicle includes a core element and a main laminate comprising a fiber reinforced plastics composite material, which wraps around the core element. The core element comprises four load-introducing elements and a foam core, and the four load-introducing elements (4) are connected by positive engagement to the foam core (5). The four-point link has four additional windings, wherein a respective additional winding wraps around a first, second, third and fourth load-introducing element and operatively connects a respective one of the latter to the main laminate. Compressive forces can be introduced into the main laminate (3) by means of every additional winding (6).
US11097583B2

A multi-functional off-road vehicle has a frame which includes a left lateral frame member and a right lateral frame member. The two frame members are connected by a crossbar. Four wheel assemblies are connected to the frame. At least two of the wheel assemblies are continuous tracks. The crossbar includes a track width adjustment actuator which extends and contracts a length of the crossbar and thereby changes a track width of the vehicle.
US11097580B2

Methods, apparatus, systems and articles of manufacture are disclosed for a modular double pin load sensor coupled to a hitch receiver. An example disclosed apparatus to be coupled to a receiver tube includes a crossbar interface to be coupled to a crossbar of a hitch, a pin adapter coupled to the crossbar interface, a first load-sensing pin disposed within the pin adapter, and a second load-sensing pin disposed within the pin adapter.
US11097579B2

A vehicle hitch assistance system includes a powered suspension system supporting a rear of the vehicle at a height and a controller. The controller acquires position data for a coupler of a trailer, determines when the position data indicates that a hitch ball of the vehicle is aligned with the coupler, and causes the powered suspension system to raise the height of the rear portion of the vehicle until a threshold resistance value is detected.
US11097575B2

A pneumatic tire includes a bead portions and a bead core at the bead portions, the tire being mounted to a 15°-tapered specified rim. The bead portions include a portion inward in a radial direction of an extension line of an inner circumferential surface of the bead core, the extension line extending in the lateral direction, that is positioned outward in the tire lateral direction of an imaginary line passing through a first intersection point between the extension line and a tire inner surface and extends inward in the tire radial direction from the extension line at an angle perpendicular to the extension line. An angle α formed by the imaginary line and a line segment passing through a second intersection point between a bead base and the tire inner surface and the first intersection point between the extension line and the tire inner surface is from 0° to 25°.
US11097558B2

A printing method includes printing an image on a sheet with a printhead, detecting an edge of the printed image in a widthwise direction of the sheet, and performing borderless printing, based on the detection result, to make a margin amount in the widthwise direction become not more than a predetermined value so as to prevent the image from being formed outside of the sheet in the widthwise direction.
US11097556B2

A drying device includes a plurality of guide rollers and a heater. The plurality of guide rollers is configured to contact a liquid applied face of a drying target object that is conveyed with liquid applied to the liquid applied face, while the drying target object is dried. The plurality of guide rollers includes at least one guide roller having a surface roughness of from 2 to 8. The heater is configured to heat the drying target object while the plurality of guide rollers guides the drying target object. A printer includes a liquid application device configured to apply liquid to a drying target object, and the drying device.
US11097554B2

A thermal printhead includes a substrate, a protrusion formed on an obverse surface of the substrate and extending in a main scanning direction, a heat storage layer formed on a top surface of the protrusion, and a plurality of heat-generating parts arranged along the main scanning direction on the heat storage layer. The substrate and the protrusion are integrally formed from a single-crystal semiconductor.
US11097553B2

A control portion sets, as a head line of test mask data, such a read pixel line of a plurality of read pixel lines of read data obtained by a reading portion by performing reading, the plurality of read pixel lines being orthogonal to the sheet conveyance direction, as is located at a position upstream of a read pixel line of the plurality of read pixel lines as is read at a time when a detection portion detects a leading end of the sheet, by a number of lines calculated by adding an initial number of offset lines to a reference number of lines, and sets, as a non mask region, a sheet read region of the test mask data, and replaces, with white pixels, pixels outside such a region of test image data as corresponds to the non mask region.
US11097542B2

There is provided a liquid discharge head including a channel unit. The channel unit includes: first and second individual channel groups including a plurality of first and second individual channels; two supply manifolds and two return manifolds; and bypass channels communicating with the two supply manifolds or with the two return manifolds. A relationship of |P1|>|P2| is satisfied, wherein P1 is a first pressure of the supply manifold provided commonly for the first individual channel group, P2 is a second pressure of the supply manifold provided commonly for the second individual channel group, −P1 is a third pressure of the return manifold provided commonly for the first individual channel group, and −P2 is a fourth pressure of the return manifold provided commonly for the second individual channel group.
US11097536B2

A driving method enables a liquid feeding apparatus using a driving element in a membrane shape to feed a liquid at high liquid feeding accuracy. To this end, a voltage applied to the driving element is controlled in such a way as to repeat a first period in which a first voltage is applied and a second period which is a longer period than the first period and used to effect a change between the first voltage and a second voltage lower than the first voltage, and in such a way as to switch between application and non-application of the first voltage during the first period.
US11097528B2

In a lining material peeling method of peeling a lining material, which is fixedly formed on a surface of a base material, from the base material, a liquefied fluid which evaporates after injection is injected to a boundary between the base material and the lining material.
US11097522B2

A method for manufacturing a wing-box for aircraft comprises: arranging, on a curing surface, a first panel of composite material comprising a skin a plurality of longitudinal stringers, and arranging, on each stringer, a caul plate; arranging, on the first panel, pluralities of support inserts so that each support insert rests on a respective caul plate, and on the skin of the first panel, and arranging, on the first panel, a plurality of ribs of non-polymerized composite material, each rib comprising a plate, a first pair of flanges and a second pair of flanges arranged at opposed ends of the plate, and having openings on an edge of the plate, by placing the respective first pair of flanges on the first panel and the respective plurality of openings on the plurality of support inserts, and having the first panel and the plurality of ribs undergo a curing process in autoclave with vacuum bag.
US11097521B2

A bottom protection film for an OLED panel is provided. More particularly, a bottom protection film for an OLED panel, the bottom protection film having excellent bending performance due to elasticity and impact resistance, excellent alignment process workability, and excellent adhesion to an OLED panel, and being capable of preventing generation of static electricity through performing an antistatic treatment is provided.
US11097517B2

The present invention aims to provide an interlayer film for a laminated glass which has a multilayer structure including two or more resin layers laminated together and can prevent optical distortion even at high temperatures, a laminated glass including the interlayer film for a laminated glass, and a method of producing the interlayer film for a laminated glass. The present invention relates to an interlayer film for a laminated glass, the interlayer film including: two or more resin layers laminated together, one resin layer having a surface with a ratio (Rz/Sm) of a ten-point average roughness Rz (μm) to an average interval Sm (μm) of projections and recesses of 0.0018 or less as measured in conformity with JIS B-0601(1994) in the following manner: a laminated glass is produced using two clear glass sheets conforming to JIS R3202(1996) and the interlayer film; the interlayer film is peeled away from the clear glass sheets after the laminated glass is cooled with liquid nitrogen; the one resin layer is peeled away from another resin layer that is in direct contact with the one resin layer; and the Rz and Sm of the surface of the one resin layer on the side having been in contact with the other resin layer are measured.
US11097514B2

Shaped glass structures, in particular to curved glass structures, having optically improved transmittance are provided along with methods of making such glass structures. Articles and methods described herein mask tube or reforming defects with help of refractive index-matching substances (e.g. optically clear adhesives) and/or additional glass layers. The articles and methods are applicable to any shaped glass, and is particularly useful for 3D-shaped parts for use in portable electronic devices.
US11097501B2

Methods and systems are disclosed for apparel assembly using three-dimensional printing directly onto fabric apparel materials. Disclosed is a method and system for direct three-dimensional printing and assembly of an article of apparel, including designing a three-dimensional pattern for printing, positioning at least a portion of the article on a tray in a three-dimensional printing system, the portion being positioned substantially flat on the tray, printing a three-dimensional material directly onto the article using the designed pattern, curing the printed material, and removing the article from the three-dimensional printing system.
US11097499B2

A method allows for preparation of CNT nanocomposites having improved mechanical, electrical and thermal properties. Structured carbon nanotube forms such as sheet, yarn, and tape are modified with π-conjugated conductive polymers, including polyaniline (PANT), fabricated by in-situ polymerization. The PANI modified CNT nanocomposites are subsequently post-processed to improve mechanical properties by hot press and carbonization.
US11097491B1

A mask-based partition preheating device and method are provided. The device includes an overall heating light source and a local preheating light source. A substrate provided at a forming cylinder is configured to heat an underlying powder. A mask plate is provided between the local preheating light source and the overall heating light source. A powder material to be sintered is coated on a local preheating zone. The local preheating light source, the mask plate and the overall heating light source are all connected to a temperature controller. A temperature control probe and a thermal imager in a temperature monitor are disposed in a working chamber for detecting the temperature of the powder surface.
US11097488B2

A printer and method having a print assembly movable over a print zone, and a controller associated with the print assembly. The printer is capable to receive a second print assembly with an associated second controller. The first controller positions the first print assembly over the print media and to position the second print assembly over the print media. The first controller directs the first print assembly in printing. The second controller to direct the second print assembly in printing.
US11097481B2

A stereolithographic 3D printer comprising: a vat for liquid photopolymer; a print platform; a screen assembly having a screen support assembly supporting a screen for providing selective exposure of electromagnetic radiation for polymerising successive layers of photopolymer to build a 3D printed object on the print platform; and a control system for controlling the separation of the print platform and screen assembly parallel to a build direction, wherein the vat has a vat base that is resiliently deformable or has a resiliently deformable portion.
US11097478B2

A system and corresponding method to move a rod of build material in a three-dimensional (3D) printing system uses a pusher. The rod of build material has distal and proximal ends relative to an extrusion head. The distal and proximal ends having distal and proximal end surfaces, respectively. The pusher engages with the rod and applies an axial force to at least a portion of the distal end surface of the rod for at least a portion of a path the rod travels toward the extrusion head. The axial force actuates the rod of build material without alteration, such as by shaving, fracturing, or otherwise deforming the rod of build material.
US11097476B2

Techniques for measuring a position of a build platform in an additive fabrication device are provided. Such techniques may include detecting the onset and/or dissipation of force applied to a build platform as it moves from being in contact with, to being out of contact with, a container. In some embodiments, the techniques described herein may be applied in a stereolithographic additive fabrication device. According to some embodiments, measurement of forces applied to a build platform may be used to provide for reliable and consistent measurements of the height of the build platform relative to a container by measuring such forces at various positions of the build platform and analyzing the pattern of the forces with distance from the container.
US11097470B2

A laser 3D printing method with orthopedic function, comprising the following steps: step one, measuring a projection characteristic of each spot within a scanning plane, to obtain a deformation quantity of a focused light spot at the each spot within the scanning plane before rectifying; step two, setting compensation quantities of the each spot within the scanning plane of a light spot orthopedic device according to the measuring result of the step one, so that the size of the focused light spot at the each spot within the scanning plane is consistent; step three, turning on the laser, and dynamically matching the light spot orthopedic device and a scanning device to perform the laser 3D printing. The laser 3D printing method and system thereof with orthopedic function could ensure the size of the focused light spot is consistent within the scanning plane, thereby ensuring the quality of 3D printing.
US11097462B2

A method of manufacturing suspension seating includes providing a blank to be used in a suspension member. The blank has a non-visible marker. The method also includes illuminating the non-visible marker with an excitation source. The non-visible marker becomes detectable when illuminated by the excitation source. The method further includes sensing the non-visible marker with a sensor. The sensor is configured to detect the non-visible marker when illuminated by the excitation source. The method also includes determining, by a controller, a characteristic of the blank using the non-visible marker. The controller is in communication with the sensor and configured to receive information related to the non-visible marker from the sensor. The method further includes adjusting the blank to achieve the desired characteristic.
US11097458B2

The invention relates to a mold base for a system for injection molding of plastic parts, in particular for automotive body and/or structure components, preferably for baffle and/or reinforcing structures, comprising at least one, namely first, bridge manifold with at least a first and a second bridge manifold opening for feeding material to at least a first and a second sub-manifold of at least one mold insert assembly and at least a first and a second control valve, wherein the first control valve is provided and configured for controlling the material feed through the first bridge manifold opening and the second control valve is provided and configured for controlling the material feed through the second bridge manifold opening.
US11097447B2

A method for producing a rubber member according to the present invention includes the steps of: supplying a rubber composition to a cylinder provided in an extruder; extruding the rubber composition to a downstream side of the cylinder while kneading the rubber composition in an internal space of the cylinder that includes a plurality of protruding members protruding from an inner wall surface of the cylinder; compressing the rubber composition at least once in the step of extruding the rubber composition to the downstream side; discharging a gas generated from the compressed rubber composition to outside of the cylinder; discharging, through a discharge outlet of the cylinder, the rubber composition after the gas has been generated; and molding the rubber composition that has been discharged through the discharge outlet into a predetermined rubber member shape.
US11097446B2

In an exemplary embodiment, a system for making tied block mat with a border includes a mold having an array of mold cavities; and a hopper that receives a hardenable paste and is spaced from the mold to receive a sheet of mesh material therebetween, the hopper having an opening for depositing the hardenable paste into selected mold cavities, the hopper forming a filling zone with the mold wherein the hardenable paste flows through the opening into the selected mold cavities, and a blocked zone where the hardenable paste is prevented from entering other selected mold cavities of the mold; whereby the tied block mat is formed wherein the hardenable paste in the selected mold cavities becomes embedded in the sheet of mesh material in the filling zone, and a border is formed in the blocked zone where the hardenable paste is blocked from entering the other selected mold cavities.
US11097445B2

The present invention relates to a descending type ceramic 3D printer comprising a rack, the middle part of the rack is provided with a charging block sealed with the four sides thereof, the lower part of the charging block is connected with a lifting device for printing, the lifting device for printing is mounted on the lifting mounting block arranged at the lower part of the rack, the upper left side of the rack is provided with a scraping device cooperating with the material in the charging block, the upper right side thereof is provided with a mounting rack, the mounting rack is provided with a light spot emission device and a light transmission block that cooperate with each other, and the mounting rack is further provided with a discharging device; the present invention aims to provide a descending type ceramic 3D printer in which the light transmission block and the light spot emission device are arranged above the charging block so that the charging block are descended gradually to realize the printing of the product, and when printing and feeding of each part finishes, the scraping device will scratch it flat, greatly guarantying the flatness of each printing, and ensuring the performance of the joint portions, thereby improving the quality of the product.
US11097444B1

A filler material is applied to a plurality of wood elements. The plurality of wood elements is bonded into a composite wood product, where the bonding includes delivering ultrasound energy to the plurality of wood elements. The ultrasound energy has a frequency within a frequency range of 10 kHz-20 MHz.
US11097437B2

A device such as an electric shaver includes a working head attached to a handle for moving the working head along a skin surface, wherein at least one working tool is moveable relative to the handle under a skin contact pressure by a support structure to allow for pivoting of the working head's skin contact contour relative to the handle, wherein a biasing device is provided for biasing the working tool.
US11097423B2

The invention relates to a method of controlling a movable robot manipulator for screwing in a screw at least already plugged into a thread, wherein the screw has a screw head with a tool engagement interface, the robot manipulator has at its distal end a tool designed to engage the tool engagement interface, the screw has a screw central axis, and the tool has a tool central axis about which the tool of the robot manipulator is rotatable. The proposed method includes the following steps of: defining a position of the tool engagement interface of the screw at least plugged into the thread, positioning the tool over the tool engagement interface and orienting the tool central axis with a maximum deviation of 8° concentrically with the screw central axis, with force-regulated and/or impedance-regulated closed tilting movement of the tool central axis, moving the tool along the tool central axis into the tool engagement interface until there is a connection between the tool and the tool engagement interface, screwing in the screw in a first direction of rotation of the tool until a defined limit value G1 of a torque/force acting on the tool has been reached or exceeded, once the limit value G1 has been reached or exceeded, turning back the tool counter to the first direction of rotation through a defined angle in the range of [0.01° to 10°], and removing the tool from the tool engagement interface along the tool central axis.
US11097419B2

A robot system includes: an articulated type robot which retains a processing tool at an arm tip end portion and which includes a plurality of drive units that drive a plurality of drive axes; and a robot controller which controls the drive units so as to control a relative position of the processing target and the processing tool and the robot controller includes: a torque information detection unit which detects torque information on the torques of the drive units; a contact position estimation unit which estimates, based on the change of tendency of a variation in the detected torque information of at least one of the drive units, a contact position in which the processing target and the processing tool make contact with each other; and a position compensation unit which compensates the target position of the robot based on the estimated contact position.
US11097409B2

The invention relates to a power tool and battery pack assembly including a battery pack for connection with the power tool to provide power for the operation of the power tool when connected thereto. The battery pack includes a plurality of power cells and connection means are provided to allow the selective supply of power at least a first or second voltage level to the power tool from the battery pack.
US11097406B2

A dust boot tool includes a shell, a piston, a valve and stretchable rods. The shell includes a chamber in communication with an inlet channel. Pressurized air enters the chamber via the inlet channel. The piston is movable in the chamber by the pressurized air, and includes a first section, a second section opposite to the first section, a vent in the first section in the vicinity of the inlet channel, and a conical internal face extending on the second section. The valve includes a portion movably inserted in the vent. Each of the stretchable rods includes a stretchable end for contact with a dust boot, an abutment end in contact with the conical internal face of the second section of the piston, and a pivotal portion formed between the stretchable end and the abutment end and pivotally connected to the shell.
US11097404B2

A torque limiter can include a housing and a shaft. The housing can include a housing magnet enclosed within the housing. The shaft can be at least partially surrounded by the housing and can be rotatable within the housing. The shaft can include a shaft magnet integrated with the shaft to magnetically couple with the housing magnet to transmit a torque between the housing and the shaft and configured to uncouple from the housing magnet allowing the shaft to rotate within the housing when a threshold torque is reached.
US11097401B2

Magnetic coupling devices are disclosed having magnetic field sensors. The magnetic coupling device may include degaussing coils wrapped about pole extension shoes of the magnetic coupling device.
US11097400B2

Some embodiments are directed to a machine tool holding device for clamping a piece to be clamped that includes a contact surface. The holding device includes at least one claw intended to come into contact with the contact surface of the piece to be clamped. The claw includes a plurality of clamping plates stacked on each other, and each including on their edge a clamping surface arranged to be in contact with a portion of the contact surface of the piece to be clamped.
US11097399B2

A plunger clamp has a body defining a bore with a plunger slidably held in the body bore. A lever is pivotally connected with the body. A link arm pivotally connects between the plunger and lever. A catch mechanism is coupled with the body. A latch mechanism is coupled with the lever. The catch mechanism and latch mechanism couple with one another to lock the plunger in a first clamped position and in a second released position.
US11097397B2

According to an embodiment, a polishing device which polishes a surface of a polishing target, includes a sensor, an end point detector, and an end point condition setter. The sensor senses a characteristic value correlated with a state of the surface during polishing. The end point detector detects that the characteristic value or a polishing time satisfies an end point condition corresponding to an end point of the polishing. The end point condition setter sets the end point condition in accordance with at least one of device information about the polishing device and polishing target information about the polishing target, and outputs the set end point condition to the end point detector.
US11097392B2

A spindle device includes a cover member. The cover member has, formed therein, a gas flow path configured to flow a compressed gas for providing sealing between a chuck portion as a rotating member and the cover member and sealing between the chuck portion and the spindle housing. The gas flow path includes a first conduit configured to communicate the outside of the cover member and a second conduit configured to allow the first conduit to communicate with a gap between the chuck portion and the spindle housing, the second conduit being larger than the outlet of the first conduit. The outlet of the second conduit faces a surface of the spindle housing.
US11097372B2

An elongate tape (10) acts as a vaporizing actuator for impulse metalworking. It has an electrically-insulative base layer (20), an electrically-conductive layer (30), and an electrically-insulative top layer (40). In it, the base layer is characterized by the length of the tape and a first width W1, as measured between a pair of side edges. The conductive layer is characterized by the length of the tape and a second width W2, as measured between a pair of side edges; and the top layer is characterized by the length of the tape and a third width W3, as measured between a pair of side edges. The layers are joined to each other to form the elongate tape with the electrically-conductive layer interposed between the electrically-insulative base and top layers.
US11097370B2

Methods and apparatus to control an output of a switched-mode power supply in a service pack are disclosed. An example power system includes: an engine; a generator configured to generate electrical power from mechanical power delivered by the engine; a switched-mode power supply, comprising an inverter, configured to convert the electrical power from the generator to output power, the output power comprising at least one of welding-type power or battery charging power; a user input device configured to receive an input selecting at least one of a first mode representative of a first welding-type process or a second mode representative of a first battery charging mode; and control circuitry configured to: when the first mode is selected, control the switched-mode power supply to output welding-type power; and when the second mode is selected, control the switched-mode power supply to output battery charging power.
US11097365B2

The wire electric discharge machining device includes a wire bobbin configured to wind and hold a wire electrode, a wire delivery roller configured to draw the wire electrode from the wire bobbin and deliver the wire electrode continuously toward a work-piece, a brake motor configured to apply a load to the wire bobbin in a direction against the drawing of the wire electrode, rotation speed detector configured to detect a rotation speed of the wire bobbin, an emptiness determination device configured to determine that the wire bobbin reaches an empty state based on a rapid change in the rotation speed of the wire bobbin detected by the rotation speed detector, and a drive control part configured to stop the drive of the wire delivery roller when the emptiness determination device determines that the wire bobbin reaches the empty state.
US11097359B2

A cutting tool includes a body having a base and a cutting portion. The cutting portion defines a plurality of first edges and a plurality of second edges. The body defines a trunk passage, a plurality of first branch passages, and a plurality of first independent passages. Each of the first branch passages is open to the trunk passage and has an outlet open to an exterior of the cutting portion proximate to a corresponding one of the second edges. Each of the first independent passages is independent of the trunk passage and the first branch passages and has an outlet open to an exterior of the cutting portion proximate to a corresponding one of the first edges.
US11097342B2

Provided is a method for manufacturing a sintered component having a hole formed therein, in which a sintered component having no defect, such as cracks, can be manufactured with good productivity and also a reduction in tool life accompanied by forming the hole can be suppressed. The method for manufacturing a sintered component includes a molding step of press-molding a raw material powder containing a metal powder and thus fabricating a green body; a drilling step of forming a hole in the green body using a candle-type drill and thus forming a thin-walled portion, of which a thickness Gt as measured between an inner circumferential surface of the hole and an outer surface of the green body is smaller than a diameter Gd of the hole; and a sintering step of sintering the green body after the drilling step.
US11097337B2

A method of manufacturing a cylinder block for an engine comprises providing a cylinder liner for the cylinder block and keeping the cylinder liner in a controlled atmosphere, removing the cylinder liner from the controlled atmosphere, removing moisture and gaseous contamination from the cylinder liner, and positioning the cylinder liner in a mold and over-casting a cylinder block in the mold.
US11097331B2

This press-formed article includes: a top sheet portion; a sidewall continuing to the top sheet portion via a convex ridge line portion; a flange continuing to the sidewall via a concaved ridge line portion; and an outward flange continuing from an edge portion of the top sheet portion to an edge portion of the flange, via an edge portion of the convex ridge line portion, an edge portion of the sidewall, and an edge portion of the concaved ridge line portion, wherein in the same unit, an average thickness TAve, a minimum thickness TMin, and a maximum thickness TMax of the outward flange satisfy Equation 1 and Equation 2. 0.8×TAve≤TMin
US11097329B2

A method for producing an inner automotive structural part containing localized reinforced areas, the method containing the steps of: providing an inner upper front pillar blank, an inner center pillar blank and an inner side rail blank, hot stamping the inner upper front pillar blank, hot stamping the inner center pillar blank, hot stamping the inner side rail blank, wherein, the method contains, prior to the hot stamping steps, the steps of: attaching an inner upper front pillar reinforcement blank to a part of the inner upper front pillar blank, said inner upper front pillar reinforcement blank being hot stamped together with the inner upper front pillar blank, attaching an inner center pillar reinforcement blank to a part of the inner center pillar blank, said inner center pillar reinforcement blank being hot stamped together with the inner center pillar blank.
US11097326B2

A method for producing open-seam pipes from sheet metal panels, in particular thick sheet metal panels. A sheet metal panel, having bending edges on the long sides thereof, is fed to a pipe forming press where the sheet metal panel is formed, lying on a lower tool having of two supporting elements which are horizontally spaced apart from each other, by an upper tool, which can be raised and lowered, by application of a bending force, progressively into an open-seam pipe having bending edges on opposite long sides with a gap for later longitudinal seam welding. In order that the sheet metal panel can be easily, progressively formed or shaped from the start, at least the bending sections immediately adjacent on the bending edges of the sheet metal panel are each formed from the outside to the inside, deviating from a numerically ascending bending step sequence in a pilgering process sequence.
US11097325B2

A drawing machine (1) for drawing a tube (2), defining a longitudinal axis (Y), comprising a first die (3) for carrying out the drawing of the tube by means of the use of a mandrel (4); a device for varying the inclination (5) of the tube inlet into said first die (3); a second die (6) for carrying out a skin pass operation on the tube, arranged downstream of said first die (3); an in-line system for detecting the eccentricity of the tube; a data processing system (7) for processing signals originating from said detection system and sending input data to said device for varying the inclination (5) of the tube to vary the inclination of the tube so as to correct the eccentricity of the tube in-line; wherein said in-line system for detecting the eccentricity of the tube comprises a first detection head comprising at least three first transducers (8) arranged downstream of said first die (3).
US11097319B2

The present invention provides a single-use, pre-packaged, sealed container (1) for use with a nebulizer device having an aerosol generator comprising a membrane, the container containing a cleaning liquid (3) and being configured to fit onto the nebulizer device, so that the container is held in place on the nebulizer device and the membrane is immersed in the liquid. The invention also provides a strip comprising a plurality of containers (10), wherein each container is detachable from the rest of the strip; a pack comprising a multi-day supply of a drug and containers; and a method for cleaning the membrane of a nebulizer device using the container.
US11097318B2

