US11099902B1
Distributed machine learning systems and other distributed computing systems are improved by embedding compute logic at the network switch level to perform collective actions, such as reduction operations, on gradients or other data processed by the nodes of the system. The switch is configured to recognize data units that carry data associated with a collective action that needs to be performed by the distributed system, referred to herein as “compute data,” and process that data using a compute subsystem within the switch. The compute subsystem includes a compute engine that is configured to perform various operations on the compute data, such as “reduction” operations, and forward the results back to the compute nodes. The reduction operations may include, for instance, summation, averaging, bitwise operations, and so forth. In this manner, the network switch may take over some or all of the processing of the distributed system during the collective phase.
US11099901B2
A method for resource allocation and a terminal device are provided. The method includes the following. System-state information of a terminal device is acquired, and the terminal device has a target application running in a foreground of the terminal device. An internal running scenario of the target application is determined according to the system-state information. A performance improvement strategy corresponding to the internal running scenario is acquired. Allocation of system resources for the internal running scenario is adjusted according to the performance improvement strategy.
US11099898B2
A method for allocating memory resources and a terminal device are provided. The method is applied to the terminal device. The terminal device includes a rich execution environment (REE) and a fingerprint trust application (TA). The method includes the following. In response to a request for memory resources from the fingerprint TA, the REE obtains N values of memory resources requested at N time points within a preset period by the fingerprint TA, where each of the N values of memory resources is in one-to-one correspondence with one of the N time points and N represents an integer larger than 1. The REE determines a target value of memory resources according to the N values of memory resources, and allocates memory resources equal in value to the target value of memory resources for the fingerprint TA.
US11099895B2
Resource provisioning to a process in a distributed computing system, such as a cloud computing system. An instruction to provision a resource is received. Portions of the resource are provisioned to the process as they become available, and prior to all portions becoming available, based on determining that the provisioning speed is greater than or equal to the use speed for the resource. If the use speed is faster, it may be actively slowed down.
US11099880B2
A processing device comprises an address translation circuit to intercept a work request from an I/O device. The work request comprises a first ASID to map to a work queue. A second ASID of a host is allocated for the first ASID based on the work queue. The second ASID is allocated to at least one of: an ASID register for a dedicated work queue (DWQ) or an ASID translation table for a shared work queue (SWQ). Responsive to receiving a work submission from the SVM client to the I/O device, the first ASID of the application container is translated to the second ASID of the host machine for submission to the I/O device using at least one of: the ASID register for the DWQ or the ASID translation table for the SWQ based on the work queue associated with the I/O device.
US11099879B2
In one example, a system for executing applications can include a main processor to initialize a virtual machine to execute an application. The main processor can also determine a main utilization indicator of the main processor is above a threshold and an auxiliary utilization indicator of an auxiliary processor is below a threshold, wherein the auxiliary processor is based on an auxiliary instruction set architecture. Additionally, the main processor can transmit an instruction from the application to the auxiliary processor for execution and update context data for the application in response to receiving an execution result from the auxiliary processor.
US11099867B2
Conversation user interfaces that are configured for virtual assistant interaction may include contextual interface items that are based on contextual information. The contextual information may relate to a current or previous conversation between a user and a virtual assistant and/or may relate to other types of information, such as a location of a user, an orientation of a device, missing information, and so on. The conversation user interfaces may additionally, or alternatively, control an input mode based on contextual information, such as an inferred input mode of a user or a location of a user. Further, the conversation user interfaces may tag conversation items by saving the conversation items to a tray and/or associating the conversation items with indicators.
US11099866B2
An apparatus stores status information and workload information for each task executed by a user. The apparatus detects, based on the status information, completion of a first task, and withholds notification of first help information related to software selected based on a usage state of the software in the first task. The apparatus detects, based on the status information, completion of a second task after completion of the first task, and calculates, based on the workload information, an index value indicating a total workload of completed tasks including the first and second tasks. When the index value is greater than a threshold, the apparatus allows providing the user with notification of the first help information and second help information related to the software selected based on a usage state of the software in the second task; otherwise the apparatus withholds notification of the first and second help information.
US11099862B1
Embodiments of the present disclosure relate to systems for performing operations that include: receiving a first media object, such as a digital representation of a logo (e.g., JPEG, TIFF, PNG, BMP, etc.), wherein the first media object comprises at least color data that defines a set of colors of the media object; detecting the set of colors of the first media object responsive to receiving the first media object; selecting a portion of the set of colors of the first media object; and generating an interface to configure a second media object, the interface comprising a display of one or more configuration options that include a color selection, the color selection comprising a presentation of the portion of the set of colors.
US11099858B2
A self-adaptive field device is disclosed having a repository, an identity register and a firmware framework having static firmware modules. Further disclosed is an industrial automation system of self-adaptive field devices, and a method for configuring such a system. The method includes