A cup wash disk for cleaning a photoresist process tool is provided. An upper plate is arranged over a lower plate to define a cavity between the upper and lower plates. The lower plate comprises peripheral openings in fluid communication with the cavity and arranged along a periphery of the lower plate. A plurality of shims is arranged between the upper and lower plates to space the upper and lower plates and to define slits between the upper and lower plates. The slits are in fluid communication with the cavity. A method for cleaning the photoresist process tool using the cup wash disk is also provided.
US11097317B1

Provided is an information providing method of an electronic apparatus. The information providing method includes identifying an operation target set including a plurality of operation cells, identifying at least one operation cell for which item sorting is completed among the plurality of operation cells included in the operation target set, and displaying information on or regarding an operation cell selected based on priority order information from among the identified at least one operation cell.
US11097307B2

The present invention relates to a method comprising the steps of: a) contacting an acrylate monomer, a carboxylic acid monomer, and a chain transfer agent under free radical polymerization conditions to form a solution of a polymer having an Mn in the range of from 5,000 to 50,000 Daltons; b) contacting the solution with a base and an ethylenically unsaturated glycidyl functionalized monomer to form a solution of an ethylenically unsaturated acrylate polymer; c) contacting the solution of the ethylenically unsaturated functionalized acrylate polymer with water to form an aqueous dispersion of ethylenically unsaturated functionalized acrylate polymers; and d) removing the organic solvent. The method of the present invention provides a composition suitable for use as a UV curable coating that achieves an excellent balance of hardness, flexibility, and warmth with less reliance on costly MFAs.
US11097303B2

A girth weld coating machine has an application head rotatable about a pipeline. A reservoir of coating material is carried on the application head and progressively dispenses coating material on to the girth weld. The coating material is applied to the pipe surface by a roller to spread and distribute the coating over the surface.
US11097300B2

A paint recovery and cleaning trolley is provided for an apparatus for applying paint provided with a belt for conveying pieces to be painted. The conveyor belt has an upper outward section and a lower return section. The trolley includes a paint recovery subunit and a cleaning subunit. Each subunit includes a reverse roller in contact with the lower return section of the conveyor belt, a doctor blade tangentially placed with respect to the reverse roller for all its length, and a doctor blade scraping the lower return section of the conveyor belt. In each subunit the respective reverse roller, doctor blades and return section of the conveyor belt form a closed chamber having the shape of a triangular prism, of which the components represent the rectangular faces and that contains a solvent which drips from the triangular faces into a respective collecting hopper. Three positions of the trolley are provided including two inserted positions in which the trolley is totally inserted under the conveyor belt and may be inactive or in operation and a lateral extracted position in which the trolley is totally extracted from the apparatus for applying paint.
US11097299B2

A slurry spraying mask includes a holding portion and a mask portion. The holding portion includes a holding portion opening. The mask portion includes a first layer and a second layer. The first layer includes a first tapered structure, the second layer includes a second tapered structure. The first tapered structure and the second tapered structure are arranged coaxially. A gap exists between the first layer and the second layer. The apex of the first tapered structure includes a first aperture, the apex of the second tapered structure includes a second aperture, and the second aperture is overlapped with the first aperture. The apex of the second tapered structure passes through the holding portion opening such that the mask portion is localized to the holding portion.
US11097294B2

A device for rotating a fluid inside a spray nozzle includes a body defining at least one helical slot and/or a helical hole for the passage of all or part of the fluid. This device can be secured to a spray nozzle or a needle valve closing the spray nozzle. An application device includes such a device for rotating a fluid inside a spray nozzle.
US11097293B2

The present invention discloses a water outlet device, comprising: at least one rotatable driving member, at least one injector, and a main body with a plurality of water outflow passages. The main body comprises at least one accommodating cavity, each of the at least one rotatable driving member is driven to rotate by water flow, and each of the at least one rotatable driving member drives the corresponding one of the at least one injector to rotate in the corresponding one of the at least one accommodating cavity. Each of the at least one injector comprises at least one injection hole, the at least one injection hole is connected to the corresponding one of the plurality of water outflow passages, and a water outflow direction of the at least one injection hole and an axial direction of the corresponding one of the plurality of water outflow passage forms an angle.
US11097286B2

A method of identifying a spray tip from a plurality of spray tips based on a selected fluid is presented. The method comprises the step of selecting the fluid. The fluid is characterized by a set of given physical parameters. The method also comprises the step of selecting an application pressure. The application pressure is sufficient to cause atomization of the fluid through the spray tip. The method also comprises the step of selecting the spray tip for the fluid applicator, based on characteristics of the fluid. The spray tip is selected based on an ability to process the fluid. The spray tip is selected such that the fluid has a viscosity on the order of 10 mPa·s in the shear rate range of 104-106 s−1 to ensure a turbulent flow downstream of a pre-orifice.
US11097282B2

An apparatus, method and system for wet or dry processing of plant material is provided. The apparatus has an enclosure attached to a frame. The apparatus includes: (a) a cylindrical rotatable drum for receiving the plant material, the rotatable drum having a plurality of slots; (b) a cutting module for cutting portions of the plant material that pass through one or more said slots; and (c) a plurality of nozzles for ejecting a liquid within the enclosure. The apparatus may further include a controller having a processing unit and a memory, the memory containing instructions for directing the processing unit. The controller may be operable to selectably control operations of the rotatable drum, the cutting module, and the plurality of nozzles. The cutting module may include a plurality of cutting reels. The cutting module and the rotatable drum may be coaxial. The cutting module may include a plurality of blades rotatable about the drum.
US11097273B2

The disclosed technology includes devices and methods for detecting rare cells in whole blood samples using a microfluidic device. Such devices include a housing with a microfluidic chamber having first and second microfluidic layers, each microfluidic layer having an array of microscale structure. Other disclosed devices also include a housing including a chemically functionalized hydrogel matrix and a pump connected to the housing. Disclosed methods include constructing, with an additive manufacturing device, a microfluidic device having a microfluidic chamber, removing, by a thermal release process, at least some of the sacrificial support material deposited by the additive manufacturing device, and chemically functionalizing at least a portion of the microfluidic chamber. Other disclosed methods include chemically functionalizing a hydrogel matrix and connecting the chemically functionalized hydrogel matrix to a pump.
US11097270B2

A microfluidic filtering system may include a first microfluidic channel, a first pump to move fluid along the first microfluidic channel in a first direction, a second microfluidic channel, a second pump to move fluid along the second microfluidic channel in a second direction opposite to the first direction and a filter channel extending between and interconnecting the first microfluidic channel and the second microfluidic channel.
US11097262B2

A method of producing a hierarchical zeolite composite catalyst. The method including dissolving, in an alkaline solution and in the presence of a surfactant, a catalyst precursor comprising mesoporous zeolite to yield a dissolved zeolite solution, where the mesoporous zeolite comprises large pore mordenite and medium pore ZSM-5. The method also including condensing the dissolved zeolite solution to yield a solid zeolite composite from the dissolved zeolite solution and heating the solid zeolite composite to remove the surfactant. The method further including impregnating the solid zeolite composite with one or more active metals selected from the group consisting of molybdenum, platinum, rhenium, nickel, and combinations thereof to yield impregnated solid zeolite composite and calcining the impregnated solid zeolite composite to produce the hierarchical zeolite composite catalyst. The hierarchical zeolite composite catalyst has a mesostructure comprising at least one disordered mesophase and at least one ordered mesophase.
US11097258B2

The invention has as its object a catalyst that comprises a substrate based on alumina or silica or silica-alumina, at least one element from group VIII, at least one element from group VIB, and an organic compound of formula (I) in which R1, R2, R3, R4 and R5 are selected from among a hydrogen atom, or a hydroxyl radical, or a hydrocarbon radical that comprises from 1 to 12 carbon atoms that can also comprise at least one oxygen atom, and R6 is selected from a hydrogen atom, a hydrocarbon radical that comprises from 1 to 12 carbon atoms that can also comprise at least one oxygen atom, a methacryloyl radical, an acryloyl radical or an acetyl radical. The invention also relates to the method for preparation of said catalyst and its use in a method for hydrotreatment and/or hydrocracking.
US11097250B2

Methods of synthesizing crystalline metal-organic frameworks (MOFs) comprising polytopic organic linkers and cations, where each linker is connected to two or more cations, are provided. In the disclosed methods, the linkers are reacted with a compound of formula MnXm, where M is cationic Be, Mg, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Zr, Nb, Mo, Ru, Rh, Pd, Cd, or Hf, X is anionic, n and m are integers. The reacting is buffered by a buffer devoid of metal coordinating functionality when the pKa of the anion is below a threshold related to the lowest pKa of the linker. The reacting is optionally not buffered when the pKa of the anion is at or above this threshold. The disclosed methods lead to product phase MOF in which crystal growth is controlled leading to control over molecular diffusion.
US11097246B2

Methods and systems for highly-sensitive label-free multiple analyte sensing, biosensing, and diagnostic assay are disclosed. The systems comprise an on-chip integrated two-dimensional photonic crystal sensor chip. The invention provides modulation methods, wavelength modulation and intensity modulation, to monitor the resonance mode shift of the photonic crystal microarray device and further provides methods and systems that enable detection and identification of multiple species to be performed simultaneously with one two-dimensional photonic crystal sensor chip device for high throughput chemical sensing, biosensing, and medical diagnostics. Other embodiments are described and claimed.
US11097243B2

Embodiments include a system that may include a reactor including a reaction zone and a gas release zone separated by a selectively permeable membrane, wherein the selectively permeable membrane permits hydrogen to pass through the membrane and substantially blocks a substrate and its dehydrogenative coupling product from passing through the membrane. Embodiments further include a method of producing a dehydrogenative coupling product, wherein the method may include exposing a substrate to a catalyst in a reaction zone of a reactor; coupling the substrate to form the dehydrogenative coupling product and hydrogen; and separating the hydrogen from the dehydrogenative coupling product using a selectively permeable membrane and passing the hydrogen to a gas release zone of the reactor.
US11097234B2

A centrifugal mixing device can include a shaft assembly that is operably coupled to a motor such that the motor rotates the shaft assembly about a first axis. The devices can further include a turret that is rotatably coupled to the shaft assembly such that the turret rotates about the first axis relative to the shaft assembly. The turret can include a first support, a first canister rotatably coupled to the first support such that the first canister rotates about a second axis, and a second canister rotatably coupled to the first support such that the second canister rotates about a third axis. The turret is configured to rotate about the first axis in a first rotational direction and each of the first and second canisters is configured to rotate about the second and third axes, respectively, in a second rotational direction that is opposite the first rotational direction.
US11097220B2

A method of stripping carbon dioxide from a stream of natural gas to be used in the production of liquid natural gas (LNG) comprises the steps of: passing a stream of natural gas through a stripping column; injecting a stripping agent into the stripping column, the stripping agent stripping carbon dioxide from the stream of natural gas and exiting the stripping column as a liquid phase; passing the stripping agent exiting the stripping column through a regenerator column to generate a carbon dioxide gas stream and a recovered stripping agent stream; and cooling the recovered stripping agent stream using a cryogenic vapour generated in the production of LNG and injecting the cooled, recovered stripping agent stream into the stripping column as the stripping agent.
US11097219B2

A process for regenerating a temperature swing adsorption unit comprising: sending a heated purge gas stream through an adsorption bed to remove impurities from said adsorption bed and producing a contaminated stream; sending said contaminated stream to a separator to produce a liquid stream and a vapor stream; returning said vapor stream as at least a portion of said heated purge stream until said vapor stream comprises above a predetermined level of impurities; and purging a portion of said vapor stream until the heated purge stream has a level of impurities below a second predetermined level.
US11097218B2

Disclosed is a flue gas purification tower, comprising a tower body, at least one gas inlet (1) disposed at the bottom of the tower body, at least one gas outlet (2) disposed at the top of the tower body, at least one active coke layer (3) located inside the tower body, and a baffle plate (4) arranged in a place where the flow direction of the flue gas from the gas inlet changes. The baffle plate (4) is a straight plate, an arc plate, a straight-and-arc plate or a straight-arc-straight plate, wherein the straight-and-arc plate comprises a straight segment and an arc segment connected with each other; and the straight-arc-straight plate comprises a straight segment in the vertical direction, a straight segment in the horizontal direction, and an arc segment connected between the two straight segments.
US11097207B2

This invention relates to devices and methods for purifying, detecting and using biological cells. A variety of cell types including viable tumor, stem, immune and sperm cells can be purified from a complex biological sample using a column, including a pipette tip column. Methods of the invention can aid research, diagnosis and treatment of cancer. Purified viable cells can be detected on the column or eluted from the column and detected. Cells on a column can be used as a stationary phase for liquid chromatography. Cells may be removed, recovered and analyzed.
US11097200B2

The invention concerns an apparatus (10) for separation of components with different volatility in a mixed fluid, said apparatus (10) comprising: a first heat exchanging unit (100) provided with first and second flow path structures (131, 132) forming separate flow paths for a first and a second fluid flow through the first heat-exchanging unit (100); an inlet (118) for feeding the mixed fluid to the apparatus (10); an inlet (119) for feeding steam to the apparatus (10); an arrangement for feeding a cooling medium through the apparatus (10), wherein said arrangement comprises at least one cooling medium inlet (105, 106, 107, 108). The invention is characterized in that the apparatus (10) comprises a second heat-exchanging unit (200) provided with third and fourth flow path structures (233, 234) forming separate flow paths for a first and a second fluid flow through the second heat-exchanging unit (200), wherein the cooling medium arrangement comprises at least one cooling medium inlet (205, 206, 207, 208) arranged in fluid communication with the fourth flow path structure (234) and wherein the first and third flow path structures (131, 233) are arranged in fluid communication with each other.
US11097198B2

A pop sensor and device for revealing a winner for use in battle or sword-type games, A device for revealing a winner comprises a bladder, a pop mechanism, a pop mechanism support structure, and a bladder destruction apparatus. The device for revealing a winner is coupled to a pop sensor system comprising a pop sensor. Activating the pop sensor causes the player's pop mechanism to activate and cause the bladder to destroy, instantly disengaging the losing player while revealing the winning player.
US11097196B2

A carousel for amusement parks including a spherical casing able to contain at least one passenger; a plurality of rotating bodies able to stay in contact and to receive in support the spherical casing, each of the rotating bodies being able to rotate on itself around at least two respective axes of rotation, of which one steering axis passing through the center of the spherical casing and a rolling axis orthogonal to the steering axis; first motor means able to actuate a first of the rotating bodies in rotation around the respective steering axis; second motor means able to actuate the first rotating body in rotation around the respective rolling axis; and third motor means able to actuate a second of the rotating bodies in rotation around the respective steering axis.
US11097192B2

Methods, systems, and non-transitory computer-readable media are provided for fraud detection within an interactive media system such as a computer-based game. In some implementations, fraud in online subscription payments can be detected. The fraud detection can be used to adjust virtual currency revenue sharing payouts to developers associated with the computer-based game.
US11097188B2

A system, method, and graphical user interface for playing games and/or executing applications on a tablet-based client. One embodiment of a graphical user interface (GUI) for playing a video game on a tablet-based client device comprises: a virtual controller rendered on a display of the tablet computer, the virtual controller substantially mimicking the control provided by a thumb stick of a physical game controller and providing omnidirectional, free-form movement in a synchronous direction in which a user moves a finger on the display of the tablet-based client.
US11097187B1

Methods and systems for a consultation bot platform are provided. In one aspect, a method includes receiving an input indicating a request for assistance for an issue occurring in a video game. The method also includes determining a category associated with the request for assistance. The method also includes determining whether a score associated with a second-user for the category satisfies a threshold score and adding the second-user to a set of second-users in response to the score satisfying the threshold score. The method also includes selecting a first second-user from the set of second-users. The method also includes initiating a communication channel between the first user and the first second-user. The method also includes transferring messages between the first user and the first second-user. The method also includes generating a quality score for the request for assistance based on messages transferred between the first user and the first second-user.
US11097184B2

A game controller includes a joystick that accepts end user inputs and has illumination provided at the game controller surface encircling the joystick to provide indications to an end user, such as a locally-determined game controller status or a game application end user energy state. The illumination is provided from light emitting diodes disposed within the game controller interior on a flexible printed circuit board and coupled to a base of an annular light guide by a gasket to direct illumination into the annular light guide. Non-translucent treatment at the light guide on the game controller surface defines a translucent region at which illumination is presented.
US11097176B1

A basketball training apparatus includes a shot completion sensor, a condition sensor, and a computer. The shot completion sensor determines whether a shot goes through a basketball hoop. The condition sensor senses a physical condition of a basketball shooter. The computer is in communication with the shot completion sensor and the condition sensor, and has a processor for calculating shot completion percentage as a function of the physical condition.
US11097174B2

The invention includes apparatus and methods for a novel modular self-returning batting tee. In one preferred embodiment, a modular self-returning batting tee may have one or more extension arms that are compatible with a variety of different batting attachments and/or aids, and may further be secured to a receiver tube positioned within a flexible boot. This receiver tube may be coupled with a weighted base through a novel recoil joint. In this embodiment, when the tee is struck, such as may occur during batting practice, the extension arm may bend forward engaging the flexible boot and/or novel recoil joint and causing the extension arm to self-return to a pre-determined position.
US11097173B1

A basketball illumination system includes a light source mounted beneath a basketball rim to prevent glare and improve visibility of the rim in low lit conditions. Some embodiments include an L.E.D. strip arranged in a hoop directly below the rim. A bungee cord may couple the L.E.D. strip to the rim under tension to prevent the L.E.D. strip from straying into the path of balls travelling through the rim. Some embodiments include a rebound sensor and/or a shot senor. Each sensor may change the illumination of the L.E.D. strip in a different way upon detection.
US11097167B2

Golf clubs and/or golf club heads include a club head body defining an interior chamber, structure for engaging a shaft with the body, and/or a shaft engaged with the body. The club head body may have an overall length of at least 4.5 inches and an overall breadth of at least 4.2 inches. In other examples, the club head body may have an overall length of at least 4.6 inches and a ratio of the overall breadth dimension to the overall length dimension of 1 or less. If desired, the ratio of the head breadth to head length dimensions may be in a range from at least 0.94 to 1 or less.
US11097160B2

Lanyard having at least one belaying strap connected with a swivel connection which comprises two assembly parts able to rotate with respect to one another with a relative rotational movement. The two assembly parts of tubular shape are engaged coaxially in one another, the first outer part having a larger diameter than that of the second inner part. At least one of the parts is provided with a slot or hole for fitting securing means designed to secure the two parts in rotation in the engaged state. Applications: safety and securing lanyards for via ferrata, caving, mountaineering.
US11097159B2

A device for general and sport physiotherapy, facilitating the performance of stretching and relaxation exercises on the muscles of the entire body. One innovative aspect of this device lies in the configuration of its guidance mechanism, the configuration of the mechanism for regulating the device's height, the configuration of the mechanism facilitating the rotation of the transverse carrier bar with its self-locking rotatable coupling around the axle of the transverse carrier bar, and in the configuration of the device as a whole, which provides the user with the choice of a new range of prophylactic and preventive health care exercises and appropriate therapies. The patent request at hand is being lodged for both the manual as well as the electronic operation mechanism of the device.
US11097151B2

A locking device for an exercise system may include a locking member having a contact portion and configured to move between a first position and a second position. When in the first position, the contact portion of the locking member is not in mechanical communication with the resistance mechanism of the exercise system, thereby allowing movement of the at least one moveable assembly. When in the second position, the contact portion of the locking member is in mechanical communication with the resistance mechanism of the exercise system, thereby preventing movement of the at least one moveable assembly.
US11097148B2

An exercise device having a stowed configuration and a deployed configuration, in which in the stowed configuration, the exercise device is aesthetically pleasing and suitable for most rooms due to front and side panels that hide the framing of the exercise device, and in the deployed configuration, the side panels are opened to expose the arms, which can be deployed, moved up and down to adjust the height, and used to perform exercises based on a pulley system. Pneumatic cylinders may be operatively connected to the pulley system to provide the resistance for the exercises. Handles having gas actuators may be operatively connected to the pneumatic cylinders to adjust the resistance.
US11097146B2

Training equipment includes a hollow shaft having a sidewall defining an internal cavity and at least one polymer material filling at least a portion of the internal cavity. The polymer material may fill the entire internal cavity of the hollow shaft. The polymer material may be a visco-elastic polymer material or polyurethane. A spacer or a filler may fill at least a portion of the internal cavity. A method of making weighted training equipment with a hollow shaft having a sidewall defining an internal cavity may include injecting a curable composition into at least a portion of the internal cavity. The method may further include curing the curable composition into a polymer material.
US11097139B1

A corrosion prevention process to protect the piping of a dry pipe sprinkler system from corrosion is described. The process includes the selection and application of suitable corrosion inhibitors to interior portions of the piping. The corrosion inhibitors used in this process may include volatile corrosion inhibitors.
US11097135B2

The present invention relates to a rope type elevating device, and more particularly, to a rope type elevating device that can mechanically and safely control the falling speed even if a breakage occurs in the brake being electrically controlled during the elevating and descending operation. The rope type lifting device of the present invention comprising an electronic braking device for winding a conveying rope to move the rope up and down by using power, and a mechanical braking device for mechanically moving the conveying rope up and down, characterizes in that the mechanical braking device comprises: an unlocking lever being rotated by an external force within a predetermined rotation range; a connecting portion connected to the unlocking lever and moving forward by a predetermined amount in conjunction with the rotation of the unlocking lever; a rotating body that rotates by the amount of advancement of the connecting portion and adjusts a pressing force applied to the conveying rope; and a stopper for limiting the rotation range of the rotating body and supporting the pressing force applied to the rope by the rotating body.
US11097134B2

A method for treating a neurological disorder, symptom or disease that is associated with an increase in the brain levels of caveolin-1 (Cav-1) in a subject in need thereof is disclosed. The method comprises administering to the subject in need thereof a composition comprising: (a) a therapeutically effective amount of an antibody specific against the Cav-1 or an antigen-binding fragment thereof; and (b) a pharmaceutically acceptable carrier. Methods for reducing cerebral inflammation, brain tissue damage, brain neuronal death, and improving behavioral outcomes or functional recovery related to a hemorrhagic stroke in a subject in need thereof are also disclosed.
US11097133B2

A method and system for treating tissue with a combined therapy profile is disclosed. In one exemplary embodiment, ultrasound energy is used to treat numerous depths of tissue within a region of interest and the spatial and temporal properties of the ultrasound energy are varied for more effective treatment. The method and system of the present invention are configured to treat all of the tissue from the surface on down and not spare intervening tissue.
US11097132B2

Described herein are methods and devices for selectively applying either fluids (e.g., anesthetics, nerve-blockers, etc.) or energy, such as radiofrequency or ultrasound energy, to a target tissue from within a blood vessel while minimizing the amount of fluid or energy applied to non-target tissue. The catheters described herein may include an elongate body, a directional injector, and one or more holdfasts for securing the catheter. In addition, catheters can include energy applying features for delivering energy to the target tissue.
US11097129B2

An object positioning apparatus comprising: a radiographic image input interface configured to acquire a radiographic image that is generated by causing a fluoroscopic imaging apparatus to image an object and includes a first region and a second region, the first region depicting an index region for positioning of the object, the second region depicting a non-index region other than the index region; and a positioning processor configured to perform the positioning of the object by performing matching processing between a previously generated reference image and the first region that is specified from the radiographic image based on three-dimensional model information of the non-index region.
US11097127B2

A system that generates a three-dimensional model of a tissue surface, for example the inner surface of the heart from two-dimensional image data slices. On this surface, one or more pattern lines are drawn, e.g., by a physician using a user interface, to designate desired lesion(s) on the surface. From the pattern lines, a three-dimensional volume for a lesion can be determined using known constraints. Advantageously, the series of boundaries generated by the three-dimensional volume may be projected back onto the individual CT scans, which then may be transferred to a standard radiosurgical planning tool. A dose cloud may also be projected on the model to aid in evaluating a plan.
US11097115B2

An implantable pulse generator is provided that includes a power source, a wireless communication component configured to facilitate wireless communication with a non-implanted device and pulse-generating circuitry connected to the power source. The pulse-generating circuitry can be configured to identify, based on wireless communication with the non-implanted device, temporal and amplitude characteristics for electrical pulse stimuli and to trigger electrical output stimuli having the temporal and amplitude characteristics. The implantable pulse generation can further include one or more lead connections—each being shaped to engage a lead and electrically connected to the pulse-generating circuitry to enable the lead to deliver at least part of the electrical output stimuli triggered by the pulse-generating circuitry. The implantable pulse generator can further include one or more suture-engagement components, each including one or more holes each having a diameter that is at least 0.1 mm and less than 5 mm.
US11097114B2

A system and method for installing/implanting a leadless implant can include a leadless implant with shortened tine-based anchors and an implantation tool with a modified tip. The tines can extend from a surface of the leadless implant and may include a preformed curve or other shape to enable the tine to hook into or grapple tissue. The implantation tool may be provided with a modified tip to assist with proper alignment, insertion, and anchoring of the shortened tines. A tip of the implantation tool can have a reduced inner diameter to cause the tine tips to be approximately normal to the surface of the tissue to which the implant is being anchored. Upon deployment of the leadless implant, the tines of the anchoring mechanism are appropriately aligned for proper insertion so that robust anchoring is achieved.
US11097110B2

An implantable medical device (402) includes an attachment member (424) having an aperture (428) with a first diameter. A delivery device (400) includes a catheter shaft (406), a tube (450′) within the shaft, and a tether (422′) within the tube. The tube has a main portion (455′) with a second diameter and an expandable distal end (457′). The tether has a body (423′) and a tether member (426′) having a third diameter greater than the second diameter and smaller than the first diameter. The tether is slideable relative to the tube from a released condition in which the tether member is positioned at least partially distal to the distal end of the tube, and a locked condition in which the tether member is at least partially surrounded by the distal end of the tube. The distal end of the tube can pass through the aperture only in the released condition.
US11097109B2

A cardiac pacing system having a pulse generator for generating therapeutic electric pulses, a lead electrically coupled with the pulse generator having an electrode, a first sensor configured to monitor a physiological characteristic of a patient, a second sensor configured to monitor a second physiological characteristic of a patient and a controller. The controller can determine a pacing vector based on variables including a signal received from the second sensor, and cause the pulse generator to deliver the therapeutic electrical pulses according to the determined pacing vector. The controller can also modify pacing characteristics based on variables including a signal received from the second sensor.
US11097108B2

Systems and methods for reducing ventricle filling volume are disclosed. In some embodiments, a stimulation circuit may be used to stimulate a patient's heart to reduce ventricle filling volume or even blood pressure. When the heart is stimulated at a consistent rate to reduce blood pressure, the cardiovascular system may over time adapt to the stimulation and revert back to the higher blood pressure. In some embodiments, the stimulation pattern may be configured to be inconsistent such that the adaptation response of the heart is reduced or even prevented. In some embodiments, a stimulation circuit may be used to stimulate a patient's heart to cause at least a portion of an atrial contraction to occur while the atrioventricular valve is closed. Such an atrial contraction may deposit less blood into the corresponding ventricle than when the atrioventricular valve is opened throughout an atrial contraction.
US11097105B2

A pulse current generation circuit (100) for neural stimulation includes an analogue signal receiving device (101) for receiving an analogue signal; an analogue-to-digital converter (102) for converting the analogue signal into a digital control signal; a current signal controller (103) for producing, according to the digital control signal, pulse current parameters for generating bidirectional pulse current signals; and a current generator (104) for generating, according to the pulse current parameters, bidirectional pulse current signals for neural stimulation, and the current generator can generate pulse currents of different precisions according to the pulse current parameters. In addition, the present invention further relates to a charge compensation circuit, a charge compensation method, and an implantable electrical retina stimulator using the pulse current generation circuit or the charge compensation circuit.
US11097104B2

The present invention provides an electroporation device and a method for controlling an electroporation device for facilitating delivering active substances into skin such as stratum corneum while minimizing discomfort of a user by modulating applied voltage pulses. The electroporation device according to the present invention comprises: a measurement unit being configured to provide multiple outputs of one or more resistance measurement voltage pulses for measuring a resistance of skin of a user at a predetermined interval; and an output unit being configured to provide an output of one or more electroporation voltage pulses to the skin of the user based on the resistance of the skin of the user per each output of the one or more resistance measurement voltage pulses.
US11097103B2

A resilient fabric band providing a sensor platform for a wearer in order to sense a plurality of biometric data, the band comprising: a pair of ECG sensors coupled to an interior surface of a body of the band, each of the pair of ECG sensors located on either side of a front to back centerline of the body; a pair of bio impedance sensors coupled to the interior surface of the body of the band, each of the pair of bio impedance sensors located on either side of the front to back centerline; a strain gauge sensor coupled to the body of the band; a computer device mounted on the body of the band via a housing, the computer device including a power source, a computer processor, a memory for storing instructions for execution by the computer processor, and a network interface for transmitting data sensed by the sensors; and a plurality of communication pathways connecting the computer device to each of the sensors, the communication pathway for sending power from the power supply to the sensors as controlled by the computer processor and for receiving sensed data from the sensors by the computer processor.
US11097094B2

In embodiments, a wearable cardiac defibrillation (WCD) system includes one or more flexible ECG electrodes. The WCD system may have a support structure that is dimensioned to be worn so as to press the electrodes towards the body of the patient. The electrodes may be made from appropriate material so as to flex in order to match a contour of the body of the patient. An advantage over the prior art is that the flexible electrode may make better electrical contact with the patient's skin, and therefore provide a better ECG signal for the WCD system to perform its diagnosis.
US11097091B2

An implantable cardiovascular blood pump system is provided, suitable for use as a left ventricular assist device (LVAD) system, having an implantable cardiovascular pump, an extracorporeal battery and a controller coupled to the implantable pump, and a programmer selectively periodically coupled to the controller to configure and adjust operating parameters of the implantable cardiovascular pump. The implantable cardiovascular blood pump includes a coaxial inflow cannula and outflow cannula in fluid communication with one another and with a pumping mechanism. The pumping mechanism may be a vibrating membrane pump which may include a flexible membrane coupled to an electromagnetic actuator assembly that causes wavelike undulations to propagate along the flexible membrane to propel blood through the implantable cardiovascular pump. The implantable cardiovascular pump may be programmed to operate at frequencies and duty cycles that mimic physiologic flow rates and pulsatility while avoiding thrombus formation, hemolysis and/or platelet activation.
US11097078B2

A system and method for facilitating and maintaining various states of a user consciousness, including the transition between a conscious and unconscious state, is provided. The system and method include use of a smart device having a user interface, a biometric sensor coupled to a user and configured to transmit the user's biometric data to the smart device and an environmental sensor configured to transmit environmental data to the smart device. The smart device controls one or more environmental systems proximate the user and an audio/visual device proximate the user to facilitate transitioning the state of the user.
US11097072B2

With a nebulizer mesh selection method it is possible to achieve optimal treatment which fits a medicine and a patient. A nebulizer mesh selection method includes a step of acquiring a medicine attribute, by a computer, a step of acquiring a patient breathing ability, a step of selecting a mesh that corresponds to the acquired medicine attribute and patient breathing ability based on a mesh selection table in which a predetermined mesh corresponds to a combination of a medicine attribute and a patient breathing ability, and a step of outputting the selected mesh.
US11097068B2

A safety needle having a rigid outer structure within which there is a cannula holding element of being movably coupled to an injector pen for a drug is provided. The cannula holding element supports a cannula having a first extremity and a second extremity for administration of the drug. A moving protective element associated with the rigid structure, covers the second extremity of the cannula after administration, with provision being made for a deforming member capable of deforming the cannula after administration of the drug so that the second extremity of the cannula remains within the protective element. The deforming member is associated with the protective element and is capable of rotating autonomously with respect thereto after administration of the drug to deform the cannula.
US11097067B2

An injection pen comprises a starting mechanism (1) and a driving mechanism (2). A needle pin (40) of the starting mechanism (1) fitted to a connecting rod (30) and a front spring (60) is disposed in a front housing (10) and an inner casing (20) therein. A front cover (50) is disposed at the front end of the front housing (10) and covers the needle pin (40). A rear housing (70) of the driving mechanism (2) and a driving casing (80) therein are connected to the front housing (10). A trigger tube (90) and a key panel (A0) are mounted in the driving casing (80). A push rod (A1) fitted to a rear spring (A2) is mounted in the trigger tube (90). An elastic baffle (83) of the driving casing (80) fastens the driving casing (80) and the push Rod (A1) and locks the rear spring (A2). An injection needle group (3) can be mounted between the starting mechanism (1) and the driving mechanism (2). When the front cover (50) is removed, the needle pin (40) can be pressed and inwards retreated into the front housing (10) to make a needle (3A) to be exposed, and the inwards retreated needle pin (40) drives the connecting rod (30) to push away the elastic baffle (83) of the driving casing (80) to perform unlocking. The released rear spring (A2) pushes the push rod (A1) to make an injection needle group (3) to transfer a drug. After the injection, the needle pin (40) is reset under the push of the front spring (60), and the needle pin (40) is fastened in the inner casing (20) when a key panel (A0) is pulled out by means of the connecting rod (30), so that the needle pin (40) cannot be pressed to inwards retreat, and accordingly, a used syringe needle (3A) is protected, so as to prevent users from being hurt by the needle by accident.
US11097058B2

Improved apparatus for use with medication in fluid form, which is particularly beneficial for medications having a relatively high viscosity. The disclosed syringe adapter has an opening that is relatively large, as compared to a conventional needle, and thus affixing the disclosed syringe adapter to a syringe improves syringeability of higher-viscosity medications. When the disclosed syringe adapter is affixed to a pistol-grip or tab-handled syringe, the medication withdrawn into the pistol-grip syringe can be more easily administered from the syringe barrel. In some embodiments, the syringe adapter will be replaced with a needle prior to injecting the medication, while in some other embodiments, the needle is affixed to the in-place syringe adapter for the injection.
US11097053B2

In selected embodiments, a handheld injection safety applicator includes an applicator housing with a handle and a retractable needle housed within the applicator. The applicator further includes a first sensor that detects the presence of a user's grip on the handle and a second sensor that detects the presence of an animal. The applicator also includes processing circuitry configured to receive a first signal from the first sensor indicating that the user is gripping the handle and receive a second signal from the second sensor indicating that an animal is detected. The applicator extends the needle out of the applicator into the animal once the first and second signal are received and delivers a dose of medication into the animal once the needle is fully extended into the animal.
US11097047B2

A syringe rack securable to a surface of a fixture and configured for facilitating a sterile transfer of fluid from a non-sterile environment to a sterile environment. The syringe rack includes a securing portion and a syringe-receiving station. The syringe-receiving portion is coupled to the securing portion and configured to receive the syringe in a selectively releasable coupling arrangement where the syringe is oriented such that an opening in a barrel of a syringe projects away from the fixture when the syringe is received by the syringe-receiving station and when the securing portion is secured to the surface of the fixture.
US11097046B2

The invention relates to an injection device for injecting a liquid drug. The injection device comprises a housing assembly supporting a non-removable cartridge having an interior chamber containing the liquid drug to be injected and a reusable needle cannula connected to the cartridge. A needle shield assembly provided with a cleaning chamber containing a volume of a cleaning agent for cleaning at least the distal tip of the needle cannula between subsequent injections is further provided. The needle shield assembly is axially movable in a proximal direction in relation to the housing assembly from a first position to a second position upon rotation of at least a part of the needle shield assembly, wherein the first position is a position in which the distal tip of the needle cannula is located inside the cleaning chamber thereby cleansing the distal tip of the needle cannula, and the second position is a position in which the distal tip of the needle cannula is located outside and distal to the cleaning chamber for equalizing the pressure in the cartridge.
US11097044B2

Apparatuses and methods disclosed herein relate to various embodiments of wound fillers that, in some cases, preferentially collapse in one direction as compared to another direction. Such apparatuses and methods may aid in the closure of wounds and may further be used in combination with pressure sensors and controllers to provide for controlled collapse of the wound fillers.
US11097036B2

A declogging assembly (20) is configured for use with a suction conduit (10). The suction conduit has a head (14) at a first end (15) and a vacuum tube connection (16) at a second end (17). The assembly includes a body (30). The body defines a first aperture (32), a second aperture (34), and a third aperture (36). The assembly also includes a plug (40) disposed within the body (30). The plug has a surface (42) configured to contact the head (14) of the suction conduit (10) so as to move the plug from a first position, in which the first aperture (32) is in fluid communication with the second aperture (34), to a second position, in which the first aperture (32) is in fluid communication with the third aperture (36). The assembly (20) also includes a biasing member (50) configured to bias the plug into the first position.
US11097033B2

A method of crosslinking a protein or peptide for use as a biomaterial, the method comprising the step of irradiating a photoactivatable metal-ligand complex and an electron acceptor in the presence of the protein or peptide, thereby initiating a cross-linking reaction to form a 3-dimensional matrix of the biomaterial.
US11097032B2

The present disclosure discloses a scent diffusion device including an air pump, an atomizer and a liquid storage bottle. Wherein the atomizer is connected to the air pump and the liquid storage bottle, an atomizing chamber is disposed in the atomizer, a gas passage and a liquid passage is disposed in the atomizer. The gas passage is connected to the air pump and is contracted to form a gas outlet. The liquid passage is connected to the inside of the liquid storage bottle and is contracted to form a liquid outlet. The gas outlet is located at the liquid outlet and blows from the side of the liquid outlet to the other side of the liquid outlet. The atomizing chamber is connected to the gas outlet and the liquid outlet, and the atomizer is further provided with a mist outlet.
US11097030B2

The invention provides to a powdered composition of additives and a method of use thereof for increasing the visibility, potency and coverage of disinfectant solutions, such as bleach.
US11097026B2

A disinfectant transmissive material incorporated into a case for a mobile device or a supporting surface of a disinfecting charger to enable disinfection of hard to reach areas. The case can be self-disinfecting. The disinfecting charger can have monitoring and safety systems that detect proximity and provide user feedback on safety, disinfection, and charge status along with automatic interlocks to protect the user from overexposure to disinfectant.
US11097020B2

The disclosure provides compounds and compositions, and methods of using these compounds and compositions, for the targeted delivery of therapeutic agents. In one embodiment, these compositions are used for the tumor-targeted delivery of chemotherapeutic agents useful for treating cancer.
US11097011B2

Provided herein are oligonucleotides, peptides, and peptide-oligonucleotide-conjugates. Also provided herein are methods of treating a muscle disease, a viral infection, or a bacterial infection in a subject in need thereof, comprising administering to the subject oligonucleotides, peptides, and peptide-oligonucleotide-conjugates described herein.
US11097008B2

The present invention is directed colloidal microcrystalline compositions, particularly for suspending particles in low viscosity fluids, produced by co-attrition of a mixture of microcrystalline cellulose and at least a polysaccharide in the presence of acidic attrition aid; their preparation; and, products made therewith.
US11097005B2

Provided herein are methods and pharmaceutical compositions for the treatment of obesity-associated conditions using cadherin-11 antagonists.
US11097002B2

The present invention provides novel nanoparticle presented vaccine compositions that are stabilized with a locking domain. Various immunogens can be employed in the preparation of the vaccine compositions, including viral immunogens such as HIV-1 and Ebola viral immunogens, and non-viral immunogens such as immunogens derived from bacteria, parasites and mammalian species. The invention also provides methods of using such vaccine compositions in various therapeutic applications, e.g., for preventing or treating viral infections.
US11097000B2

The disclosure provides various immunogens comprising a repeat unit of saccharide of Klebsiella pneumoniae CPS, which has a formula selected from the group consisting of Formulae (I) to (VI) as described herein. Also provided are vaccines including one or more immunogens selected from Formula (I) to (VI) and methods of eliciting an immune response against a Klebsiella pneumoniae and preventing infection of Klebsiella pneumoniae by using an immunogen of the invention.
US11096998B2

BCMA-specific fibronectin type III (FN3) domains, BCMA-targeting chimeric antigen receptors (CARs) comprising the FN3 domains, and engineered BCMA-targeting immune cells expressing the CARs are described. Also described are nucleic acids and expression vectors encoding the FN3 domains and the CARs, recombinant cells containing the vectors, and compositions comprising the engineered immune cells. Methods of making the FN3 domains, CARs, and engineered immune cells, and methods of using the engineered immune cells to treat diseases including cancer are also described.
US11096993B2

Formulations and methods of treatment are disclosed for prevention and/or treatment of visual loss from age-related macular degeneration. The disclosed formulations include botulinum neurotoxin. The disclosed formulations may be applied to an intraocular or extraocular region of a patient. If applied to an extra ocular region of a patient, the botulinum-based pharmaceutical formulation may then be transported to the intra-ocular region of the patient, allowing the active ingredient(s) to penetrate into the choroid, neuro-retina, and/or retinal pigment epithelium without direct injection into the eye, eliminating risk of retinal detachment, retinal break, retinal hemorrhage, and blindness. The methods described herein allow for increased blood flow to the choroid, which improves removal of metabolites and intra retinal fluid and also serves to arrest, reverse and/or delay early and later stages of age-related macular degeneration.
US11096977B2

A composition including a standardized Wedelia chinensis extract and a method of treating an androgen-stimulated disorder with such a composition. Also provided are a method for qualifying a standardized preparation of a Wedelia chinensis extract for treating an androgen-stimulated disorder and a method for treating said disorder with a thus qualified preparation.
US11096968B2

The present disclosure relates to an in vitro method for enhancing engraftment of neurosensory precursor cell comprising the step of contacting an isolated neurosensory precursor cell prior to a transplantation in a subject in need thereof, with a gem-difluorinated C-glycopeptide compound of general formula I, or a pharmaceutically acceptable base, addition salt with an acid, hydrate or solvate thereof: (I).
US11096964B2

Compounds that either produced a higher proportion or greater absolute number of phenotypically identified nave, stem cell memory, central memory T cells, adaptive NK cells, and type I NKT cells are identified. Compositions and methods for modulating immune cells including T, NK, and NKT cells for adoptive cell therapies with improved efficacy are provided.
US11096960B2

Mineral, cosmetic, pharmaceutical, agricultural, nutraceutical, and other compositions are produced using a mineral composition containing minimal concentrations of cadmium, lead, arsenic, and mercury and containing relatively high concentrations of micro and macro mineral elements, of rare earth elements, of calcium, and of silica. The mineral concentrations are produced by processing naturally occurring clay soil to concentrate mineral elements naturally occurring in the soil.
US11096955B2

The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt; SEQ ID NO. 1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC  wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
US11096950B2

The present invention relates to prevention of congenital deformations. The invention further relates to cancer inhibition and prevention. The invention further relates to methods and compositions to modulate, antagonize, or agonize disparate signaling pathways that may converge to regulate patterning events and gene expression during prenatal development, post-natal development, and during development in the adult organism. The invention also relates to activators or deactivators of pyruvate kinase M2 (PKM2) for the treatment, prevention, or amelioration of diseases related to PKM2 function.
US11096944B2

The invention relates to particular substituted deuterated heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and/or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving 5-HT2A receptor, serotonin transporter (SERT) and/or pathways involving dopamine D1/D2 receptor signaling systems, and/or the treatment of residual symptoms.
US11096936B2

This invention relates to cocrystals of naloxone and of naltrexone and their use as opioid antagonists. The cocrystals of the invention include naloxone isonicotinamide cocrystal, naloxone hydrochloride piperazine cocrystal, naltrexone menthol cocrystal, naltrexone thymine cocrystal, naltrexone 2,5-dihydroxybenzoic acid cocrystal, naltrexone salicylic acid cocrystal, naltrexone hydrochloride piperazine cocrystal and naltrexone hydrochloride sulfathiazole cocrystal. A drug-in¬ adhesive transdermal patch containing the opioid analgesic fentanyl or an analog thereof and a cocrystal of naloxone or naltrexone is disclosed. Also disclosed is a method of treating pain, such as acute, chronic or intermittent pain, by applying a drug-in-adhesive transdermal patch of the invention to the skin of a patient in need thereof. Also disclosed is an improved transdermal patch for administering fentanyl or an analog thereof, or for administering a mu opioid agonist, the improvement wherein the transdermal patch contains a cocrystal of the invention in an abuse limiting amount. The improved transdermal patch may be a drug-in-adhesive transdermal patch or a reservoir transdermal patch.
US11096930B2

Disclosed herein are substituted imidazopyridine compounds of formula (I) which are inhibitors of indoleamine 2,3-dioxygenase (IDO) and/or tryptophan-2,3-dioxygenase (TDO) enzymes: (I). Also disclosed herein are uses of the compounds in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder. Also disclosed herein are compositions comprising these compounds. Further disclosed herein are uses of the compositions in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder.
US11096928B2

The present invention relates to a pharmaceutical composition comprising: (a) at least one neutral endopeptidase inhibitor or a pharmaceutically acceptable salt or ester thereof, (b) at least one compound represented by formula (I) or a pharmaceutically acceptable salt or ester thereof, and a pharmaceutically acceptable carrier. Combined administration showed better medicinal effects than separate administration.
US11096916B2

The invention concerns the use of a nicotinic acetylcholine receptor alpha 7 activators for the treatment, prevention or delay of progression of dyskinesia associated with dopamine agonist therapy in Parkinson's Disease.
US11096915B2

Described is a method for the preparation of an oral levothyroxine composition, comprising the steps of combining levothyroxine or a salt thereof, a water-miscible organic solvent or a sugar alcohol and water, adjusting the pH to at least 8 providing a basic aqueous medium, dissolving the levothyroxine in the basic aqueous medium to yield a levothyroxine solution, and lowering the pH of the levothyroxine solution to between 3.5-4.9. also described is an oral levothyroxine composition obtainable by the said method and its use as a medicament.
US11096900B2

A nanocarrier including a silica body having a surface and defining a plurality of pores that are suitable to receive molecules therein is described. The nanocarrier also includes a lipid bilayer coating the surface, and a cargo-trapping agent within the phospholipid bilayer. The phospholipid bilayer stably seals the plurality of pores. The cargo-trapping reagent can be selected to interact with a desired cargo, such as a drug.
US11096899B2

Provided herein are nanoparticles comprising a polyplex core comprising one or more pH-responsive polymers and one or more anionic immune adjuvants, wherein each pH-responsive polymer comprises ionizable amine groups; and a shell of bacterial cell membrane components at least partially coating the polyplex core, wherein the bacterial cell membrane components comprise TLR 2 and/or TLR 4 agonists. Also provided are methods of stimulating an immune response in a mammal using the nanoparticle.
US11096898B2

A membrane including a barrier having layers of alginate with different material molar concentrations relative to another material. The layers have a uniform consistency across a thickness of the layers. The thickness is free of laminae and interfaces and forms a single layer morphology that provides permeability for selected molecules.
US11096897B2

The present invention relates to an edible composition having a lipid continuous phase and self-assembled structures, the composition comprising oil, phospholipids, caffeine and water. Further aspects of the invention are the use of a composition to provide controlled release of caffeine, a composition for use in the treatment or prevention of drowsiness, the non-therapeutic use of a composition to increase mental alertness, and an edible capsule.
US11096893B2

Disclosed herein are glucose-sensitive drug delivery systems including polymeric shell encapsulating an active agent. Upon exposure to a sufficient concentration of glucose, the shell is ruptured, releasing the active agent for absorption.
US11096891B2

A composition and method for the administration of therapeutic and/or diagnostic agents is provided. Specifically, a hybrid system, composed of polymer that harbors drug-loaded lipid nanoparticles, and use thereof for the administration of active agents e.g., anti-cancer agents, is provided.
US11096883B2

Provided is a composition including: an acrylamide compound represented by general formula (1) in 20% by mass or greater but 50% by mass or less; a multifunctional monomer in 40% by mass or greater but 70% by mass or less; and a polymerization initiator, where in general formula (1), R1 represents alkyl group containing 1 through 6 carbon atoms, X represents alkylene group containing 1 through 6 carbon atoms, and Y represents any one selected from the group consisting of general formula (2) below and general formula (3) below, where in general formula (2), R2 represents alkyl group containing 1 through 10 carbon atoms, and * represents binding site with X above, where in general formula (3), R2 represents alkyl group containing 1 through 10 carbon atoms, and * represents binding site with X above.
US11096882B2

The present disclosure relates to anhydrous cosmetic compositions which contain a combination of a strongly swelling and a low-swelling water-absorbing component, an odor-absorbing component and a deodorant active ingredient. These compositions have an outstanding deodorizing effect and improved sensory features and additionally result in a minimization of sweat spots on textiles. Furthermore, the present disclosure relates to a cosmetic product containing these anhydrous compositions and the use of this composition or product for reduction of the body odor released by perspiration. Finally, the present disclosure relates to the use a strongly swelling water-absorbing component in combination with an odor-absorbing component to improve the sensory characteristics of anhydrous deodorant compositions.
US11096878B2

The present disclosure relates to a concentrated rinse-off cleansing composition that includes a high concentration of surfactants and conditioning agent(s). For example, the cleansing compositions may include: (a) surfactants system comprising: (i) one or more anionic surfactants selected from: (i-a) alkyl sulfates; alkyl ether sulfates, salts thereof, or a mixture thereof; and (i-b) optionally, one or more non-sulfate anionic surfactants; (ii) one or more alkyl polyglucosides; and (iii) one or more amphoteric surfactants; (b) one or more conditioning agents; and (c) water. The cleansing compositions are particularly useful for cleansing hair.
US11096876B2

A dentifrice composition containing water, a calcium-containing abrasive, a sodium monofluorophosphate, and an alkaline metal fluoride were the composition has a high fluoride uptake.
US11096863B2

An object is to provide a port that is capable of securely preventing pulling-out of a sealing plug from a port body. Provided is a port including: a sealing plug through which a hollow needle can be pierced; a port body having a hollow structure with the sealing plug disposed therein; and a pulling-out preventing member to be attached to the port body. The port body includes: a part to be sealed that has a tubular shape with a first end and a second end opposite to the first end, and is configured so that the sealing plug is sealingly inserted into the part to be sealed; a connection part that has a tubular shape, is continuous with the first end of the part to be sealed, and has an outer periphery connected to the bag body to be filled with a medical liquid; and a part to be fitted that is formed in any one of an inner peripheral surface of the part to be sealed, an outer peripheral surface of the part to be sealed, and the second end of the part to be sealed. The pulling-out preventing member includes: a body part that has a first surface directed toward the first end of the part to be sealed within the part to be sealed; a restriction part that is formed on the first surface of the body part and restricts movement of the sealing plug toward the second end of the part to be sealed; and a fitting part that comes into fitting engagement with the part to be fitted of the port body.
US11096857B2

An assistance apparatus includes a first wire and a second wire that couple an upper-body belt and a left knee belt to each other on or above a front part and back part of the body of a user, respectively, a third wire and a fourth wire that couple the upper-body belt and a right knee belt to each other on or above the front part and back part of the body of the user, respectively, a motor, a left sensor on the left hand of the user, and a right sensor on the right hand of the user. When a left sensor value of the left sensor is larger than a right sensor value of the right sensor, the tension of the first wire and the second wire is made greater than the tension of the third wire and the fourth wire. When the right sensor value is larger than the left sensor value, the tension of the third wire and the fourth wire is made greater than the tension of the first wire and the second wire.
US11096854B2

A system and method by which movements desired by a user of a lower extremity orthotic is determined and a control system automatically regulates the sequential operation of powered lower extremity orthotic components to enable the user, having mobility disorders, to walk, as well as perform other common mobility tasks which involve leg movements, perhaps with the use of a gait aid.
US11096842B2

Extended fingerlifts and their use in closure assemblies typically provided in absorbent articles such as diapers are described.
US11096841B2

A woodpulp-free urine pad includes from top to bottom a top sheet, a perforated film layer, a core layer and a bottom layer, wherein the perforated film layer is made by perforating the surface of the waterproof material, the core layer comprises an upper adhesive layer, a lower adhesive layer and a water accepting layer which is mad of SAP polymeric particle between the upper and lower adhesive layers. The utility model has a strong ability to prevent liquid infiltration, and it removes away the wood pulp in the core layer to save a large amount of wood and to protect the environment. A production equipment for producing the woodpulp-free urine pad includes a feeding channel which is composed of a plurality of back-up rolls, follow the direction of forward motion of the feeding channel, there is sequentially provided with a material shelf of lower adhesive layers, an adding mechanism of water accepting layers, a material shelf of upper adhesive layers, a material shelf of bottom layers, a material shelf of top sheet and a cutting table, in order to facilitate the production of the woodpulp-free urine pad.
US11096833B2

The present disclosure relates to methods and apparatuses for printing and drying inks on substrates. Printing systems may include a metering device positioned between a printing station and a light source. During operation, the printing station deposits ink onto a substrate to define a printed region. And the light source directs infrared light onto the substrate to define an illumination zone. The printed region is advanced from the printing station to the metering device and from the metering device through the illumination zone, wherein the ink is dried with infrared light traveling from the light source, which also heats the substrate and changes the modulus of elasticity of the substrate. In turn, the metering device isolates the printing station from the change in the modulus of elasticity to help reduce phase shifts caused by changes in the modulus of elasticity resulting from heat in the substrate.
US11096829B2

Systems, methods, and apparatuses for generating and releasing iodine are described. Some embodiments may include a dressing member including a plurality of iodine-forming reagents and a water-swellable material. In some embodiments, the dressing member may include water-swellable fibers. The water-swellable fibers may each include a water-swellable material in which iodine-forming reagents are dispersed. As liquid comes into contact with and is absorbed by the water-swellable material, the iodine-forming reagents may come into contact with each other, causing an iodine-forming reaction to occur, producing iodine.
US11096822B2

Injection device comprising an elongated body (1) with a hollow needle (8) at a distal end; a reservoir for an injection material to be delivered through the needle; a plunger (3) with a first force element (5) configured to provide an injection force to said injection material, and a distal element (10) attached to the distal end of the device thereby sealing a needle lumen, wherein the distal element comprises a tissue interface and a distal seal (11), and wherein the distal seal is penetrable by a distal tip of the needle by the application of pressure on a tissue surface with the distal end of the device, wherein the penetrated distal element becomes slidable on the needle to allow advancement of the needle into tissue, wherein the penetrated distal seal opens a path for flow or delivery of the injection material from the distal end of the needle.
US11096820B2

Systems and methods are provided for treating snoring or sleep apnea of a patient that include an implantable device and a retainer. The device includes an elongate filament sized for introduction into or through a patient's tongue and including a distal end and a proximal end, a connection member on the proximal end, and one or more securing elements on or adjacent the distal end. The retainer includes a body configured to be removably engaged with one or more teeth within a patient's mouth, and a connector port for removably engaging the connection member to support the patient's tongue relative to the retainer.
US11096817B2

Various embodiments are directed to a therapy tape configured to enable a tensile force to be applied to one or more surfaces (e.g., a patient's skin). In various embodiments, the therapy tape may comprise a backing layer having a top surface and a bottom surface. An adhesive layer configured to secure the therapy tape to a surface may be secured relative to the bottom surface of the backing layer. Moreover, one or more handles may be secured to the top side of the backing layer. The one or more handles may be configured to enable a tensile force to be applied to the therapy tape and the surface to lift a portion of the surface while maintaining adherence between the therapy tape and the surface.
US11096816B2

An orthopedic device, first and second struts, and a range-of-motion limiting pivot assembly connecting to the first and second struts. The pivoting assembly having an engagement member linked to a tab disposed and arranged for pulling radially outward away from a central axis of the pivoting assembly for adjusting the range of motion of the pivoting assembly.
US11096808B2

Biodegradable self-expanding polymer stent has an outer diameter of 0.25-40 mm, length of 5-250 mm, and closed-cell wall structure formed by struts, where ratio of inner diameter values before crimping and after crimping is in a range of 3 to 5, and made of a copolymer obtained from L-lactide, D-lactide, D,L-lactide, meso-lactide, glycolide, ε-caprolactone, trimethylene carbonate, p-dioxanone and compounds comprising functional groups capable of photopolymerization; supramolecular structure of the copolymer is oriented substantially circularly in a transversal cross section of the stent. Method of manufacturing includes extruding a tube of a polymer material; annealing the extruded polymer tube; laser cutting the extruded polymer tube to form a stent workpiece; heating the stent to above glass transition temperature of the polymer, crimping the stent workpiece uniformly over the entire outer surface thereof, and quenching at about minus 20 degrees Celsius; placing the quenched stent on a delivery means.
US11096807B2

A medical instrument is disclosed having a structure capable of preventing liquid circulation between an inner layer side and an outer layer side of a peripheral wall portion. The medical instrument includes a main body portion in which a center hole and a radially outward space are partitioned by a tubular peripheral wall portion. The peripheral wall portion includes at least a first layer on which a hydrophilic member, in which a hydrophilic coating is formed on a first base portion, is disposed and a second layer on which a hydrophobic member, in which a hydrophobic coating is formed on a second base portion, is disposed. The peripheral wall portion is configured by the first layer and the second layer being stacked along a radial direction. As a result of swelling of the hydrophilic coating, the adjacent hydrophilic members come into contact with each other.
US11096806B2

The present invention relates to an endoluminal device for implantation in a body lumen, such as a pancreatic duct. The device is provided with a distal end region having greater flexibility than that of a medial region of the device.
US11096805B2

A liner for a prosthesis, wherein the liner is made of a liner material and comprises a proximal opening for accommodating an amputation stump, a distal end, a longitudinal direction, which extends from the proximal opening to the distal end, and an auxetic material The auxetic material is a two-dimensional-auxetic material, which is arranged in such a way that an extension of the liner in the longitudinal direction leads to an expansion of a diameter of the liner.
US11096801B2

An orthopaedic surgical system includes a sensor module for determining the joint force of a patient's knee joint and an adaptor for coupling various tibial trialing components to the sensor module. The sensor module includes a tibial paddle to which the adaptor is configured to couple. The adaptor and tibial paddle include structures that control the orientation at which the adaptor is attachable to the tibial paddle. Some tibial trialing components may be positioned over the adaptor in a mobile orientation that facilities rotation of the tibial trialing component relative to the tibial paddle or a fixed orientation that restricts the rotation of the tibial trialing component.
US11096794B2

An orthopedic device for implanting between adjacent vertebrae comprising: an arcuate balloon and a hardenable material within said balloon. In some embodiments, the balloon has a footprint that substantially corresponds to a perimeter of a vertebral endplate. An inflatable device is inserted through a cannula into an intervertebral space and oriented so that, upon expansion, a natural angle between vertebrae will be at least partially restored. At least one component selected from the group consisting of a load-bearing component and an osteobiologic component is directed into the inflatable device through a fluid communication means.
US11096793B2

A calcaneal prosthesis system includes a body having a dorsal surface, a plantar surface, an anterior surface, and a posterior end. The posterior end has a tuberosity. The anterior surface has at least a concavity or convexity shaped for receiving a cuboid bone or mid-foot bone. The dorsal surface includes a convex or concave surface for engaging a talus bone or distal tibia. The body has a first previously formed surface defining a hole extending through the body for receiving an intramedullary (IM) nail. The hole extends from the plantar surface of the body to the dorsal surface.
US11096773B2

A method of promoting lung disinsufflation including inserting a catheter into a bronchial passage of a patient's lung. The catheter contains an implantable artificial bronchus compressed within the catheter. The method further includes using the catheter to position the implantable artificial bronchus in the bronchial passage such that the implantable artificial bronchus extends across openings of a plurality of other bronchial passages and withdrawing the catheter from the bronchial passage to cause the implantable artificial bronchus to naturally expand and remain in the bronchial passage. The implantable artificial bronchus is configured to promote enlargement of the bronchial passage and allow air to exit from the plurality of other bronchial passages and into the implantable artificial bronchus through one or more of the plurality of side openings.
US11096772B1

A structure of aligned (e.g., radially and/or polygonally aligned) fibers, and systems and methods for producing and using the same. One or more structures provided may be created using an apparatus that includes one or more first electrodes that define an area and/or partially circumscribe an area. For example, a single first electrode may enclose the area, or a plurality of first electrode(s) may be positioned on at least a portion of the perimeter of the area. A second electrode is positioned within the area. Electrodes with rounded (e.g., convex) surfaces may be arranged in an array, and a fibrous structure created using such electrodes may include an array of wells at positions corresponding to the positions of the electrodes.
US11096770B2

The invention provides compositions and methods for whitening teeth of a subject comprising administering one or more isolated, non-pathogenic, hydrogen peroxide-producing bacterial strains to an oral cavity of a subject.
US11096769B1

A specialized battery powered device that has a rotating sponge tip that can dispense mouthwash on demand while in use. The sponge tip can be rotated by a battery-powered motor at different RPM. The present invention also includes a step-by-step process for using the device and achieving an extremely clean mouth.
US11096762B2

A system for planning and performing a guided and free-handed transperineal prostate biopsy includes a transrectal ultrasound probe, an access needle configured to perforate a perineal access site of a patient, a biopsy gun, and a guide. The guide includes a sliding platform, stabilization bars, upper and lower mounts, and fasteners. The system and guide apparatus is used for locating a target area using the ultrasound probe, positioning the ultrasound and the access needle at respective designated points, precisely measuring the distance to a designated point, and obtaining specimens from a precise point in the prostate, wherein the method is performed free-handed, and multiple tissue or cell specimens may be obtained from the prostate through an initial access needle.
US11096761B2

Needles are deployed in tissue under direct ultrasonic or other imaging. To aid in deploying the needle, a visual needle guide is projected on to the image prior to needle deployment. Once the needle guide is properly aligned, the needle can be deployed. After needle deployment, a safety boundary and treatment region are projected on to the screen. After confirming that the safety boundary and treatment regions are sufficient, the patient can be treated using the needle.
US11096757B2

An implantable medical lead may include an electrode at a distal portion of the lead that is configured to monitor or provide therapy to a target site. The lead may include a visible indicator that is visible to the naked eye of a clinician at a medial portion of the lead that is configured to indicate when the electrodes of the lead are longitudinally and radially aligned properly to monitor or treat the target site. A clinician may insert the lead into the patient using an introducer sheath inserted to a predetermined depth into the patient and subsequently aligning the distal portion of the lead by orienting the indicator at an entry port of the introducer sheath.
US11096756B2

A medical drape has a tool-less removal feature and includes a drape material, a drape cut, an adhesive tape strip, and a scoreline. The drape material has a top side, a back side, and at least one exterior edge. The drape cut has a starting point at the exterior edge and extends completely through the thickness of the drape material. The adhesive tape strip is positioned along the length of the drape cut to overlap at least a portion of the drape material on both sides of the drape cut to initially secure the two adjoining cut edges to each other. The scoreline extends along the length of the adhesive tape strip and only partially through the thickness of the adhesive tape strip to permit easy tearing of the adhesive tape strip for separation of the two adjoining cut edges.
US11096743B2

A laser system for use in an environment is disclosed. The laser system may include a base unit including a laser, a controller operatively coupled to the laser, and a first antenna operatively coupled to the controller. The laser system may further include a laser energy delivery system having a first end which receives laser energy from the laser and a second end which delivers the laser energy to the environment. The laser system may further include a switch unit located remote from the base unit and including a switch controller, a second antenna operatively coupled to the switch controller, and a user operable switch. The switch unit may be connected to the base unit through a tether. The controller may determine when the laser energy is provided to the laser energy delivery system based on a signal from the switch unit, the signal being sent wirelessly to the controller from the second antenna of the switch unit to the first antenna of the base unit.
US11096737B2

A dual-output generator is configured to output two or more waveforms at different frequencies. In particular, the dual-output generator is configured to provide low-frequency output, which may be suitable for ultrasonic surgical instruments, and a high-frequency output, which may be suitable for electrosurgical instruments, while reducing the amplitude of all remaining frequencies other than the two selected low and high frequencies to about zero.
US11096736B2

A catheter adapted for use in the pericardial sac to sense temperature of an ablation site and surrounding heart tissue within one of the heart's ventricles or atria via proximity with the epicardium in the pericardial sac, includes a catheter body and a temperature sensing array adapted for placement on and contact with the epicardium. The temperature sensing array may comprise a 2-D body, with a surface adapted to contact an area on the epicardial tissue or in pericardial space. The array may also comprise at least one finger member, each having at least one temperature sensing location. The array may further comprise an elongated body having a generally circular configuration, a distal portion of which is movable to a spirally inward position.
US11096735B2

A surgical instrument for implanting a bone fastener is provided. The surgical instrument comprises an elongated body having a frangible region and a distal end adjacent to the frangible region. The distal end of the surgical instrument is configured to engage the bone fastener. The bone fastener is less frangible than the frangible region of the elongated body of the surgical instrument. Kits and methods are also disclosed.
US11096726B2

A multi-layer, fiber-reinforced composite orthopaedic fixation device having a design selected based on a desired characteristic of the orthopaedic fixation device. The design may be selected according to a model of the device, the model defining design constraints, and the design may comprise a pattern of the fiber angle for each layer. The selection of a design may be analyzed using finite element analysis to determine whether the design will comprise the desired characteristic.
US11096724B2

The present application provides a tool for minimally invasive surgical procedures. The tool includes a first and second portion where each portion has an outer blade and an inner blade that is slidable along the outer blade. A removable connector connects the first and second portions. When removed, the first and second portions are separated by a gap extending the length of the tool.
US11096720B2

This disclosure relates to a cannula for a surgical instrument used for cutting selected tissue in a body cavity while under visual inspection. A kit containing the cannula and methods for performing surgical procedures using the cannula are also described.
US11096719B2

An improved transparent bladeless obturator includes a proximal handle, a distal-end portion and a shaft therebetween, the handle and the shaft including a generally-aligned axis aperture, the distal-end portion including a transparent tip, from the distal end to the proximal end, the transparent tip divided into a top-portion, a spear-portion, a transition-portion and a base-portion; the top-portion includes an apex and a rotary-wall extending axially from the apex to the proximal end and gradually increasing in a transverse direction, the rotary-wall limiting a hollow cone; the main-portion including a main-body wall, the rotary-wall and the main-body wall extend to be intersected and form a circular field of vision; the sweeping-wall extends axially from the distal end to the proximal end and gradually increases in a transverse direction; and the spear-portion includes the first transverse-portion and the second transverse-portion.
US11096714B2

An endoscopic treatment tool comprises an elongated sheath and an elongated portion configured to be inserted in the elongated sheath and capable of being movable back and forth in directions. A loop portion is disposed on a distal end of the elongated portion and is constructed of a wire folded to form into a loop. The loop portion includes a first bent portion, a pair of second bent portions, a pair of third bent portions, and a fourth bent portion all of which are integrally formed from a distal end toward a proximal end of the loop portion. A first length that represents a length from the first bent portion to the fourth bent portion in the directions along the longitudinal axis ranges from one and half times to two times a first width that represents a maximum dimension of the loop portion in directions perpendicular to the longitudinal axis.
US11096707B2

Certain embodiments provide a surgical instrument comprising surgical instrument comprising an device having a functional end and a main handle comprising a distal end coupled to the device. The surgical instrument further comprises an actuation handle insert comprising a number of first rolling components and an actuation tube coupled to the actuation handle insert, wherein the functional end of the device at least partially extends outside of the actuation tube when the device is deactivated. The surgical instrument further comprises levers comprising second rolling components. The surgical instrument further comprises a plurality of rolling elements, wherein each of the rolling elements is placed between one of the second rolling components and one of the first rolling components and pressing one or more of the levers pushes the actuation handle insert forward relative to the device, causing the actuation tube to transition the device from the deactivated state to an activated state.
US11096706B2

The present invention relates to a reflector for an acoustic shock or pressure wave head, wherein the reflector comprises an acoustically reflective surface formed by a body of rotation, said body of rotation being formed by rotation of an elliptical segment about a rotation axis which extends through a focal point of the ellipse and encloses an angle α between 0.1° and 30° with the main axis of the ellipse.
US11096705B2

A medical device to be inserted into a blood vessel for effectively removing an object flowing in a biological lumen while reducing the burden on the living body includes an elongated shaft portion, and an expansion portion which is an elastically deformable cylindrical body having a plurality of gaps and in which a proximal portion or a distal portion of the cylindrical body is interlocked with the shaft portion. The expansion portion has a ring-shaped or annular bent portion which protrudes toward a proximal side position radially outside the expansion portion in a bent state of being bent along an axial direction, and an axial length of a second portion from the bent portion to a proximal end of the expansion portion is shorter than an axial length of a first portion from the bent portion to the distal end of the expansion portion.
US11096691B2

A tissue gripping device is formed from a shape-memory material, and has a base section, a first arm, and a second arm disposed opposite the first arm, each arm having a first end coupled to the base section and a free end extending from the base section. The arms of the tissue gripping device are configured to resiliently flex toward a relaxed configuration in a distal direction as the tissue gripping device is moved from a pre-deployed configuration toward a deployed configuration. The tissue gripping device is usable in a method for gripping tissue. The method includes positioning the tissue gripping device near target tissue and moving the tissue gripping device from a pre-deployed configuration toward a deployed configuration in order to grip the target tissue.
US11096687B2

A surgical stapler system may include a surgical instrument comprising an end effector configured to receive a removable staple cartridge, and an actuation mechanism operably coupled to actuate the end effector to perform a stapling procedure. The surgical stapler system also may include a drive system operably coupled to transmit an actuation force to the actuation mechanism and a controller operably coupled to the drive system. The controller may be configured to measure an actuation force transmitted by the drive system to the actuation mechanism, and control continued transmission of the actuation force based on a comparison of the measured actuation force to a range defined from a minimum threshold actuation force to a maximum threshold actuation force.
US11096685B2

A surgical apparatus comprises a surgical staple for treating tissues of a patient in a surgical procedure. The surgical staple is deformable from a first configuration (e.g., an un-deployed configuration) to a second configuration (e.g., a deployed configuration) in accordance with embodiments of the present invention. The surgical staple includes a first leg and a second leg, wherein said surgical staple substantially resembles a V-shape or a suture needle in the first configuration and substantially forms a D-shape in the second configuration in accordance with embodiments of the present invention.
US11096678B2

The present disclosure relates to the field of endoscopy. Specifically, the present disclosure relates to systems and methods for real-time visualization and sampling of target tissue within body passages. In particular, the present disclosure relates to a system that provides real-time visualization of eccentric pulmonary nodules, and which allows the location/orientation of a biopsy needle to be determined prior to its first actuation.
US11096669B2

An ultrasound diagnostic apparatus includes a transmitter, a receiver and a hardware processor. The transmitter outputs a drive signal for a C-mode image to an ultrasound probe. The receiver obtains a reception signal from the probe. The processor sets at least one mask in a frame of packet data of the reception signal; calculates a covariance matrix from a plurality of packet data included in the mask; calculates an eigenvector for the mask from the covariance matrix; calculates a first filter coefficient for the packet data by using the eigenvector and a gain matrix; performs interpolation on the first filter coefficient to calculate a second filter coefficient for packet data of each position in the frame; filters the packet data of the position by using the second filter coefficient; and generates C-mode image data from the filtered packet data.
US11096667B2

A method of controlling an ultrasound imaging apparatus includes setting a region of interest on a contrast-enhanced image or an ultrasound image that is registered and displayed; obtaining feature information of the contrast-enhanced image or the ultrasound image from the set region of interest; detecting at least one region, in which feature information similar to the feature information of the region of interest is obtained; and displaying the at least one region that is detected.
US11096661B2

Techniques, systems, and devices are disclosed for synthetic aperture ultrasound imaging using spread-spectrum, wide instantaneous band, coherent, coded waveforms. In one aspect, a method includes synthesizing a composite waveform formed of a plurality of individual orthogonal coded waveforms that are mutually orthogonal to each other, correspond to different frequency bands and including a unique frequency with a corresponding phase; transmitting an acoustic wave based on the composite waveform toward a target from one or more transmitting positions; and receiving at one or more receiving positions acoustic energy returned from at least part of the target corresponding to the transmitted acoustic waveforms, in which the transmitting and receiving positions each include one or both of spatial positions of an array of transducer elements relative to the target and beam phase center positions of the array, and the transmitted acoustic waveforms and the returned acoustic waveforms produce an enlarged effective aperture.
US11096657B2

A laser light source transmits laser light to a tip of an interventional instrument such as a needle via an optical fiber. The laser light is absorbed at the distal tip of the instrument and generates a photoacoustic signal. The laser light source is configured to receive a trigger signal from an ultrasound machine when a laser pulse is to be produced. The light source signals the ultrasound machine when an optical connector is connected to the laser light source to automatically begin a needle tip (NTV) visualization mode. If the optical connector is removed from the laser light source, the laser light source stops producing laser light pulses.
US11096654B2

Devices, systems, and methods of the present disclosure are directed to accurate and non-invasive assessments of anatomic vessels (e.g., the internal jugular vein (IJV)) of vertebrates. For example, a piezoelectric crystal may generate a signal and receive a pulse echo of the signal along an axis extending through the piezoelectric crystal and an anatomic vessel. A force sensor disposed relative to the piezoelectric crystal may measure a force exerted (e.g., along skin of the vertebrate) on the anatomic vessel along the axis. The pulse echo received by the piezoelectric crystal and the force measured by the force sensor may, in combination, non-invasively and accurately determine a force response of the anatomic vessel. In turn, the force response may be probative of any one or more of a variety of different characteristics of the anatomic vessel including, for example, location of the anatomic vessel and pressure of the anatomic vessel.
US11096651B2

Methods and systems are provided for calibrating a nuclear medicine imaging system having more than 5 detector heads. In one embodiment, a method includes obtaining residual center of gravity determinations corresponding to each of a plurality of detector units based on point source projections acquired over a series of detector unit rotational steps, obtaining center of gravity determinations for each of the plurality of detector units based on point source projections acquired over a series of detector unit sweep angles, obtaining a fit of the center of gravity determinations for each of the plurality of detector units, and determining a sweep offset for each of the plurality of detector units based on the residual center of gravity determinations and the fit of the center of gravity determinations for each of the plurality of detector units. In this way, a sweep axis zero degree position for each of the plurality of detector units is determined.
US11096650B2

A subject support includes a fixed portion and a moveable portion coupled to the fixed portion and configured to move along at least one axis relative to the fixed portion, and the coupling includes one or more points of friction that move during movement of the moveable portion and which wear due to at least movement by the moveable portion. The moveable portion receives and supports at least one of an object or a subject during an imaging procedure with an imaging device. One or more inertial measurement units (IMUs) are affixed to or embedded in the moveable portion that directly measure acceleration of translation of the moveable portion along one or more axes.
US11096635B2

A system for controlling a motorised component of radiological equipment using a device with a control lever having a first end constrained to a base manoeuvred by gripping a handle with a hand. First and second electric sensors are associated with a grip of the control lever. The first electric sensor is located at a first point of the grip and adapted to detect the presence of a finger. The second electric sensor is located at a second point of the handle of the control lever and adapted to detect the presence of a finger at the second point. Another electric sensor is for detecting the positioning of the control lever with respect to the base. An electronic unit is connected to the electric sensors for causing movement as a function of the positioning of the control lever only if the first and/or second electric sensors detect a presence.
US11096627B2

An examination system having separate enabled interchangeable operating modes includes at least one medical device having a housing retaining an optical system. The examination system further includes an adapter that is configured for aligning a plurality of disparate smart devices with the optical system of the medical device when the adapter is attached to the medical device, thereby enabling multiple operating modes without modification to the device. In at least one version, common engagement features are provided on a plurality of medical devices to permit the adapter and an attached smart device to be used therewith interchangeably.
US11096622B2

Concepts and technologies are disclosed herein for measuring user exertion via bone conduction. According to one aspect, a device can generate a measurement signal. The device can cause a transducer to transmit the measurement signal through a body of a user. The device can receive, via the transducer, a modified measurement signal. The modified measurement signal can include the measurement signal as modified by the body of the user. The device can compare the modified measurement signal to a modified baseline signal. The device can determine, based on a result of comparing the modified measurement signal to the modified baseline signal, a level of exertion experienced by the user while the measurement signal was transmitted through the body of the user.
US11096621B2

A method and system for detecting the presence of BRCS carriers in breast tissue, comprises obtaining spectral data from breast tissue using a magnetic resonance spectroscopy device and producing spectral data by said device which provides chemical markers to enable detection of whether the breast tissue contains BRCA carriers.
US11096620B1

An optical measurement system includes a wearable module assembly configured to be worn on a body of a user. The wearable module assembly includes a plurality of wearable modules and a connecting assembly. Each wearable module includes a light source configured to emit a light pulse toward a target within the body of the user and a plurality of detectors configured to receive photons included in the light pulse after the photons are scattered by the target. The connecting assembly physically and flexibly connects the plurality of wearable modules such that the wearable module assembly is conformable to a three-dimensional (3D) surface of the body of the user when the wearable module assembly is worn on the body of the user.
US11096619B2

A neural analysis and treatment system includes a computing device with a memory for storing an application that is executable on a processor to receive amplitude-integrated electroencephalography (aEEG) and range-EEG (rEEG) measurements associated with a patient. The systems determine a spectral edge frequency (SEF) measurement from the received EEG measurements, and determine one or more neural characteristics of the patient according to the determined SEF, aEEG, and rEEG measurements. These neural characteristics may then be used to identify and implement an appropriate therapeutic treatment.
US11096614B2

A method for providing a neural interface system. At least one primary metallization layer is deposited on a substrate. The primary metallization layer has a thickness. A monolayer of nanospheres is deposited in a substantially uniform distribution. The nanospheres contact an upper surface of the primary metallization layer. The upper surface of the primary metallization layer not contacted by the nanospheres is treated to form a plurality of undulating structures having a substantially uniform arrangement. The treating comprises etching recesses part-way through the thickness of exposed portions of the primary metallization layer from the upper surface thereof.
US11096611B2

A method providing a signal quality degree associated with an analyte value measured in a continuous monitoring system is disclosed. The method includes: receiving a measured analyte value from a biosensor; determining at least two impact parameters, wherein each of the impact parameters is influenced by an operational status of the continuous monitoring system and wherein each of the impact parameters is capable of exerting an influence on the signal quality of the biosensor and wherein the influence of each of the impact parameters on the signal quality of the biosensor is expressed by a weight assigned to each of the impact parameters; and determining the signal quality degree associated with the measured analyte value as a function of the weights and the corresponding impact parameters; and providing the signal quality degree associated with the analyte value. A method of calibration using the signal quality degree is also disclosed.
US11096610B2

A monitoring system includes a surgical implant configured for implantation in vivo and having at least one sensing fiber configured to measure a preselected physiological parameter, and a receiving unit in wireless communication with the at least one sensing fiber and configured to receive measurements of the preselected physiological parameter. A surgical system includes an end effector having a plurality of fasteners, and a surgical implant securable to tissue via the plurality of fasteners. The surgical implant includes at least one sensing fiber configured to measure a preselected physiological parameter.
US11096598B2

A system for measuring central venous pressure is provided comprising a device for measuring jugular venous pressure in communication with a patient inclination controller via a processing unit.
US11096596B2

The invention provides a body-worn monitor featuring a processing system that receives a digital data stream from an ECG system. A cable houses the ECG system at one terminal end, and plugs into the processing system, which is worn on the patient's wrist like a conventional wristwatch. The ECG system features: i) a connecting portion connected to multiple electrodes worn by the patient; ii) a differential amplifier that receives electrical signals from each electrode and process them to generate an analog ECG waveform; iii) an analog-to-digital converter that converts the analog ECG waveform into a digital ECG waveform; and iv) a transceiver that transmits a digital data stream representing the digital ECG waveform (or information calculated from the waveform) through the cable and to the processing system. Different ECG systems, typically featuring three, five, or twelve electrodes, can be interchanged with one another.
US11096592B2

A sensor module includes a light emitter that emits light beams including near-infrared light beams towards a subject; a light receiver that receives light beams having passed through the subject; and a controller that estimates biological information based on signals output from the light receiver. The light emitter includes a plurality of light emitting elements that emit near-infrared light beams having central wavelengths different from each other. The light emitter produces sets of light emissions by causing the plurality of light emitting elements to sequentially and intermittently emit the near-infrared light beams. In given two consecutive sets of light emissions produced by the light emitter, a second non-light-emission period of time T4 is longer than a first non-light-emission period of time T2. The controller estimates the biological information in a processing period of time T41 that is set in correspondence with the second non-light-emission period of time T4.
US11096590B2

The invention provides a body-worn patch sensor for simultaneously measuring a blood pressure (BP), pulse oximetry (SpO2), and other vital signs and hemodynamic parameters from a patient. The patch sensor features a sensing portion having a flexible housing that is worn entirely on the patient's chest and encloses a battery, wireless transmitter, and all the sensor's sensing and electronic components. It measures electrocardiogram (ECG), impedance plethysmogram (IPG), photoplethysmogram (PPG), and phonocardiogram (PCG) waveforms, and collectively processes these to determine the vital signs and hemodynamic parameters. The sensor that measures PPG waveforms also includes a heating element to increase perfusion of tissue on the chest.
US11096573B1

A mobile communication device-based corneal topography system includes an illumination system, an imaging system, a topography processor, an image sensor, and a mobile communication device. The illumination system is configured to generate an illumination pattern reflected off a cornea of a subject. The imaging system is coupled to an image sensor to capture an image of the reflected illumination pattern. A topography processor is coupled to the image sensor to process the image of the reflected illumination pattern. The mobile communications device includes a display, the mobile communications device is operatively coupled to the image sensor. The mobile communications device includes a mobile communications device (MCD) processor. A housing at least partially encloses one or more of the illumination system, the imaging system, or the topography processor.
US11096572B2

The disclosed technology is directed to placing two galvanometer mirrors in a pupil conjugate relationship and at the same time preventing astigmatism from occurring while preventing images from being degraded by flaws and foreign matter on a lens. A scanning optical system includes two one-dimensional scanning means disposed closely to each other at a spaced interval therebetween in an optical axis direction for scanning a light beam from a light source in two scanning directions. An objective lens for focusing the light beam scanned by the scanning means onto a target. A plurality of optical elements is disposed in positions spaced from an intermediate image plane in the optical axis direction and having different optical powers in the two scanning directions. The positions and the optical powers of the respective optical elements are set to compensate for the spaced interval between the two scanning means in the optical axis direction.
US11096568B2

According to an aspect, a medical device includes an elongate member having a sidewall. The sidewall defines a lumen. The lumen has a non-circular cross-sectional shape.
US11096567B2

An endoscope system includes an endoscope having an insertion portion. The endoscope is attached to the proximal end of the insertion portion. An image capturing module is attached to the distal-end portion of an insertion portion. The image capturing module includes a wiring board having a principal surface including first electrodes and second electrodes disposed thereon. An image capturing element includes respective photodetection and reverse surfaces. The reverse surface includes external electrodes and is connected to the first electrodes on the wiring board. A prism having an entrance surface to which light is applied, a reflection surface, and an exit surface in which the exit surface being bonded to the photodetection surface of the image capturing element. A support member is used to support the prism. A layered element including a plurality of elements is layered together and having an upper surface, a lower surface with element electrodes disposed thereon.
US11096563B2

A method for determining a shape of a bendable instrument can include placing the bendable instrument in a neutral position; moving a first control element a first amount until slack is removed from the first control element; moving a second control element a second amount until slack is removed from the second control element; sensing a position of the first control element after moving the first control element the first amount, the sensed position of the first control element being defined as a first control element calibration position; sensing a position of the second control element after moving the second control element the second amount, the sensed position of the second control element being defined as a second control element calibration position. The method can further include bending the instrument by moving one or both of the first control element and the second control element from the respective first control element calibration position and the second control element calibration position; and determining a resulting shape of the bendable instrument based on a distance one or both of the first control element and the second control element respectively moved from the first control element calibration position and second control element calibration.
US11096557B2

An endoscope assembly comprising a handle incorporating a liquid reservoir and injection system, a flexible or rigid cannula attaching to the handle, and a distally attached miniature imaging head. The imaging head is a transparent tubular shaped body having an essentially closed proximal end, and a tubular wall extending from the closed proximal end to the distal open end of the body. An optical source is attached to the closed proximal end, and its emitted illumination directed into the tubular wall of the body, such that said illumination is internally reflected within the tubular walls and is emitted from the distal open end. A detector array is disposed within the inner surfaces of the tubular wall section, and a lens images light reflected back into said imaging head, onto the detector array. The optical source is disposed radially inwards of the outer dimensions of the tubular shaped body.
US11096553B2

A method for obtaining and processing image data by using a medical visual aid system including a monitor and an endoscope configured to be inserted into a body cavity and having an image capturing device and a light emitting device, the method including illuminating a field of view of the image capturing device with the light emitting device, capturing the image data using the image capturing device, providing a non-linear scaling model adapted to the body cavity, adjusting the image data by applying the non-linear scaling model such that adjusted image data is formed, and presenting the adjusted image data on the monitor.
US11096550B1

A control box for a sprayer system is provided. The control box may include a wash flow path, a wash flow solenoid disposed in the wash flow path, a detergent supply assembly disposed in wash flow path, a rinse flow path, a rinse flow solenoid disposed in the rinse flow path, a common flow path, a flow switch disposed in the common flow path, an alternating relay, and a connection valve leading to a discharge flow path. The flow switch may be configured to provide a signal to the alternating relay. The alternating relay may be configured to control both the wash flow solenoid and the rinse flow solenoid. The connection valve may receive both the wash flow path and the rinse flow path. In another embodiment, a sprayer system including a control box and a sprayer unit is provided.
US11096537B2

A vacuum cleaner bag assembly is adapted to be removably disposed within a tank of a vacuum cleaner, and the bag assembly includes a panel assembly made from a first material and forming an enclosure having an interior volume, and an aperture extends through the panel assembly. A shield member may be disposed within the interior volume and secured to one or more portions of the panel assembly, and the shield member may comprise a second material that is different than the first material. The shield member is adapted to protect a portion of the panel assembly when the vacuum cleaner bag assembly is disposed within the tank.
US11096533B2

In a dust station, a suction part is connected selectively to one of a first suction port and a second suction port. In a state where the first suction port is connected to the suction part, a dust-collecting control unit drives the suction part and also automatically stops the suction part after elapsing of a first specified period of time. In a state where the second suction port is connected to the suction part, the dust-collecting control unit drives the suction part, and enables stopping the suction part through specified operation and also stops the suction part automatically when the suction part is not stopped even after elapsing of a second specified period of time or longer in a state where the suction part is driven, the second specified period of time being different from the first specified period of time.
US11096531B2

A handle assembly has a first handle with first and second end regions connected to and fixed relative to first and second mounts on a wall, respectively. A second handle extends longitudinally between third and fourth end regions, with the third end region connected to the first end region of the first handle. The first and second handles each have surfaces for grasping by a user. A position of the second grab bar is adjustable relative to the first grab bar by at least one of one of pivoting the second grab bar about the longitudinal axis of the first grab bar, pivoting the second grab bar about a horizontal axis adjacent to the first end region of the first grab bar, and sliding the second grab bar along the first grab bar. A method of installing the handle assembly is also provided.
US11096530B2

A device can include one or more inputs, which, in operation, receive one or more signals indicative of toilet-lid positions and one or more signals indicative of user-toilet proximity; and control circuitry coupled to the one or more inputs. The control circuitry can, in operation, determine a position of a toilet lid based on the one or more signals indicative of toilet-lid positions; respond to a determination that the toilet lid is in a closed position by entering a power-save mode of operation; and respond to a determination that the toilet lid is not in a closed position by selectively generating, based on the one or more signals indicative of user-toilet proximity, toilet-lid-actuator control signals to cause a toilet-lid-actuator to move the toilet lid toward a closed position. Related methods and systems are also provided.
US11096527B2

An illuminated shower handle assembly for dimly illuminating a bathroom at night includes a handle that is positionable in a recess of a shower stall in a residential bathroom. The handle can be gripped during showering and the handle is comprised of a translucent material. A light emitter is integrated into the handle and the light emitter illuminates the handle when the light emitter is turned on. In this way the handle acts as a night light for dimly illuminating the residential bathroom at night.
US11096526B2

A cooking apparatus that combines microwave based heating/cooking with either of blender/mixer grinder functionality and traditional cooking using open flame and/or induction cooking is disclosed. The cooking apparatus comprises a lid and at least one microwave producing device coupled to the lid. A lifting and lowering mechanism carries the lid and microwave producing device at a lower end for enabling vertically raising and lowering the lid along with the coupled microwave producing device. Upper end of lifting and lowering mechanism is slidably configured with a lower side of a chimney. Lid in lowered position gets operatively coupled with a container holding a food item. The container can be one for cooking food using conventional source of heat, or a container for preparatory operations such as blending, stirring, grinding and mixing. Coupling of the lid with the containers enables heating of the contents of the container through the microwaves generated by the at least one microwave producing device.
US11096524B2

A stand mixer arrangement includes a pedestal for a mixing bowl; an electric motor and a drive system including a rotary drive outlet disposed overhead of the bowl, capable of imparting a mixing action to a tool suspended into the bowl from a socket supported by said drive outlet; and illumination means encircling, or substantially encircling, said drive outlet and arranged to direct light into the mixing bowl.
US11096523B2

A blender system includes a blender base, a container and a blade assembly. The container is attached to the blender base. The blade assembly is attached to the container. The blender base includes a motor. The motor drives the blade assembly. The blade assembly includes a shaft and a blade. A gasket is positioned about the shaft. The gasket seals the shaft and the blade from a cavity of the container.
US11096522B2

Provided is a household electrical appliance for cooking and/or reheating food including: a housing having a tank arranged such as to receive the food to be cooked and/or reheated; a removable cover arranged such as to close the tank while cooking and/or reheating; at least one heating element and a fan arranged such as to create a closed hot air flow while cooking and/or reheating; and a ventilation sheath that includes a suction inlet, arranged on one side of the tank, and a ventilation outlet above the tank. Said ventilation sheath is arranged such as to direct the hot air flow onto the food while cooking and/or reheating. Said appliance is characterized in that the ventilation sheath is in one piece and separated from the cover.
US11096516B2

A system for preparing a quantity of beverage, including first and second capsules, and an apparatus including a first and a second brew chamber part, wherein at least a portion of the second brew chamber part is movable into a first and a second brewing position, wherein the first brew chamber part is movable between a loading position and a brewing position, wherein the first brew chamber part in the brewing position together with the at least one portion of the second brew chamber part in the first brewing position and in the second position define respective closed positions in which the first exchangeable capsule and the second capsule fit in the brew chamber, respectively. The invention also relates to an apparatus, a method and a capsule.
US11096511B2

Disclosed is an artificial tree having a plurality of electrified tree sections that couple together to provide power and/or command signals to devices connected thereto. One or more tree sections may have a trunk portion, one or more electrical connectors having a plurality of terminals, branches, a light string, and an electrical distribution system located at least partially within the trunk portion. A first tree section may be configured to couple to a second tree section such that an electrical connector of the first tree section is in electrical connection with an electrical connector of the second tree section, thereby mechanically and electrically connecting the first tree section to the second tree section such that power and/or the control data are transmitted to the second tree section. Further, each trunk segment may include an axial electrical connector that permits adjacent trunk segments to connect in a plurality of radial orientations relative to each other.
US11096509B2

A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.
US11096502B2

A sleep system comprises an air posturizing module having a case, the case comprising a first case section extending medially along a length of the case to define a movable first section, a second case section adjacent to the first case section and extending along a length of the case to define a movable second section, a third case section defining a third posturing section, a fourth case section extending medially along a length of the case to define a movable third section, and a fifth case section extending medially along a length of the case to define a movable fourth section. One or more first air chambers are carried in the first, third and fourth case sections to provide a first sleep area, and one or more second air chambers are carried in the second, third, and fifth module sections to provide a second sleep area.
US11096499B1

A position change apparatus and method for changing a position of a convertible-position item of furniture.
US11096496B2

A therapeutic chair with an adjustable backrest and cushioned fulcrum pad allows users to extend their thoracic spine over the fulcrum of the adjustable chair back. The device allows the individual to sit on the chair and adjust the height of the backrest so the fulcrum is matched to the patient's need for movement.
US11096486B1

A shelf structure has at least four columns and at least one supporting board provided with a plurality of circular gaskets respectively jacketing onto the columns. Each column has a plurality of positioning grooves, each circular gasket having a tapered shape and a fastening rib on an inner surface. The supporting board comprises a frame and a board member. The frame is provided with a raised internal surface, four top edges and four bottom edges of the frame are respectively provided with a horizontal rib. Each horizontal rib respectively forms a concave arced groove at each corner of the frame, and each concave arced groove is provided with an assembling arc member with two wing portions at each side configured to engage with the frame, the assembling arc member and the concave arc groove form a tapered hollow casing for engaging with the respective circular gasket.
US11096477B2

A method (400) for determining a user's compliance with a guided cleaning session during use of an oral cleaning device (10) includes the steps of: (i) providing (410) an oral cleaning device including a sensor (28), a guidance generator (46), and a controller (30); (ii) providing (420), by the guidance generator, a guided cleaning session to the user; (iii) generating (430), at a first location during the guided cleaning session, sensor data from the sensor indicating a position or motion of the oral cleaning device; (iv) comparing (440) the generated sensor data to expected sensor data for the first location; and (v) generating (450), based on the comparison, an estimate of the user's compliance with the guided cleaning session.
US11096468B2

An application utensil for transferring a coloring composition in one of many patterns onto skin includes a wheel comprising a pattern of raised and submerged regions on an outer tread surface of the wheel; a wheel well that supports the wheel and allows rotation of the wheel, wherein the wheel is removable from the wheel well; and a manual grip connected to the wheel well. A plurality of different application utensils and wheels are disclosed. Application utensils are interchangeable as are the wheels to allow many combinations according to consumer preference.
US11096454B2

The present invention provides a double-sided usable belt buckle, a belt having the double-sided usable belt buckle can be available on both sides. The two ends of the pin shaft can be connected with the buckle and the tail clamp by matching the clamping block arranged on the pin shaft with the clamping groove. The clamping block extends into the pin shaft mounting hole firstly, and after the connecting convex block is clamped into the connecting groove, the clamping block can be clamped into the clamping groove. When it is needed to use the other side of the belt having the double-sided usable belt buckle, simply pressing the pin shaft to make the clamping block slide out of the clamping groove so as to separate the tail clamp from the buckle, and then replace the tail clamp and connect it with the buckle again.
US11096451B2

A one-side clothing fastening section and another-side clothing fastening sections being provided to face opposite each other and having no button insertion holes provided thereon, the one-side clothing fastening section and the other-side clothing fastening section being fastened together when the clothing is worn on a human body. Each of the ornaments for the clothing includes a button-like base portion having the decorative surface on the front side thereof; and a sharply protruding portion extending from and through the rear side of the button-like base portion and having a hook portion at the tip end side thereof. The sharply protruding portion being passed through the clothing from the front side to the rear side of the one-side clothing fastening section and then from the front side to the rear side of the other-side clothing fastening section.
US11096450B2

A lace lock system. The lace lock system is mountable to footwear and includes a latch having an aperture that receives a lace guide and is affixed to a cam. The lace guide is pivotally affixed to the cam and has a channel that receives a lace through the aperture. The lace lock is designed to transition between an open position and a locked position. In the locked position, the lace is tensioned to align a distal end of the cam within the channel of the lace guide, such that the distal end of the cam frictionally bears against the lace disposed in the channel. In the open position, the latch is rotated towards a first end of the lock, causing the distal end of the cam to misalign with the channel of the lace guide and release tension of the lace disposed in the channel.
US11096437B2

An article or garment comprising a micro hook-and-loop closure system is provided herein. The article comprises at least one extremity-covering portion. The distal end of the extremity-covering portion comprises a first textile at an outer-facing surface and a second textile at an inner-facing surface. The second textile includes micro hook or micro loop materials that releasably mate with complementary micro hook or micro loop materials of the first textile in order to place the micro hook-and-loop closure system in a closed configuration. The placement, size, and shape of each of the first and second textiles, as extending from a distal end toward a proximal end of the article, enable the article or garment to be expediently and comfortably donned and doffed.
US11096433B2

This disclosure is related to trousers with a waist protection belt. The trousers include the waist protection belt that is detachably attached to a belt cloth of the trousers, a trouser body that includes a stretchable cloth at a position corresponding to a waist part of a back body part of the trousers, and a position adjusting part that is provided at substantially a center of the waist protection belt and is provided at a position on a back surface of the belt cloth corresponding to the waist part of the trouser body. The position adjusting part is configured to adjustably change an attachment position of the waist protection belt in a vertical direction with respect to the trouser body.
US11096430B2

A lower body outer garment, such as a pant or legging or skirt, is provided which has a construction and hidden support which helps to redefine the wearer's appearance. The support is provided in the form of internal mesh re-enforcing panels that lift the buttocks and flatten the tummy. The garment also includes external seaming that provides structure and has a visual effect to re-draw the wearer's outline.
US11096424B2

A controlling apparatus able to warn a user as to an old or malfunctioning atomizer head applied to an electronic cigarette, with a control method. A first detecting device detects value aN of loss factor when atomizing head operates for the Nth time, a timer records N times of operating and operating duration tN. A storage stores a loss calculation formula, a preset threshold value of the accumulated total loss DN, and loss data as to previous use of current atomizer head. A processor can acquire aN, N and tN, and loss calculation formula, and the loss data to calculate the operating loss dN and the total loss DN, then store dN and DN. Total loss DN is compared with the preset threshold value, and an alarming device transmits alarm signal if DN is equal to or greater than the preset threshold value.
US11096421B2

The invention discloses an installation structure of a conductive contact of an electronic cigarette and an electronic cigarette, wherein the installation structure of the conductive contact of the electronic cigarette comprises an electronic cigarette body provided with a receiving groove and a conductive contact which is installed in the receiving groove and is exposed to an opening of the receiving groove at one end thereof. The conductive contact comprises a first contact, a second contact, an insulating part and a sealing part provided with an installation hole, and the second contact is partially received in the installation hole; the insulating part is sleeved on the second contact and is partially received in the installation hole to separate the first contact from the second contact. The sealing part comprises first and second sealing rings; the first ring may be sleeved on an upright post of the insulating part and the second ring may be sleeved on the second contact.
US11096416B2

Machine and method for producing substantially cylindrical articles of the tobacco processing industry; a material with cavities is fed, along a given path, through an insertion station, where powder material is inserted into the cavities, so as to obtain a strand, and through a wrapping station, in the area of which a strip is wrapped around the strand; the powder material is inserted into each cavity by a relative insertion unit, which moves in a synchronous manner along a coupling portion of the given path.
US11096414B2

Bacteriophage against Geobacillus are provided, and methods of making and using the bacteriophage also are provided.
US11096411B2

An apparatus for coating a food product with a batter, includes a frame having a conveyor belt mounted on a rotatably driveable belt support member. The coating apparatus has a batter pump for pumping batter from a batter container towards an upper applicator positioned over the conveyor belt to form a stream of batter flow from the applicator to the conveyor belt to provide batter to an upper surface of the food product. The front roller is positioned at the food product entry section to provide a layer of batter on the conveyor belt at the entry section by a thrust on the batter towards the entry section by the front roller and/or the conveyor belt. The coating apparatus comprises a batter overflow device positioned at the entry section and is mounted between the transport run and the return run of the conveyor belt.
US11096409B2

Described are probiotic compositions for human oral consumption comprising Veillonella bacteria. In some aspects, the probiotic compositions further comprise a salt of nitrate (NO3−) and/or a salt of nitrite (NO2−). In other aspects, the probiotic compositions further comprise a salt of nitrite (NO2−) and a natural source of nitrate. In certain embodiments, the probiotic compositions additionally comprises a polyphenol. Also described herein are methods of enhancing generation of bioactive nitrogen oxides in a human subject, of treating or preventing a gastrointestinal disorder in a human subject, of enhancing athletic performance in a human subject, and of enhancing administration of nitrite or nitrate in a human subject, wherein the human subject is administered the probiotic compositions described herein.
US11096402B2

Disclosed herein is a process for preparing a coffee extract, comprising the steps of: providing a mixture of roasted coffee beans and water, milling the mixture of roast coffee beans and water in a pressurised chamber, and separating the milled mixture in a liquid coffee extract and spent coffee grounds. The coffee extract maintains many of the flavour components of the roasted beans.
US11096399B2

A method is for manufacturing brine-salted cheese with a homogeneous salt distribution and/or organic acid distribution and/or eyes distribution and/or texture on one axis of the cheese. The method includes, before a brining, applying a hydrophobic barrier on the entire outer parts of the cheese, which are located at the ends of the cheese axis. The hydrophobic barrier is kept on the cheese outer parts at least during part of the brining.
US11096394B2

A gas stunning apparatus and system includes a first environment and a second environment. An animal is passed through the first environment until the carbon dioxide concentration within the first environment is about 40%, rendering the animal unconscious. The animal is then passed through the second environment until the carbon dioxide concentration within the second environment is about 100%, rendering the animal irrevocably unconscious.
US11096391B1

The present disclosure is directed to a sanitizing composition for dispensing into aquatic systems. The sanitizing composition contains a sanitizing agent containing water molecules that have been bound within the composition by a water binder. In one embodiment, the sanitizing agent is a polybiguanide salt and the water binder is an anhydrous salt. The resulting composition can be a solid that can be packaged in water degradable or water soluble packages for ease of handling and dispensing.
US11096384B2

An enhanced equine tool has an enhanced pick tool, an enhanced grip handle, and an interchangeable tool head. The pick tool extends through the handle and out one end, curves into a flex fulcrum, and then extends upwards to a pick tip. The handle has two finger stops and a tool mount that releasably mounts an interchangeable tool head. The tool head can be a collateral groove brush head, bale twine cutter head, etc. The collateral groove brush head is adapted to fit within the collateral groove of an equine hoof and provide enhanced cleaning. The V-shaped brush head also efficiently cleans the central groove of the frog and other areas. Together, the components of an enhanced equine tool provide a plethora of enhanced functionalities that allow the equine caregiver to efficiently clean the hoof and undertake other tasks as well.
US11096375B2

A method of smart cattle reproduction management and digital farm to market transparency metrics tracks, monitors, and predicts reproductive efficiency, providing actionable information that allows the cattle rancher to optimize operations to ensure a high calf crop percentage. Using conventional ear tags to track and monitor the location, temperature, and movement of each animal in the herd, a highly accurate and data-driven reproductive performance score may be calculated for open heifers, cows, and bulls, thereby allowing actions to be taken to enhance reproductive efficiency. In addition, given the high risk of losing a heifer during calving, a method provides a means to detect, in advance and remotely, when a pregnant heifer is about to start calving to allow the cattle rancher to go on site, locate the animal, and provide any veterinary assistance that may be required should the delivery be difficult.
US11096367B1

A novel soybean variety, designated 5PYQQ43 is provided. Also provided are the seeds of soybean variety 5PYQQ43, cells from soybean variety 5PYQQ43, plants of soybean 5PYQQ43, and plant parts of soybean variety 5PYQQ43. Methods provided include producing a soybean plant by crossing soybean variety 5PYQQ43 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PYQQ43, methods for producing other soybean varieties or plant parts derived from soybean variety 5PYQQ43, and methods of characterizing soybean variety 5PYQQ43. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PYQQ43 are further provided.
US11096366B2

A novel soybean variety, designated 5PJQV48 is provided. Also provided are the seeds of soybean variety 5PJQV48, cells from soybean variety 5PJQV48, plants of soybean 5PJQV48, and plant parts of soybean variety 5PJQV48. Methods provided include producing a soybean plant by crossing soybean variety 5PJQV48 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PJQV48, methods for producing other soybean varieties or plant parts derived from soybean variety 5PJQV48, and methods of characterizing soybean variety 5PJQV48. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PJQV48 are further provided.
US11096364B2

A soybean cultivar designated 81111940 is disclosed. The invention relates to the seeds of soybean cultivar 81111940, to the plants of soybean cultivar 81111940, to the plant parts of soybean cultivar 81111940, and to methods for producing progeny of soybean cultivar 81111940. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar 81111940. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar 81111940, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar 81111940 with another soybean cultivar.
US11096360B2

The invention relates to the soybean variety designated 01067560. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01067560. Also provided by the invention are tissue cultures of the soybean variety 01067560 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01067560 with itself or another soybean variety and plants produced by such methods.
US11096345B2

The present disclosure provides a method for treating rice. The method comprises the steps of: providing a domestic rice crop plant and at least one ACCase-inhibiting aryloxyphenoxypropanoate herbicide selected from the group consisting of quizalofop or an ester thereof, haloxyfop, fluazifop or an ester thereof, clodinafop, clodinafop-propargyl, diclofop, and diclofop-methyl; applying an effective amount (measured in g AI/Ha) of the at least one aryloxyphenoxypropanoate herbicide to the domestic rice crop plant, post-emergence; thereby creating a treated rice plant; and growing the resulting treated rice plant.
US11096341B2

Described herein are several embodiments relating to modular irrigation controllers. In many implementations, the irrigation controllers are modular in that various functional components of the irrigation controller are implemented in removable modules that when inserted into position within the controller, expand the capabilities of the controller. Also described are various different types of expansion modules that may be coupled to the modular controller, having as variety of functions and features, as well as related methods of use and configuration of these modules in the controller. In some embodiments, a serial communication bus is provided between a control unit of a modular irrigation controller and an expansion module.
US11096337B1

An HVAC system used in a growing room to grow plants, including lighting and other heat producing pieces of equipment, wherein operating parameters are modified over time in response to and anticipation of changes in heat production by the lighting and other heat-producing pieces of equipment and moisture production from the plants and plant growing systems located in or near the growing room. The operating parameters of the system are modified during the growth cycle of the plants to provide environmental conditions appropriate to each phase of the plant growth. Additionally, the system comprises components carrying a load such that energy use can be reduced during times when less than maximum load is required. Algorithms and tables to control airflow, heating, cooling, dehumidification, and chemical composition of the air are included to maximize plant growth. CO2 and other byproducts of heating, cooling, and cogeneration are recycled for use in connection with plant growth.
US11096334B2

A round baler includes a bale chamber in which a round bale can be produced, and a wrapping device with which a completely pressed round bale can be wrapped with a first film in the bale chamber, and a feed device for introducing the first film into the bale chamber. The round baler also includes a feed point at which the first film can be fed to the bale chamber, and an ultrasonic sensor which is arranged at the bale chamber. The ultrasonic sensor is arranged at the bale chamber in such a way that with the ultrasonic sensor it is possible to determine whether the film is present on a surface of the round bale.
US11096333B2

The invention relates to a round baler having a bale chamber in which a round bale can be produced, and a wrapping device with which a completely pressed round bale can be wrapped with a first plastic film in the bale chamber, and a feed device for feeding the first plastic film into the bale chamber. The round baler also includes a feed point at which the first plastic film can be fed to the bale chamber, and an ultrasonic sensor which is arranged at the bale chamber. The ultrasonic sensor is arranged at the bale chamber in such a way that with the ultrasonic sensor it is possible to determine whether the first plastic film is present on a surface of the round bale. The invention also relates to a detection method for detecting a first plastic film on a surface of a round bale.
US11096332B2

A non-stop round baler is towed by a towing vehicle and is divided into a collection chamber and a baling chamber. The collection chamber is disposed between a pick-up unit and the baling chamber. The collection chamber momentarily stores the crop material before being transferred to the baling chamber. A feed control gate is functionally disposed between the collection chamber and the baling chamber. The feed control gate is selectively switchable between a flow restricting configuration during a bale binding cycle and a bale ejection cycle, and a flow facilitating configuration during a bale forming cycle. When in the flow restricting configuration, the feed control gate blocks crop movement into the baling chamber. When in the flow facilitating configuration, the feed control gate facilitates crop movement into the baling chamber.
US11096327B2

A crop residue spreader for an agricultural crop harvester such as a combine includes a rotor having a plurality of paddles including a first paddle having a first cross-sectional shape and a second paddle having a second cross-sectional shape, the second cross-sectional shape of the second paddle being different from the first cross-sectional shape of the first paddle. Different V-shapes can be used for the first and second cross-sectional shapes, the openings of the V-shapes facing in a forward rotational direction of the rotor. Multiple pairs of similarly shaped paddles can be used.
US11102908B1

A storage apparatus mounted in a rack includes: a battery that is placed on a front surface side of a power supply and supplies power during a backup operation; a drive mounting unit that is placed in front of the battery and has drives mounted thereon; a midplane that is placed between the battery and the drive mounting unit and relays signals and power; and a sub-midplane that is placed between the midplane and the battery and relays signals and power from the power supply and the battery, wherein the midplane and the sub-midplane are coupled to each other by a bus bar for supplying the power from the power supply, and an air passage that is capable of supplying cooling air from an intake port, formed on the front surface, to the battery without allowing the cooling air to pass around a periphery of the drives is provided.
US11102907B2

Networking device serviceability may be provided. A networking device may be disposed in a rack between uprights. The networking device may comprise a first plurality of switch bars each comprising a first switch type arranged parallel to one another, a second plurality of switch bars each comprising a second switch type arranged parallel to one another, and a third plurality of switch bars each comprising a third switch type arranged parallel to one another. The first plurality of switch bars, the second plurality of switch bars, and the third plurality of switch bars may be arranged orthogonally. A hinge device associated with the networking device may be configured to allow the networking device to rotate at least a predetermined angle value from a first position between the uprights to a second position where both the first plurality of switch bars and the second plurality of switch bars are clear from the uprights.
US11102906B2

The present disclosure provides a holding apparatus which includes a base tray and an expansion tray. The base tray can hold a first board, and the expansion tray can hold a second board. The expansion tray can fit within the base tray and can have a transition mechanism. The transition mechanism can engage first connectors on the first board to second connectors on the second board, or disengage the first connectors from the second connectors.
US11102904B2

An electronic component assembly including a fixing part fixable to a first face on a first-direction side of an adherend, an electronic component, and a housing. The adherend has a housing hole opening in the first face. The housing includes a fixed portion fixed to the fixing part and a housing body to house the electronic component. The housing body includes a first portion disposed on a second-direction side relative to the fixing part. The second direction is opposite to the first direction. The first portion of the housing body has a dimension in the second direction that is equal to, or smaller than, a dimension in the second direction of the housing hole of the adherend. The first portion of the housing body is configured to be housed in the housing hole of the adherend.
US11102900B2

An electrical power delivery system includes a module stack, a conductive bus bar, and one or more energy storage devices. The module stack includes multiple modules stacked side by side along a stack axis. Each of the modules has a respective housing and internal electrical components within the housing. The conductive bus bar is oriented along a plane parallel to the stack axis. The bus bar is mounted along a side of the module stack and electrically connected to one or more of the modules. The one or more energy storage devices are electrically connected to the bus bar and extend from a side of the bus bar facing away from the module stack such that the bus bar is disposed between the one or more energy storage devices and the module stack.
US11102899B2

An electronic device includes a display, an upper housing surrounding at least a portion of a periphery of the display, a lower housing coupled to the upper housing, and a window waterproof member disposed between at least a portion of a periphery of the display and the upper housing to seal an aperture between the upper housing and the display. The window waterproof member includes an inner core having a specific strength, and an outer sheath having a specific elasticity, and an outer peripheral surface of which contacts at least part of the upper housing and an inner peripheral surface of which contacts at least part of the display while the outer sheath surrounding at least a portion of the inner core.
US11102891B2

A method of manufacturing a polymer printed circuit board contains in a sequential order steps of: A), B), C), D, and F). In the step A), a material layer consisting of polymer is provided. In the step B), circuit pattern is formed on the material layer. In the step C), metal nanoparticles are deposited on the laser induced graphene (LIG) of the circuit pattern so as to use as a material seed. In the step D) a metal layer on the nanoparticles are deposited and the LIG of the circuit pattern are formed. In the step E), the circuit pattern is pressed. In the step E), the circuit pattern, the material layer, the metal nanoparticles, and the metal layer are pressed in a laminating manner to obtain the polymer printed circuit board.
US11102889B2

Provided are a desmearing method and a desmearing device which are able to reliably remove a smear derived from any of an inorganic substance and an organic substance, and eliminate the need to use a chemical that requires a waste liquid treatment. The desmearing method of the present invention is directed to a desmearing method for a wiring substrate material that is a laminated body of insulating layers made from resin containing a filler and a conductive layer, and includes an ultraviolet irradiation treatment step for irradiating the wiring substrate material with ultraviolet beams with a wavelength of 220 nm or less, and a physical vibration treatment step for applying physical vibrations to the wiring substrate material which has undergone the ultraviolet irradiation treatment step.
US11102888B2

At least one embodiment of the present disclosure relates to a substrate, a display panel and a fabrication method thereof, and a spliced screen. The substrate includes a base having a display region and a non-display region, and the non-display region includes a bonding region arranged at an end-side of the base.
US11102883B2

The present invention relates to substrates comprising a network comprising core shell liquid metal encapsulates comprising multi-functional ligands and processes of making and using such substrates. The core shell liquid metal particles are linked via ligands to form such network. Such networks volumetric conductivity increases under strain which maintains a substrate's resistance under strain. The constant resistance results in consistent thermal heating via resistive heating. Thus allowing a substrate that comprises such network to serve as an effective heat provider.
US11102875B2

A remote control device may be configured to be mounted over the toggle actuator of a light switch and to control a load control device via wireless communication. The remote control device may include a base portion and a rotating portion supported by the base portion so as to be rotatable about the base portion. The remote control device may include a control circuit and a wireless communication circuit. The control circuit may be operably coupled to the rotating portion and to the wireless communication circuit. The control circuit may be configured to translate a force applied to the rotating portion of the remote control device into a control signal and to cause the communication circuit to transmit the control signal to the load control device.
US11102856B2

A process for heating articles includes sequentially passing loaded carriers in a continuous manner through a first processing section and sequentially passing said plurality of loaded carriers in an incremental manner through a second processing section using an incremental convey segment. The incremental convey segment includes sequential carrier-receiving slots, each carrier-receiving slot configured to receive one of the loaded carriers. The incremental convey segment is further configured to be move incrementally at multiples of discrete intervals corresponding to the carrier-receiving slots. The process further includes sequentially passing the loaded carriers in a continuous manner through a third processing section and heating articles supported by the carriers with microwave energy in at least one of the processing sections, the heating of the articles occurring while the articles are at least partially submerged in a liquid bath and at an pressure greater than atmospheric pressure.
US11102853B2

A microwave heating system includes: a power supply; a first semiconductor module configured to receive power from the power supply and to generate a first microwave; a second semiconductor module configured to receive power from the power supply and to generate a second microwave; a heating chamber that is configured to accommodate an object at an inside of the heating chamber and that allows transmission of the first microwave and the second microwave to the inside of the heating chamber; and a control unit. The control unit is configured to control operation of each of the first semiconductor module and the second semiconductor module, and to control at least one of a frequency, a phase, or a magnitude of each of the first microwave and the second microwave to increase a heating uniformity of the object.
US11102849B2

A cooking device includes a light unit and an insulation unit configured to electrically insulate the light unit. The insulation unit includes a first insulation element and a second insulation element, with the light unit being at least partially arranged between the first insulation element and the second insulation element.
US11102843B2

Constructing and/or recovering paths of mobile devices is enabled. For instance, a method comprises: receiving, by wireless fidelity (Wi-Fi) sensors, respective probes from mobile devices, grouping probes having a same media access control (MAC) address into segments, identifying fingerprints of information elements the mobile devices, grouping segments according to an identified fingerprint, determining an increment of a sequence number corresponding to consecutive segments of a segment group, determining a time gap between the sequence number corresponding to a first probe and an incremented sequence number corresponding to a second probe having a timestamp that is later in time than the first probe, and comparing a growth rate of the sequence number corresponding to the consecutive segments to determine a forward segment of the consecutive segments, resulting in a constructed path of the mobile devices, and storing the constructed path in a database.
US11102842B2

A wireless device, a network node, a core node and methods therein, for managing reachability of the wireless device. The wireless device starts an AS (Access Stratum) reachable timer when entering an inactive state. If the AS reachable timer expires while still in the inactive state, the wireless device sends to the network node a reachable notification indicating that the wireless device is reachable. If entering a connected state before the AS reachable timer expires, the wireless device stops the AS reachable timer when changing from the inactive state to a connected state. If the core node receives from the network node a not reachable notification indicating that the wireless device is not reachable, the wireless device can be marked as not reachable via paging.
US11102840B2

A wireless device receives an uplink grant triggered in response to receiving a trigger during a validation duration. A determination is made that the wireless device is not in an Active Time, during at least a portion of the validation duration, by a process controlling monitoring of a control channel for: a pre-defined radio network temporary identifier (RNTI); and at least one RNTI. During the at least a portion of the validation duration: the control channel addressed to the pre-defined RNTI is monitored for the trigger; and the control channel addressed to the at least one RNTI is not monitored.
US11102836B2

A method and apparatus are disclosed from the perspective of a first UE (User Equipment) in RRC_CONNECTED to detect configuration failure. In one embodiment, the method includes the first UE transmitting a first PC5 RRC (Radio Resource Control) message to a second UE, wherein the first PC5 RRC message includes an AS (Access Stratum)-layer configuration for a unicast link established with the second UE. The method also includes the first UE transmitting a fourth RRC message to a network node if a configuration failure of the AS-layer configuration is detected, wherein the fourth RRC message indicates the configuration failure occurs.
US11102835B1

When a first access node is considering setup of dual-connectivity service for a UE, the first access node could take into consideration the MU-MIMO grouping efficiency respectively of each of one or more candidate second access nodes, in order to decide whether to set up the dual-connectivity service for the UE and/or to decide which of the multiple second access nodes to use for the UE's dual-connectivity service. MU-MIMO grouping efficiency of a given access node could be a representative count of UEs that the access node has provided with MU-MIMO service per unit time. Thus, for instance, the first access node may decide to use a given candidate second access node for the dual-connectivity service of the UE, with the decision being based on the given candidate second access node having a higher MU-MIMO grouping efficiency than one or more other candidate second access nodes.
US11102834B2

Disclosed herein is a system comprising a first backhaul node, a second backhaul node, and multiple sites that each comprise a respective node configured to maintain a first communication link with the first backhaul node and a second communication link with the second backhaul node, operate in a first mode in which the respective node engages in communication with the first backhaul node over the first communication link and does not engage in communication with the second backhaul node over the second communication link, detect a triggering event associated with the first communication link, and in response to detecting the triggering event, dynamically switch from operating in the first mode to operating in a second mode in which the respective node engages in communication with the second backhaul node over the second communication link and does not engage in communication with the first backhaul node over the first communication link.
US11102832B2

A method by a wireless local area network (WLAN) termination (WT) node in a second radio access technology (RAT) is provided. The method includes receiving, from a base station in a first RAT, a WT addition request message including quality of service (QoS) parameters for at least one bearer; identifying access category information for the at least one bearer, based on the QoS parameters received from the base station; transmitting, to the base station, a WT addition request acknowledge message including an identity of admitted bearer among the at least one bearer and access category information of the admitted bearer based on the admitted bearer being an uplink bearer, the access category information of the admitted bearer being forwarded from the base station to a terminal; and receiving, from the terminal, data based on the access category information.
US11102826B2

An MME detects that a PDN connection is not effective and changes from a non-optimal gateway to a bearer established in a PDN connection using a more optimal gateway as an endpoint node. This configuration allows an already-established PDN connection to switch to a new PDN connection using the more optimal gateway, which achieves optimal communication control for continuing communication of UE.
US11102823B2

Various aspects include methods for receiver (RX) beam sweep configuration of a millimeter wave (MMW) repeater during random access channel (RACH) procedures. Various embodiments may include determining two or more different RX beam sweep configurations for one or more RACH occurrences (ROs) associated with a synchronization signal block (SSB), generating a RACH configuration message indicating the two or more different RX beam sweep configurations for the one or more ROs, and sending the RACH configuration message to an MMW repeater. Various embodiments may also include receiving a RACH configuration message indicating two or more different RX beam sweep configurations for one or more ROs associated with an SSB, and controlling one or more RX antennas of the MMW repeater to perform RX beam sweeping during the one or more ROs according to the RACH configuration message to receive a RACH message 1 from a computing device.
US11102821B2

A communications device that, when in an inactive state, transmits a first signal comprising a random access preamble and a first portion of data to infrastructure equipment, receives a random access response message from the infrastructure equipment, and transmits a second signal comprising a second portion of the data to the infrastructure equipment.
US11102820B2

A configurable new radio (NR) RACH procedure that may be executed by a UE and a base station is disclosed. A first message can be transmitted, in an inactive or idle state, a on a physical random access channel, where the first message includes a random access preamble. A second message can be received on a downlink channel in response to the first message, where the second message includes a temporary cell radio network temporary identifier and an uplink grant for the user equipment. A request can be transmitted on an uplink channel based on the uplink grant. A common search space of a downlink control channel can be monitored, such as for an acknowledgement message or a negative acknowledgement message corresponding to the request and identifiable based on the temporary cell radio network temporary identifier.
US11102813B2

The present invention relates to a method and apparatus in which a terminal performs contention-based access in a mobile communication system, wherein the method comprises: a sensing step of sensing whether or not contention-based access is allowed for at least one logical channel; a receiving step of receiving a contention-based reverse grant from a base station; and a transmitting step of transmitting data to the base station through the logical channel for which the contention-based access is allowed. According to the present invention, contention-based access can be efficiently performed, and the reliability of transmission can be ensured.
US11102806B2

A base station of a wireless communication is disclosed. A wireless communication base station comprises a communication module and a processor. The processor receives DCI of a physical downlink control channel (PDCCH) for scheduling a physical uplink shared channel (PUSCH) transmission over a plurality of slots and multiplexes hybrid automatic repeat request (HARQ)-ACK information to the PUSCH transmission by applying a value in a downlink assignment index (DAI) field of the DCI to each slot where the HARQ-ACK information is multiplexed to the PUSCH transmission over the plurality of slots.
US11102781B2

Embodiments of the present disclosure relate to frequency or RAT selection based on slice availability. In one aspect, a core network function is provided for determining information for RAT and/or frequency selection based on knowledge of network slices and providing that information to a RAN node, which may provide that information to a UE. The information may be a RFSP index or other index parameter, which may be set based on subscription related information or other information. Slice knowledge may include knowledge of availability of network slices at the network, active slices for the UE, slices to which the UE is registered or connected, and/or slices to which the UE is allowed access. In another aspect, a RAN node performs mapping to mobility policies for UE active or idle mobility based on the determined information along with slice or subscription information provided by a CN node.
US11102774B2

A data transmission method and a terminal device are disclosed, which may solve the data transmission problems of a sidelink when the size of a time unit of a downlink and the size of a time unit of the sidelink are not the same. The method includes that a terminal device receives first control information sent by a network device, and determines a sending time for sidelink data according to the first control information.
US11102771B2

A method and apparatus for monitoring downlink control information (DCI) in a wireless communication system, especially in a new radio access technology (NR) is provided. A user equipment (UE) monitors first DCI having a first size in a UE specific search space (USS). The first size is determined based on an active bandwidth part (BWP). The UE further monitors second DCI having a second size in a common search space (CSS). The second size is determined based on a default BWP.
US11102761B2

In a radio system which allocates resources using as units resource blocks which are formed by frequency components and time components, control information for mobile station devices, and identification information which is used to identify a format for a control information transmission channel which transmits the control information is transmitted from the base station device to the mobile station devices by means of the control information transmission channel.
US11102748B2

The present disclosure relates to a method, performed in a network node of a first network, for designating one or more cells of a second network as neighbouring cells to the first network. The method comprises selecting a set of carriers employed in the second network and transmitting information for the selected set of carriers to a wireless device served by the first network. Measurement reports are received for respective carriers from the wireless device. The network node determines neighbour cell relations between the first network and one or more cells of the second network based on the received measurement reports.
US11102738B2

Apparatuses, systems, and methods for performing timing synchronization between a base station and a user equipment device within an unlicensed spectrum band. In some scenarios, beamforming tracking may also be performed. Upon determining that a transmission medium within the unlicensed spectrum band is available for transmission, a base station may transmit a plurality of synchronization signal blocks (SSBs), or a plurality of copies of one SSB, with associated remaining minimum system information (RMSI) blocks, within a single time instance within a SSB burst window. The SSBs may be transmitted at different frequency positions and according to distinct beamforming configurations. The SSBs and RMSI blocks may be configured such that a receiving user equipment device may determine the time-domain, and optionally the frequency-domain, position of the SSB and RMSI within the SSB burst window, to allow timing synchronization and optionally beamforming tracking.
US11102737B2

Embodiments of the disclosure provide methods and apparatuses for transmitting and receiving a synchronization signal, and a transmission system. A method includes that, a base station determines one or more sets of system parameters, each set of the system parameters including at least one of the following information of a carrier: frequency information, or a frame structure parameter; the base station constructs a synchronization signal of a predetermined structure according to the system parameters; and the base station transmits the synchronization signal to the terminal; the one or more sets of system parameters corresponding to the same predetermined structure. With the embodiments of the disclosure, the problem of excessive complexity in detection of the synchronization signal in the related technology is solved.
US11102732B2

The present disclosure relates to a communication technique for convergence of a 5G communication system for supporting a higher data transmission rate beyond a 4G system with an IoT technology, and a system therefor. The present disclosure may be applied to an intelligent service (for example, smart home, smart building, smart city, smart car or connected car, health care, digital education, retail business, security and safety-related service, etc.) on the basis of a 5G communication technology and an IoT-related technology. The present disclosure relates to a method of a terminal, the method comprising the steps of: determining a path loss reference beam on the basis of whether information indicating the path loss reference beam is received; obtaining a path loss on the basis of the path loss reference beam; obtaining a power headroom (PH) on the basis of the path loss; and transmitting a power headroom report (PHR) including the PH.
US11102729B2

A data transmission system may comprise a first transmission chain comprising a first transmission power controller, the first transmission power controller being configured to operate in an open loop power control mode or in a closed loop power control mode; a second transmission chain; and a power control mode selector configured to select the first transmission power controller to operate in the open loop power control mode or in the closed loop power control mode based on at least one quantity indicative of interference induced by the second transmission chain in the first transmission power controller when operating in the closed loop power control mode.
US11102725B2

A method of dynamically changing a mode of advertising for at least one of a multiple of access controls, including transmitting advertisements from an access control at a nominal mode; and changing the nominal mode in response to an event.
US11102722B2

A wireless device may receive a first configuration parameter indicating a CI-RNTI, for cancellation indication, and DRX configuration parameters. The wireless device may monitor a control channel for the CI-RNTI in a time window that is based on a timing of a scheduled uplink transmission and regardless of a DRX procedure, performed by the wireless device based on the DRX configuration parameters, indicating a DRX Active Time or not. The wireless device may receive a cancellation indication DCI, associated with the CI-RNTI, comprising an uplink cancellation indication. The wireless device may cancel the scheduled uplink transmission based on the uplink cancellation indication.
US11102721B2

A method for transmitting a physical layer protocol data unit (PPDU) and a device using the same are provided. The device receives a trigger frame for requesting a transmission of a response PPDU and transmits the response PPDU. A duration of the response PPDU is calculated based on a duration of the trigger frame.
US11102720B2

A method, user equipment (UE) and basestation are provided, wherein the UE is configured to send battery status data to the basestation and, in response, the basestation is adapted to improve the Quality of Service for the UE.
US11102716B2

A method for configuring a connection between a User Equipment, UE, and a 3rd Generation Partnership Project, 3GPP, compliant mobile communications network at the UE. The method comprises checking a service equivalency indicator, the service equivalency indicator indicating zero or more mobile communications networks the UE is permitted to transmit a new request for a PDN connection corresponding to a previously rejected request for a PDN connection. If the service equivalency indicator indicates that there is at least one mobile communications network including the mobile communications network to which the UE is currently attached for which it is permitted to transmit a request for a PDN connection corresponding to a previously rejected request for a PDN connection, and a new PDN connection corresponding to a previously rejected request for a PDN connection is required, the method further comprises transmitting a new request for a PDN connection, the new request corresponding to a previously rejected request for a PDN connection.
US11102713B2

Aspects of the subject disclosure may include, for example, receiving a request to permit equipment of a subscriber of a mobile service provider that provides a subscribed service via a licensed frequency spectrum to access the subscribed service via a wireless access terminal according to an unlicensed frequency spectrum. A radio adapted to provide access to the subscribed service via the licensed frequency spectrum is identified, wherein the wireless access terminal resides within a coverage area of the identified radio. A current utilization of the identified radio is determined and a response to the request is generated according to the current utilization of the identified radio, wherein access to the subscribed service via the wireless access terminal is conditional according to the response to the request, resulting in conditional access. Other embodiments are disclosed.
US11102710B2

The present disclosure provides a user equipment for a mobile telecommunications system, which includes circuitry configured to communicate with a new radio base station. The circuitry is further configured to transmit an on-demand system information request to the new radio base station, wherein the on-demand system information request is transmitted based on a backup resource.
US11102706B2

Embodiments of the present invention relate to the communications field, and provide a method and device for sending system information. The method comprises: a terminal receives a broadcast message from a network device, the broadcast message comprises indication information for an system information (SI) and wherein that the indication information is for indicating that whether the SI is being broadcasted or not, in case that the indication information indicating that the SI is not being broadcasted, the terminal sends a system information request to the network device for acquiring the SI.
US11102705B2

[Object] To provide a communication device capable of efficiently using a NOMA technology by effectively sharing information to be used in NOMA. [Solution] Provided is a communication device including: a setting unit configured to set a predetermined resource pool to be used for transmission and information regarding non-orthogonal multiplexing in a first device; and a transmission processing unit configured to broadcast the information regarding the non-orthogonal multiplexing.
US11102704B2

Communication between a terminal and a base station, and network access methods and apparatuses for a terminal are provided. The communication between the terminal and the base station includes: the terminal sending a network access request frame with a first preamble to a relay device, the relay device being configured to receive the network access request frame according to the first preamble, send the network access request frame with a second preamble to the base station, and receive a network access response frame returned by the base station, a length of the second preamble being smaller than a length of the first preamble; and the terminal receiving the network access response frame sent by the relay device.
US11102702B2

A method for establishing a network cluster between a plurality of devices having a wireless radio configurable in access point mode and a client mode involves causing a first device to be configured in client mode and in response to a determination by the first device that networking services associated with a network cluster name are not currently offered by another device, causing the first device to be configured in access point mode. In response to receiving a connection request at the first device from a second device configured in client mode, the method involves accepting the connection, determining a user identifier of the second device, and adding an entry to a connection listing on the first device. The method involves, in response to receiving data packets at the first device having a destination corresponding to the second device user identifier, transmitting the data packets to the second device.
US11102697B2

A method for controlling earphone switching and an earphone are provided. The method includes the following. A first earphone acquires a first remaining power and a first operating parameter of the first earphone and a second remaining power and a second operating parameter of a second earphone. The second earphone serves as a slave earphone. The first earphone predicts a first battery life of the first earphone according to the first remaining power and the first operating parameter and a second battery life of the second earphone according to the second remaining power and the second operating parameter. The first earphone predicts switches the second earphone to serve as a master earphone and the first earphone to serve as a slave earphone, when a difference between the second battery life and the first battery life is greater than a first preset threshold.
US11102691B2

A first access node of a first wireless access network receives, via a first entry node of the first network, a service-request message from a terminal registered with the first network. The first access node requests first network-capacity information associated with the first wireless access network from the first entry node, and second network-capacity information associated with a second wireless access network from a second access node of the second network. The first access node selects a target access network based on the service-request message and the first and second network-capacity information. The first access node, in response to a selection of the first wireless access network, sends a service-reply message to the first entry node. The first access node, in response to a selection of the second wireless access network, triggers a handover of the terminal to the second wireless access network.
US11102687B2

Disclosed is a 5G or a pre-5G communication system provided to support a higher data transmission rate than a system after a 4G communication system such as LTE.
US11102685B2

A method of switching a measurement mode and a device thereof are provided. The method includes: sending, by a network equipment, configuration information to a user equipment, to enable the user equipment to switch from a first measurement mode to a second measurement mode according to the configuration information; where the first measurement mode is a mode of triggering the user equipment to measure a current cell and/or a neighboring cell in the case that a first measurement trigger condition is met; and the second measurement mode is a mode of triggering the user equipment to measure a current cell and/or a neighboring cell in the case that a second measurement trigger condition is met.
US11102684B1

A method and system for blindly triggering handover based on past failures to trigger handover of beamforming-served devices. A computing system identifies a geolocation area where wireless communication devices (WCDs) that are served with beamforming by a first access node tend to experience radio link failure after having reported to the first access node being within threshold weak coverage of the first access node and threshold strong coverage of a second access node. And, based on the identifying, the computing system then blindly triggers handover of a given WCD from the first access node to the second access node in response to determining that the given WCD is served with beamforming by the first access node while positioned in the identified geolocation area.
US11102675B2

[Object] To provide a wireless communication apparatus capable of causing transmission and reception of data at an existing transmission time interval and transmission and reception of data at a short transmission time interval shorter than an existing transmission time interval to coexist effectively. [Solution] Provided is a wireless communication apparatus including: a notification unit configured to notify of a short transmission time field in which data is transmitted at a short transmission time interval which is a transmission time interval shorter than one subframe period in a subframe, and notify of information regarding the short transmission time interval for another communication apparatus in a control field transmitted in units of subframes.
US11102669B2

A terminal apparatus configured to receive a measurement configuration from one or more base station apparatuses transmits a first measurement result and a second measurement result, and the first measurement result includes, as measurement results of a serving cell, the measurement results of the serving cell of a first cell group and the serving cell of a second cell group, and the second measurement result includes, as a measurement result of a serving cell, the measurement result of the serving cell of the second cell group.
US11102663B2

Among other things, a communication system comprising at least one remote unit and at least one controller is described. The at least one remote unit exchanges radio frequency (RF) signals with mobile devices. Each RF signal comprises information destined for, or originating from, one of the mobile devices. The controller is communicatively coupled to the at least one remote unit and comprises a real-time scheduler for assigning airlink resources to the mobile devices for the information. The at least one controller and the at least one remote unit are configured so that the physical layer functions for an air interface are split between the controller and the at least one remote unit. The at least one controller and the at least one remote unit are configured so that the split of the physical layer functions for at least some of a first channel of the air interface differs from the split of the physical layer functions for a second channel of the air interface.
US11102646B1

A method of configuring an electronic subscriber identity module (eSIM) of a wireless communication device. The method comprises storing provisioning data packages in an eSIM of a wireless communication device, receiving a short message service (SMS) message by an eSIM management application executing on the mobile communication device from a provisioning application executing on a computer system, in response to the SMS message, determining by the eSIM management application a current location of the mobile communication device and the identities of the provisioning data packages, sending the current location and the identities of the provisioning data packages by the eSIM management application to the provisioning application, receiving a provisioning command message by the eSIM management application from the provisioning application, wherein the provisioning command message identifies one of the stored provisioning data packages, and activating the identified provisioning data package in the eSIM for communication by the wireless communication device.
US11102640B2

A network function performs a method to identify an invalid subscription concealed identifier, SUCI. When the network function receives a message containing a SUCI, it determines a size of the SUCI contained in the received message, and also determines an expected size of the SUCI in the received message. The network function then determines whether the size of the SUCI contained in the received message satisfies a criterion associated with the expected size. If the size of the SUCI contained in the received message does not satisfy the criterion associated with the expected size, the network function determines that the SUCI in the received message is invalid, and it rejects the SUCI in the received message if it is determined to be invalid.
US11102637B2

Devices, systems and processes for providing relevant, real-time information to a responder are described. For at least one embodiment, a process may include receiving, by a responder system, alert data identifying an incident location. The process may include determining whether relevant data for the incident location is stored in the responder system. When relevant data is not stored in the responder system, the process may include obtaining the relevant data for the incident location from an external data source and storing the obtained relevant data in the responder system. While proceeding to the incident location, the process may include generating, based on the alert data and the relevant data, initial augmented reality information for presentation to a responder associated with the responder system. Upon arriving at the incident location, the process may include generating second augment reality information for the responder. Upon arriving within a localized area of the incident location, the process may include identifying and selecting an IoT device operable within the localized area, establishing a communications link with the selected IoT device, receiving first IoT device data from the selected IoT device, and generating, based on the first IoT device data, third augmented reality information.
US11102634B2

In a first user equipment, apparatus and method, a first user equipment performs sidelink communication with a second user equipment, receives a first message from the second user equipment, where the first message is periodically transmitted from the second user equipment based on a first timer, starts or restarts a second timer upon receiving the first message, where a value of the second timer is determined based on a value of the first timer, and transmits a second message to a network apparatus upon expiration of the second timer, where the second message indicates that the second user equipment is disconnected from the first user equipment.
US11102621B2

A method for extending the connection time of talkgroup radios in a talkgroup conversation based on historical talkgroup statistics is provided. A talkgroup conversation request intended for a talkgroup is received from a first mobile unit. A group call grant message is sent to radios that are members of the talkgroup. The group call grant message initiates the talkgroup conversation with a first talkgroup call and includes an extended connection time value. Once it is determined that the first talkgroup call has ended, all radios that are members of the talkgroup are kept in a connected state. An extended connection timer utilizing the extended connection time value is started. Upon expiration of the extended connection timer, all radios that are members of the talkgroup are set to an idle state.
US11102616B2

Provided are techniques for tracking a tagged object using a thermostat. The techniques include utilizing a controller that includes a display, wherein the controller is located in a thermostat and is configured to receive a scan request. The techniques also include a tag that is coupled to an object, where the tag is configured to transmit a beacon, and one or more sensors are configured to detect the beacon and transmit data associated with the tag to the controller, wherein each of the one or more sensors are located in one or more zones of a structure.
US11102612B2

Systems and methods are provided to permit groups of recreational vehicle riders and others the ability to quickly create and join groups without prior knowledge of the contact information of everyone in the group. In one embodiment, groups are joinable based on the proximity information of the prospective member and the current group members.
US11102598B1

A personal air vehicle (PAV) and a control method thereof are provided for compensating for distortion in a speaker due to changes in altitude. The. PAV provides communication through a speaker in an emergency. In particular, the PAV includes an air pressure sensor that is configured to sense external air pressure and a propulsion device that is configured to supply propulsion for flight. A speaker is provided and includes an enclosure having a preset internal air pressure. A controller is configured to adjust an acoustic signal supplied to the speaker based on a difference value between the external air pressure and the internal air pressure changing according to altitude.
US11102596B2

Embodiments described herein generally relate to analyzing a signal generated by a device under test (DUT). In particular, the signal generated by the DUT may be compared to a reference signal to determine pass/fail results for the DUT. For example, a method may include: storing, on a computing device, a reference signal from a reference device; receiving a test signal from a device under test (DUT); synchronizing the reference signal and the test signal based on a time-synchronization buffer of each signal; after the synchronization, comparing the test signal and the reference signal to determine a pass or fail result for the DUT; and generating a notification indicating the pass or fail result for the DUT.
US11102591B2

An ear-worn electronic device comprises a plurality of EEG sensors configured to sense EEG signals from or proximate a wearer's ear. At least one processor is configured to detect, during a baseline period of no wearer movement, EEG signals from the EEG sensors, and detect, during each of a plurality of candidate control movements by the wearer, EEG signals from the EEG sensors. The at least one processor is also configured to compute, using the EEG signals, discriminability metrics for the candidate control movements and the baseline period, the discriminability metrics indicating how discriminable neural signals associated with the candidate control movements and the baseline period are from one another. The at least one processor is further configured to select a subset of the candidate control movements using the discriminability metrics, each of the selected control movements defining a neural command for controlling the ear-worn electronic device by the wearer.
US11102587B2

Disclosed herein is a hybrid acoustic apparatus. The hybrid acoustic apparatus includes: a rectangular microspeaker used as a first acoustic device; and a second acoustic device integrated with the microspeaker. The microspeaker includes a plate configured to constitute a part of a magnetic field part, a magnet configured to be disposed beneath the plate, a diaphragm configured to be disposed on the plate, and a frame configured to accommodate the diaphragm, the plate, and the magnet. A path of vibration sound generated by the diaphragm is formed to be perpendicular to a direction in which the diaphragm vibrates so that the vibration sound is discharged through a side surface of the diaphragm.
US11102583B1

An audio power output circuit provides a pair of output signals to an audio output transducer that has two different voice coils. Using a measured or predicted position of the voice coil assembly with respect to the transducer's magnetic field, a processing circuit generates the pair of signals such that a first relationship between a first one of the pair of output signals and an audio input signal and a second relationship between a second one of the pair of the output signals vary with the position of the voice coil. Offset in the Dynamic Mean Position (DMP) can be compensated for without adding low frequency or direct current components that compromise the dynamic range of the transducer. The efficiency, acoustic output power and/or linearity of the acoustic output of the transducer may be optimized by tailoring the first and second relationship to a particular target performance.
US11102580B2

The disclosure includes a headset including one or more earphones and a connector configured to couple data and charge between the headset and a user equipment (UE). The headset also includes a charge node. The charge node includes a charge port for receiving UE charge from a charge source. The charge node also includes a downstream port for coupling audio data toward the earphones. The charge node further includes an upstream port for coupling the audio data toward the earphones via the downstream port and coupling UE charge from the charge port toward the UE via the connector.
US11102579B2

An apparatus for reducing cross-talk between transmitted audio signals and received audio in a headset. The headset includes one or more of a set of earphones, a headset frame, a microphone boom with an array of MEMS microphone configured to isolate the earphone audio from the microphone audio, a VOX circuit, low crosstalk cable(s), and/or other components. Sets of microphones may be enabled and/or disabled to reduce cross-talk between received audio signals and transmitted audio signals. The VOX circuit is configured to reduce cross-talk between received audio signals and transmitted audio signals.
US11102576B2

Methods and apparatus change operation of a hearing device based on a state of an acoustic valve in the hearing device. In some examples an electrical circuit performs one or more of differing operations depending on a state of the acoustic valve. Some operations change the signal to a sound producing transducer and other operations change other operations of the hearing device. For example, an electrical circuit changes active noise cancelling operation, changes equalization settings, provides noise reduction improvements, provides beam forming changes and other operations based on a state of the acoustic valve. In some implementations, a change in acoustic valve state is used to change the operation of the hearing device.
US11102575B1

A method for driving a voice coil of a loudspeaker may include providing a magnetic circuit having an air gap, providing a voice coil suspended in the air gap, and applying an audio signal to the voice coil to move the voice coil along a travelling axis. The voice coil comprises a center voice coil section, an upper voice coil section, and a lower voice coil section arranged on respective sides of the center voice coil section. A center driving signal is provided to the center voice coil and an upper rectified driving signal, attenuating a first direction of current, and a lower rectified driving signal, attenuating a second direction of current, are provided respectively to the upper and lower voice coil sections. The invention further relates to a voice coil driving system and a loudspeaker comprising a voice coil driving system.
US11102562B2

The invention discloses a microphone encapsulation structure having a plurality of transducers, comprising: a housing; a circuit base plate, wherein the circuit base plate and the housing form an acoustic cavity, and a first acoustic through-hole is provided on the circuit base plate; a PCB (Printed Circuit Board) substrate disposed at a top of the circuit base plate, wherein the PCB substrate is provided with a plurality of second acoustic through-holes and the PCB substrate is provided with: a plurality of acoustic transducers each disposed directly above one of the plurality of second acoustic through-holes; and a plurality of ASIC (Application Specific Integrated Circuit) chips each connected to one of the plurality of acoustic transducers via gold wire.
US11102557B2

Systems, methods, and apparatus to identify linear and non-linear media presentations are disclosed. An example method to determine whether a media presentation is a linear or a non-linear media presentation comprises generating a reference log comprising a first media identifier of first media and a time at which the first media was presented, accessing a media presentation log comprising a second media identifier of second media and a time at which the second media was presented, and determining whether the second media correspond to a linear media presentation or a non-linear media presentation by comparing the media presentation log to the reference log.
US11102556B2

A system for automatically managing the delivery of media assets allocates the media assets to delivery slots of a media delivery servers so that consumers will receive the media assets when they consume digital media programming at times that correspond to the delivery slots. An example is the automated allocation of sponsored videos to television programs airing on a particular afternoon. The system includes data stores and a campaign manager system. The campaign manager system will automatically allocate digital media assets to delivery slots in a campaign to generate scheduling files that media servers will use to present the allocated media assets to consumers during the assigned delivery slots via media consumption devices.
US11102555B2

A method in a server for providing various Internet Protocol television signal qualities involves an IPTV signal having a first signal quality that is transmitted over a first network connection to a first device. A request to receive the IPTV signal over a second network connection at a second device with the IPTV signal having a second signal quality is received. A determination is made that the second network connection has sufficient bandwidth to transmit the IPTV signal at the second signal quality, and that the second device is capable of receiving IPTV signal. The transmission of the IPTV signal over the first network connection to the first device is ended. An endpoint for the transmission of the IPTV signal to the first device is determined. The IPTV signal is transmitted over the second network connection to the second device at the second signal quality beginning at the determined endpoint.
US11102548B2

An interactive television program guide application is provided that queries a user regarding the user's interest in television programs and suggests television programs to the user based on the user's responses. The interactive television program guide application identifies a television program that is potentially of interest to the user. The interactive television program guide application then queries the user regarding the user's interest using questions that are formulated based on attributes associated with the identified television program. Using the user's responses to the questions, the interactive television program guide application identifies and suggests one or more television programs to the user.
US11102544B2

Disclosed is a system and method for reducing the total latency for transferring a frame from the low latency camera system mounted on an aerial vehicle to the display of the remote controller. The method includes reducing the latency through each of the modules of the system, i.e. through a camera module, an encoder module, a wireless interface transmission, wireless interface receiver module, a decoder module and a display module. To reduce the latency across the modules, methods such as overclocking the image processor, pipelining the frame, squashing the processed frame, using a fast hardware encoder that can perform slice based encoding, tuning the wireless medium using queue sizing, queue flushing, bitrate feedback, physical medium rate feedback, dynamic encoder parameter tuning and wireless radio parameter adjustment, using a fast hardware decoder that can perform slice based decoding and overclocking the display module are used.
US11102542B2

Systems and methods are described herein for controlling access from a first content platform to content items available on a second content platform to which a user will temporarily have access in the near future. The first content platform identifies a period of time during which the user will have access to the second content platform and determines an access duration of the period of time. The first content platform retrieves a plurality of content identifiers of content items that will be available on the second content platform during the period of time. Upon receiving selection of a content identifier, the first content platform determines a duration of the content item corresponding to the selected content identifier and generates for display the content item. The first content platform then reduces the access duration by an amount of time equal to the duration of the content item.
US11102516B2

A viewing device, a method of displaying streamed data frames and a client viewing device are disclosed herein. In one embodiment, the video viewing device includes: (1) a screen, (2) a decoder configured to decode a data frame received in a bitstream from a transmitter to provide a decoded data frame, and (3) an error concealer configured to either discard the decoded data frame or select the decoded data frame for display on the screen based on a complexity of the decoded data frame.
US11102514B2

A system for signaling extension functions used in decoding a sequence including a plurality of pictures, each picture processed at least in part according to a picture parameter set is disclosed. An extension presence signaling flag is read and used to determine whether flags signaling the performance of extension functions are to be read. The flags are only read if indicated by the extension presence signaling flag.
US11102512B2

An encoder includes circuitry and memory. The circuitry, using the memory: prohibits a first splitting method when arrangement and shapes of blocks obtained by splitting a first block multiple times by the first splitting method are identical to arrangement and shapes of blocks obtained by splitting the first block multiple times by a second splitting method different from the first splitting method, and when scan order of the blocks obtained by the first splitting method is identical to scan order of the blocks obtained by the second splitting method; and encodes the first block.
US11102502B2

The present invention relates to the encoding and decoding of image information. According to the present invention, the decoding method comprises the steps of: entropy-decoding received information; performing inter prediction on a current block based on the entropy-decoded information; and restoring images by using the prediction results, wherein, in the inter prediction step, a skip mode or merge mode is applied to the current block and movement information of the current block may be determined based on the movement information of a neighboring block of the current block.
US11102501B2

A motion vector field coding and decoding method, where the method includes obtaining an original signal of a current motion vector field block, where the current motion vector field block is obtained by dividing a current motion vector field into blocks, and the current motion vector field is a motion vector field corresponding to a video frame at a moment t, obtaining a prediction signal of the current motion vector field block and prediction information of the current motion vector field block, calculating a prediction residual signal of the current motion vector field block according to the prediction signal and the original signal, where the prediction residual signal is used to indicate a residual between the original signal and the prediction signal, and writing the prediction information and the prediction residual signal into a bitstream.
US11102499B2

A device may be configured to signal information using watermarks. A device may be configured to determine a watermark message identifier. A device may be configured to receive a multimedia signal, parse a watermark message identifier, and receive fragment characteristic information in response to the value of the watermark identifier.
US11102497B2

A method for encoding a video sequence in a scalable video encoder to generate a scalable bitstream is provided that includes encoding the video sequence in a first layer encoder of the scalable video encoder to generate a first sub-bitstream, encoding the video sequence in a second layer encoder of the scalable video encoder to generate a second sub-bitstream, wherein portions of the video sequence being encoded in the second layer encoder are predicted using reference portions of the video sequence encoded in the first layer encoder, combining the first sub-bitstream and the second sub-bitstream to generate the scalable bitstream, and signaling in the scalable bitstream an indication of a maximum decoded picture buffer (DPB) size needed for decoding the second sub-bitstream and the first sub-bitstream when the second sub-bitstream is a target sub-bitstream for decoding.
US11102490B2

A method of controlling intra prediction for decoding or encoding of a video sequence, is by at least one processor and includes obtaining an index of an intra prediction mode of a current block of the video sequence, obtaining a coefficient scanning direction based on the obtained index, using a first look up table indicating a mapping between a plurality of indices of a plurality of intra prediction modes and respective coefficient scanning directions, and performing a coefficient scanning of the current block, based on the obtained coefficient scanning direction.
US11102484B2

A video coding mechanism is disclosed. The mechanism includes selecting a split mechanism to split a coding unit (CU) into sub-CUs for application of one or more transform units (TUs), the selection of the split mechanism based on comparing a CU width to a max TU width and comparing a CU height to a max TU height. The selected split mechanism is applied to the CU to obtain sub-CUs. A residual of one of the sub-CUs is determined. The residual includes a difference between sample values for the sub-CU and prediction samples for the sub-CU. The TUs are applied to transform the residual of the CU based on results of the selected split mechanism. A transformed residual for the CU is encoded into a bitstream.
US11102482B2

Embodiments of the present invention relate to the field of picture processing. Especially, the embodiments are directed to improving the deblocking filter of an image coding device. During the deblocking, at most a number MA of sample values of the first coding block adjacent to the block edge are modified and at most a number MB of sample values of the second coding block adjacent to the block edge are modified; or at most a number MA of sample values of the second coding block adjacent to the block edge are modified and at most a number MB of sample values of the first coding block adjacent to the block edge are modified, MA≠MB.
US11102480B2

An apparatus is configured to determine an adopted intra prediction mode on the basis of a most probable modes list, a selected modes list and a non-selected modes list having a first portion and a second portion, wherein the adopted intra prediction mode is one of a plurality of intra prediction modes comprising a plurality of angular intra prediction modes for predicting sample values of a current picture block. The apparatus includes a processor configured to generate the first portion of the non-selected modes list by including one or more angular intra prediction modes determined to be close to a respective angular intra prediction mode of the most probable modes list and the selected modes list. The processor is further configured to determine the adopted intra prediction mode.
US11102475B2

A video encoding device includes a local decode generation unit for generating a reference image based on a result of encoding of a divided image, a compression unit for compressing the reference image to generate a compressed data, a reference image storage determination unit for determining whether to store the compressed data in a memory, and an inter-prediction unit for performing motion vector search for inter-coding based on a reference image stored in the memory. The reference image storage determination unit sets an allowable data amount used for storing the reference image for each determined area of the moving image data, and determines whether or not to store the compressed data obtained by compressing the reference image in the memory based on the allowable data amount. Inter-prediction unit sets the reference image corresponding to the compressed data stored in the memory as the search range of motion vector search.
US11102469B2

A 3D play system which includes a head-mounted/headset device. The head-mounted device includes a supporting structure, a first lens, and a second lens. The supporting structure is configured to support two display devices. The first lens is configured to zoom an image displayed by a first display device and project the zoomed image onto a left eye. The second lens is configured to zoom an image displayed by a second display device and project the zoomed image onto a right eye.
US11102466B2

A decoding method including: decoding at a current time instant a current image having at least two views respectively representative of a same scene. The decoding includes: deriving a disparity motion vector for a current block; predictively decoding the current block according to the derived disparity motion vector; and during the deriving: constructing a plurality of lists of disparity motion vectors, including at least one list in which at least two disparity motion vectors have been derived respectively according to at least two different estimation methods; applying a first function to the at least two disparity motion vectors of the at least one list, to obtain one disparity motion vector for each of the at least one list, and applying a second function to the disparity motion vectors of the plurality of lists to deliver the derived disparity motion vector.
US11102463B2

A method for processing at least one digital image for reproduction on a display device. The image includes image elements, an image element being associated with color information having, in a first color space, a luminance component and chrominance components. The method includes the following acts: determining a number of image elements, known as “bright” elements, at least the luminance component of which has a value greater than a first predetermined threshold; evaluating a maximum tolerated brightness value as a decreasing function of the number of counted image elements; and transforming the first luminance components of the image elements to second luminance components, including for an image element, calculating an intermediate luminance value by applying an expansion exponent to the first luminance component value and multiplying the intermediate value calculated by the evaluated maximum tolerated luminosity value.
US11102457B1

An audio/video (A/V) recording and communication doorbell device includes an input port, a switch, a first power supply, a second power supply, a button, a first controller, and a second controller. The switch is electrically coupled across the input port. The first power supply receives power from the input port and powers a first power supply rail, and the second power supply powers a second power supply rail. The button, when pressed, activates a signaling device. The first controller is at least partially powered from the first power supply rail and closes the switch in response to the button being pressed. The second controller is at least partially powered from the second power supply rail.
US11102446B2

The present invention relates to an arrangement or a device for transmission and verification of signals in audio visual radio transmitters and receivers, such as TV receivers, set-top boxes, mobile handsets, etc. The receiver may be configured to receive a number of signal units within a frequency range. An identifying unit is configured to identify the signal units. A comparator unit configured to make possible for at least a portion of the signal units to be forwarded or at least partially be blocked with respect to the receiver. A verification unit, which includes a memory configured to store at least a number of signal units, verify that each forwarded signal units that pass the arrangement is being registered by means of a specific signal in a register unit.
US11102441B2

The present disclosure is intended to provide a smart television and a method for displaying a graphical user interface of a television screen shot. The method includes while a display device is displaying currently-played content, in response to receiving an input instruction for capturing a screen shot, acquiring a screen shot image comprising at least one object; and while the display device continues playing, displaying a screen shot content display layer on the display device. The screen shot content display layer is configured to present the screen shot image. The method further includes in response to receiving an input for selecting an object or a keyword matched with the object, displaying recommended content related to the object; in response to receiving a selection for a different object on the screen shot image by moving a focus frame, updating presentation of recommended content based on the selected different object.
US11102420B2

A method is disclosed for improving the quality of photographs taken in low-light conditions by adjustment of shutter speed and digital gain based on a shutter prioritization value. Using a network of sensor, a digital camera processes various parameters, such as luminance of the scene and movement of the camera or of subjects within the scene, to compute a shutter prioritization value. The value is then used to select the most appropriate shutter speed and digital gain combination from a constant exposure curve. Higher prioritization values correspond to faster shutter speeds and higher digital gain. Lower prioritization values correspond to lower shutter speeds and lower digital gain. In further embodiments, the shutter prioritization value may be manually customized by a user in order to produce artistic effects.
US11102412B1

A controller of an imaging apparatus performs, if the controller can not obtain information on a focal length of an interchangeable lens from the interchangeable lens, the controller controls to perform an image stabilization operation using, as the focal length, an estimated focal length calculated based on at least one of a combination of a detected shake amount and an image motion amount in image data, or a combination of the detected shake amount and a motion amount of an image sensor. The controller controls whether to execute or stop the image stabilization operation by a first image stabilizer based on at least one of a correlation between the detected shake amount and the image motion amount, or a correlation between the detected shake amount and the motion amount of the image sensor.
US11102407B2

A powered device receives power from at least one of a first power supply and a second power supply having a voltage higher than a voltage of the first power supply. The powered device includes a first load unit, a second load unit electrically separated from the first load unit, and a changing unit configured to supply power from the first power supply to the first load unit and the second load unit in a case where the first power supply is connected to the powered device and the second power supply is not connected to the powered device, and supply power from the second power supply to the first load unit and from the first power supply to the second load unit in a case where the first power supply and the second power supply are connected to the powered device.
US11102402B2

There is provided an image processing apparatus including an association section configured to, in a case where panorama image data generated by using a plurality of frame image data obtained by an imaging operation while displacing an imaging direction is determined to be a full circumference panorama image, associate the panorama image data with information showing that the panorama image data is the full circumference panorama image.
US11102391B2

A medical image acquisition system includes an imaging device and an image processing device. The imaging device includes: an imaging unit configured to receive light and convert the light into an electric signal so as to generate the imaging signal; an optical unit including a focus mechanism moving one or a plurality of lenses so as to adjust a focal point position, and configured to form an optical image on the imaging unit; a memory configured to store therein unique information of the imaging device; and an auto focus controller configured to totally control the imaging device. The image processing device includes an auto focus evaluation unit configured to perform focusing evaluation based on the imaging signal, and the auto focus controller controls driving of the focus mechanism by referring to the unique information in accordance with an evaluation result by the auto focus evaluation unit.
US11102384B2

A camera substrate assembly, a camera apparatus, and a terminal device, where the camera substrate assembly includes a rigid support plate and a printed circuit board laminated, where at least two mounting holes for accommodating camera chips are disposed on the printed circuit board, the rigid support plate has mounting surfaces facing the mounting holes respectively and are configured to support the camera chips, strength of the rigid support plate is greater than strength of the printed circuit board, and flatness of the mounting surfaces is less than a specified threshold. The mounting holes disposed on the printed circuit board and the mounting surfaces disposed on the rigid support plate are used to support cameras. This avoids impact of warpage on camera mounting when the printed circuit board and a flexible circuit board are laminated, and improves flatness after camera mounting.
US11102380B2

The present invention discloses a motion detection circuit applied to CIS and a motion detection method. Through the current frame pixel signal sampling branch and the previous frame pixel signal sampling branch, the sampling of the current frame and the previous frame pixel signal is respectively controlled, and the previous frame pixel signal is transmitted to the first end of the first capacitor and the second capacitor connected in series, and then the first error reference signal and the second error reference signal related to the pixel signal of the previous frame, which are respectively output by the second ends of the first capacitor and the second capacitor that are not connected, are transmitted to the first comparator branch and the second comparator branch of the comparator branch respectively, by judging the high and low-state of the comparison signals of the current frame pixel signal and the first error reference signal, and the current frame pixel signal and the second error reference signal respectively output by the first comparator branch and the second comparator branch, so as to determine whether an image point reflected by the pixel points of the pixels connected with the motion detection circuit has moved or not.
US11102373B2

An image forming apparatus includes an image forming device and circuitry. The image forming device is configured to form an image on a medium. The circuitry is configured to detect a position of the image forming device relative to the medium. The circuitry is further configured to control the image forming device based on the position of the image forming device detected and image data. The circuitry is further configured to control a system state of the image forming device based on the position of the image forming device associated with movement of the image forming device relative to the medium.
US11102366B2

An image forming apparatus includes a document reading unit reading an image of a document and generating scan data of the document and a printing unit printing on a sheet the scan data generated by the document reading unit, and is configured to be able to feed the sheet subjected to printing by the printing unit to a post-processing device. The image forming apparatus includes a judging unit that judges whether an image of a post-processing mark which is composed of a staple mark or a punching hole is present in the scan data generated by the document reading unit, and a printing control unit that, when the judging unit judges that the image of the post-processing mark is present in the scan data, generates corrected data by deleting the image of the post-processing mark from the scan data and causes the printing unit to print the corrected data.
US11102365B2

An edge detecting device includes processing circuitry. The processing circuitry is configured to acquire first color information and second color information in an image including a document region and a background region outside the document region. The first color information is color information of the background region and the second color information is color information of the document region. The processing circuitry is configured to detect a boundary between the background region and the document region from a change in color information between the first color information and the second color information.
US11102358B2

An image forming apparatus includes a plurality of parts each configured to operate to form an image; and at least one processor configured to control an operation of the image forming apparatus. The at least one processor has a function of executing the following processing: error detection processing of detecting occurrence of an error of each part; failure portion identification processing of identifying a failure portion which is a cause of the error; and determination processing of determining, in a case where the image forming apparatus is reactivated after the identification of the failure portion by the failure portion identification processing, whether there is a failure in a part corresponding to the failure portion information before execution of a preparation operation for enabling an image forming operation.
US11102345B2

A method for qualifying identity in a communication network upon initiation by caller terminal of a communication to a called terminal is described. The method is performed by the called terminal and includes receiving at least one identity of the calling terminal certified by a trusted third-party, as well as at least one non-certified identity of the calling terminal, and presenting the user of the called terminal with information representative of at least one of the identities of the calling terminal, accompanied by an indication representative of a qualification information indicating whether the at least one identity of the calling terminal is or is not certified by a trusted third party.
US11102344B1

A system may include a processor that may execute computer-executable instructions that cause the processor to receive caller information regarding an incoming communication from a caller and receive a request from a user to route the incoming communication to a virtual assistant application. The virtual assistant application is configured to interact with the caller and determine whether the caller is associated a fraudulent caller activity stored on databases accessible by the processor. The processor may then receive an indication from the virtual assistant application that the caller is associated with the fraudulent caller activity and forward the incoming communication to another party in response to receiving the indication.
US11102343B2

The present disclosure relates to a mobile terminal capable of sensing an operation for gripping a terminal, including: a main body having a case for forming an exterior; a memory for storing a plurality of pieces of visual information; a touch screen arranged at the front surface of the main body and displaying at least one of the plurality of pieces of visual information; a grip sensor arranged at a lateral surface of the main body and attached to an inner surface of the case so as to sense a user input applied to the lateral surface; and a control unit for executing a select-all function, which sets at least one of the pieces of displayed visual information into an editable selection state, on the basis of the sensing of the user input through the grip sensor during the execution of an editing mode for editing the plurality of pieces of visual information, wherein the control unit does not set remaining pieces of visual information, excluding at least one piece of displayed visual information, into the selection state even if the select-all function is executed.
US11102342B2

As a user interacts with a voice application, a history of the prompts played to the user and the users responses are displayed to the user. The displayed prompts and displayed responses could be summaries of the prompts and responses, or they could be full transcriptions of the prompts and responses. A user may be able to select a prompt or response in the history to return to a certain point in the voice application. It may be possible for a user to save a history of the interactions that occurred when a voice application was performed, and to recall the history to continue on from a selected location in the history.
US11102339B2

A display device includes: a display module; a support part on a rear surface of the display module and comprising a support plate and a plurality of support bars; a first case accommodating the display module and the support part; a second case combined with the first case so as to be moved in a direction away from or close to the first case along a first direction; and a sub-support part under the support part so as to overlap a part of the support part, wherein both sides of the plurality of support bars are respectively inserted into first guide grooves defined in inner surfaces of the first case, which face with each other in a second direction crossing the first direction, and the plurality of support bars are configured to be moved along the first guide grooves.
US11102338B2

A remote controller includes a remote controller body including a control device configured to receive a remote-control command. The remote controller further includes an antenna and a holding mechanism movably connected to two opposite sides of the remote controller body, respectively. The holding mechanism is configured to hold a mobile terminal. The remote controller further includes a connecting mechanism connected between the remote controller body and the holding mechanism and configured to enable the holding mechanism to move relative to the remote controller body to be in an extended state or in a contracted state.
US11102337B2

Systems, methods, and computer-readable media for receiving an indication of an equivalence failure, the equivalence failure corresponding to one or more models of network intents. The indication of the equivalence failure is analyzed and one or more constituent intents that caused the equivalence failure are identified, wherein the one or more constituent intents are associated with a model of the one or more models of network intents. The granularity of the equivalence failure and the identified one or more constituent intents is determined, and an event for external consumption is generated, the event based at least in part on the equivalence failure, the granularity of the equivalence failure, and the identified one or more constituent intents.
US11102325B2

Dynamically transforming web content is described. An HTTP request is received from an Internet client. The web resource identified in the HTTP request is accessed. The content of the web resource is analyzed. A set of transformation instructions are applied on a set of identified portions of the content of the web resource. Each applied transformation instruction includes logic to locate and manipulate at least an identified portion of the content, and at least one of the applied transformation instructions is a client-side script transformation instruction that performs one or more of: modify a client-side script included in the content, remove a client-side script included in the content, and add a client-side script to the content. An HTTP response is rendered that includes the results of the applied transformation instructions and further includes those portions of the content that were not manipulated by a transformation instruction. The response is then transmitted to the Internet client.
US11102316B1

A system and method to track whether users are viewing different sections of content in an email. The method and system tracks the scrolling behavior of recipients of an email by identifying the sections of an email that the recipients have viewed by tracking the touching of these sections in the case of a touch device or tracking of the cursor hovering over these sections in the case of a computer with a cursor and subsequently sending the activity to a remote server to be stored and aggregated.
US11102309B2

Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for pairing a speech-enabled device with a display device. A determination may be made to pair a speech-enabled device with a display device of a particular type. A set of display devices that are associated with the speech-enabled device may be identified in response to determining to pair the speech-enabled device with the display device of the particular type. An instruction may be provided to each of the display devices. The instruction may cause the display device to determine (i) whether the display device is of the particular type and (ii) whether the display device and the speech-enabled device both share a local area network and display on the display device an indication regarding pairing with the speech-enabled device.
US11102308B1

A software and/or data mobility platform. The mobility of software and data in an edge network is achieved by loading software and/or data on an edge node. The software and data are replicated or migrated to neighbor nodes and prepared for the device when the device switches nodes. As the device switched nodes, clean up or mobility operations are performed by replicating or migrating the software/data to new neighbor nodes and deleting or removing the software/data from nodes that are no longer considered to be neighbor nodes. The software is typically deployed to the mobility platform rather than directly to the nodes to allow developers to focus on their application rather than on the mobility of the application.
US11102296B2

Methods and systems for datacenter migrations are disclosed. A method includes: virtualizing, by a computing device, servers in a source environment; installing, by the computing device, an isolation firewall to isolate a target environment from the source environment; installing, by the computing device, shared services in the target environment; installing, by the computing device, monitoring and management tools in the virtualized servers in the source environment; replicating, by the computing device, between the source environment and the target environment; and cutting over, by the computing device, from the source environment to the target environment by switching a route advertisement from the source datacenter to the target datacenter.
US11102293B2

In a network of mobile agents, data integrity can be improved by providing an agent server that can migrate between devices operating in the region of interest (ROI). The agent server distributes agent clients onto devices in the ROI and provides agent server services to the agent clients, including receiving and storing data from the agents. When the agent server device is to leave the ROI, the agent server can migrate to any device executing an agent client and continue to provide the agent server services, including data collection and aggregation, from the device to which the agent server has migrated.
US11102291B2

Methods and apparatus for coordinating inter-region operations in provider networks. An inter-region coordinator (IRC) operates asynchronously to the control planes of regional networks to coordinate inter-region operations. The IRC in a region may include one or more IRC servers. To perform inter-region operations, the servers may implement a local-remote-local method in which a server invokes an API in the local region to get work, sends the work to a control plane of a remote region, receives a response from the remote region, and informs the control plane in the local region of the status of the work.
US11102288B2

Techniques for performing peer discovery in a wireless network are described. A device may perform peer discovery to detect and identify other devices of interest. In an aspect, the device may perform peer discovery based on a hybrid mode that includes autonomous peer discovery and network-assisted peer discovery. In another aspect, the device may perform peer discovery based on a push mode and a pull mode. For the push mode, the device may occasionally transmit and/or receive a peer detection signal. For the pull mode, the device may transmit and/or receive a peer discovery request when triggered. In yet another aspect, the device may perform event-triggered peer discovery (e.g., for the pull mode). In yet another aspect, the device may perform peer discovery using both a downlink spectrum and an uplink spectrum. In yet another aspect, the device may transmit a peer detection signal in a manner to improve detection and/or increase payload.
US11102274B2

A system and method are disclosed for providing geocoded web content to a user based on a specific geographic location specified by the user. A determination module receives a geographic location from the user and determines latitude and longitude coordinates associated with the geographic location from a geographic information database. The determination module further determines a geographic boundary associated with the latitude and longitude coordinates based at least in part on an area of interest surrounding the geographic location. A web content search module determines web content comprising substance associated with a location within the geographic boundary. A front end interface transmits the determined web content for display in an order based at least in part on distance from the location associated with the web content to the geographic location.
US11102268B2

An RTP disconnection detection function is operated properly even when networks having different timer values are connected. A first monitoring timer 11 configured to count a first timer value representing a predetermined time from when a callee transmission packet transmitted from a callee terminal 6 is interrupted, a second monitoring timer 12 configured to count a second timer value representing a predetermined time from when a caller transmission packet transmitted from a caller terminal 1 is interrupted, a first relay interpolation unit 14 configured to relay the callee transmission packet to the caller terminal 1, and while the first monitoring timer 11 times out and the second monitoring timer 12 performs counting, generate a callee interpolation packet for interpolating the callee transmission packet and transmit the generated callee interpolation packet to the caller terminal 1, and a second relay interpolation unit 15 configured to relay the caller transmission packet to the callee terminal 6, and while the second monitoring timer 12 times out and the first monitoring timer 11 performs counting, generate a caller interpolation packet for interpolating the caller transmission packet and transmit the generated caller interpolation packet to the callee terminal 6, are included.
US11102266B2

The present invention relates to a communication method and device. The communication method comprises: obtaining information related to a current network state; determining an appropriate codec mode set according to the information related to the current network state and information related to a service type; and carrying out service communication by using the appropriate codec mode set. According to the communication method, since the current network state is considered during determining of the codec mode set, the overall network performance is improved.
US11102249B2

A cybersecurity system is provided that sums and scores one or more cybersecurity controls for different client computing systems that each have different attributes, needs, and interests. In addition, the cybersecurity system provides to each different client computing system auto-suggestions that suggest one or more ways in which the client computing system may improve the confidentiality, integrity, and availability of the information stored on the client computing system and/or improve the confidentiality, integrity, and availability of the underlying characteristics of the client computing system. In addition, the cybersecurity system verifies that the functioning of the client computing system has improved.
US11102240B2

Early-warning decision method, node and system are provided in the present disclosure. The method includes obtaining a flow analysis result of a portion of service requests that are targeted at a same server; calculating a flow of all the service requests that are targeted at the server based on a flow indicated by the flow analysis result and a weight of a current distributed node, the weight being a weight or proportion of all the service requests targeted at the server that accounts for the flow indicated by the flow analysis result that is obtained by the current distributed node; comparing a flow of all the service requests that are targeted at the server with an abnormal flow threshold; and determining whether to send an instruction for performing subsequent processing on the server based on a comparison result.
US11102238B2

An endpoint in an enterprise network is monitored, and when a potential trigger for a distributed denial of service (DDoS) attack is followed by an increase in network traffic from the endpoint to a high reputation network address, the endpoint is treated as a DDoS service bot and isolated from the network until remediation can be performed.
US11102237B2

Systems and methods are provided for detecting malware. The method includes receiving a request for a web page; determining expected attributes of the web page; generating a modified web page by combining the web page with code for detecting malware; transmitting the modified web page to a client device; receiving data collected from the executed version of the modified web page; determining attributes of the executed version of the modified web page; comparing the expected attributes with the attributes of the executed version of the modified web page; and determining whether the malware is present on the client device based on the comparison.
US11102236B2

Systems and methods provide for identification and remediation of IoT devices exhibiting anomalous behaviors. An IoT management system can identify IoT devices requiring remediation. The IoT management system may present a first interface including representations of the devices requiring remediation, where each representation can include identifying information for an IoT device, policies applied to the IoT device, and bandwidth/throughput information of the IoT device. The IoT management system can present a second remediation interface representing a detailed representation of a first IoT device. The detailed representation can include user interface elements representing actions to be performed relating to the first IoT device. The IoT management system can perform a first action corresponding to a selection of one of the user interface elements.
US11102234B2

Methods and systems for scanning an endpoint terminal across an open computer network are disclosed. An exemplary method includes providing a scanner engine in a computer server in communication with an open computer network, and establishing a secure connection across the open computer network between the scanner engine and a scanner agent installed on the endpoint terminal in communication with the open computer network. Commands for collecting data regarding the endpoint terminal are sent from the scanner engine across the secure connection to the scanner agent. The scanner engine then receives the collected data from the scanner agent across the secure connection, analyzes the data to assess a current posture of the endpoint terminal, and determines any updates for the endpoint terminal from the analysis. Updates are sent across the secure connection to the scanner agent for installation on the endpoint terminal, and the secure connection may then be terminated.
US11102229B2

An illustrative embodiment of a computer-implemented process for identifying a request invalidating a session excludes all marked logout requests of a Web application, crawls an identified next portion of the Web application and responsive to a determination, in one instance, that the state of the crawl is out of session, logs in to the Web application. The computer-implemented process further selects all crawl requests sent since a last time the crawl was in-session, excluding all marked logout requests and responsive to a determination that requests remain, crawls a selected next unprocessed request. Responsive to a determination, in the next instance, that state of the crawl is out of session and the selected request meets logout request criteria, the computer-implemented process marks the selected request as a logout request.
US11102221B2

A corpus of documents (and other data objects) stored for an entity can be analyzed to determine one or more topics for each document. Elements of the documents can be analyzed to also assign a risk score. The types of topics and security elements, and the associated risk scores, can be learned and adapted over time using, for example, a topic model and random forest regressor. Activity with respect to the documents is monitored, and expected behavior for a user determined using a trained recurrent neural network. Ongoing user activity is processed to determine whether the activity excessively deviates from the expected user activity. The activity can also be compared against the activity of user peers to determine whether the activity is also anomalous among the user peer group. For anomalous activity, risk scores of the accessed documents can be analyzed to determine whether to generate an alert.
US11102212B2

Embodiments of the invention eliminate problems associated with annotation dependency when providing data protection operations. A proxy register is provided such that proxies can register with the data protection servers. The proxies identified in the proxy register, for each server, are uniquely identified in the proxy register and the proxy register ensures that proxies participating in the performance of data protection operations are excluded from being protected while unregistered proxies can be protected by the data protection application.
US11102207B2

Adding an internet location to a greylist includes receiving a login pairing that includes login credentials and an internet location that the login credentials are received from. A successful login number of prior successful logins associated with the login pairing is determined and the internet location may be added to the greylist based at least in part on the successful login number.
US11102205B2

A system for remotely controlling a document includes a server, an intelligent mobile device, and a first client device. The server stores a first identification datum corresponding to the intelligent mobile device and at least a second identification datum corresponding to the first client device. The intelligent mobile device and the first client device respectively installed with a remote control client APP program and a first customer client APP program. The intelligent mobile device uses the remote control client APP program to set up a user permission of an electronic document. The intelligent mobile device uses the remote control client APP program to transmit the electronic document to the server according to the second identification datum. The first client device uses the first customer client APP program to download the electronic document from the server and control the electronic document according to the user permission.
US11102200B1

In general, the techniques of this disclosure describe a computing device that is configured to verify an identity of a user based on authentication factors received from multiple authentication devices. The computing device, which may be configured to operate as a server device, may receive an authentication factor from at least three authentication devices in a group of three or more authentication devices via a guard device. The computing device may determine a probability that the respective user of each respective authentication device is a particular trusted user based on the received authentication factors. If the probability exceeds a threshold authentication probability, the computing device may send an authentication confirmation to a client device.
US11102194B2

Secure network communications are described. In one aspect, a secure network can include a passbuilder that provides policy information related to performance characteristics of the secure network. A sender can receive the policy information and transmit packets to a receiver if the policy information is complied with by the potential packet transmission.
US11102191B2

Embodiments of the disclosure enable single sign-on for secure network services. In one embodiment, a method is provided. The method comprises providing, by a processing device of a first server, a prompt for first login information associated a second server. An authentication request is transmitted on behalf of a client to the second server to authenticate the first login information received from the client. An authentication ticket is provided to the client in view of the first login information. The authentication ticket is received from the second server in response to authentication of the first login information. A service request comprising the authentication ticket and a request to access a service associated with the first server is received from the client. Thereupon, access to the service by the client is enabled by applying the authentication ticket, without prompting the client for entry of second login information.
US11102187B2

Systems, methods, and software are disclosed for managing workflow transactions including protected personal data (PPD) in regulated computing environments. The method includes determining, by a first application, that a record of a first network group includes PPD; transmitting, by the first application, a packet to an encryption logging service application in response to determining that the record includes the PPD; encrypting, by the encryption logging service application, the PPD payload and a data identification record; transmitting, by the encryption logging service application: the encrypted PPD payload, the encrypted data identification record, and an unencrypted header, to a system log database; decrypting, by the encryption logging service application, the encrypted PPD payload in response to a query of a system log database by a second network group for data contained in the unencrypted header; and transmitting, by the encryption logging service application, the decrypted PPD payload to the second network group.
US11102184B2

A computer-implemented method comprises: committing a transaction amount of a transaction with a commitment scheme to obtain a transaction commitment value, the commitment scheme comprising at least a transaction blinding factor; generating a first key of a symmetric key pair; encrypting a combination of the transaction blinding factor and the transaction amount t with the first key; and transmitting the transaction commitment value T and the encrypted combination to a recipient node associated with a recipient of the transaction for the recipient node to verify the transaction.
US11102174B2

Introduced here are Internet monitoring platforms configured to define, monitor, and assess the boundary of a private network associated with a client. By monitoring the entire Internet, a private network, and relationships between these networks, an Internet monitoring platform can discover changes in the boundary of the private network that is defined by those assets on the private network capable of interfacing with a public network, such as the Internet. The Internet monitoring platform may, in response to discovering the boundary of the private network has experienced a change, identify an appropriate remediation action by mapping the change to a technological issue, a relevant business relationship, etc. For example. If the Internet monitoring platform discovers that the boundary of the private network has expanded due to the introduction of a new cloud computing asset, the Internet monitoring platform may automatically reconfigure a network tool so that traffic generated by the new computing device is examined.
US11102163B2

A communication technique for providing a mobile gateway in a radio node (such as an eNodeB) in a local wireless network that is associated with a venue is described. During the communication technique, the radio node may provide, via the mobile gateway, cellular-telephone-network services. In particular, the mobile gateway may implement functions including: providing, when an electronic device attaches to the local wireless network, an Internet Protocol (IP) address to the electronic device based on a media access control (MAC) address for the electronic device, which is, in part, provided by a mobile management entity (MME) in a cellular-telephone network; triggering, via a supported interface, paging to the electronic device when the electronic device is in idle in the local wireless network; transmitting uplink data and receiving downlink data via a cellular-telephone communication protocol (such as Long Term Evolution or LTE); and/or electronic-device mobility in the local wireless network.
US11102149B2

Switches and groups of IO ports may be divided into separate switch modules and IO modules that can be connected by high-speed low-loss management cables in a variety of configurations. Thereafter, the separate modules may be replaced independently of each other. The switch module may recognize, and thereafter ignore, unconnected ports, removing the performance penalty that sometimes arises when fewer than all available ports are connected. The switch module may rapidly adjust to addition, subtraction, and replacement of connected IO modules.
US11102148B2

A device for computing a routing path from a source node to a destination node across a 6TISCH mesh network comprising a plurality of nodes, the device comprising: an interface for communicating with one or more nodes in the network; a memory configured to store data regarding the stability and availability of individual nodes in said network to receive packet data; a controller configured to: employ said data regarding the stability and availability of individual nodes in said network to receive packet data to calculate a path stability metric for each of a plurality of potential routing paths between said source node and said destination node, employ said path stability metric to select one of said plurality of potential routing paths for data transmission between said source node and said destination node, and cause said interface to transmit a signal configured to cause said plurality of nodes to transmit data from said source node to said destination node via said selected route.
Patent Agency Ranking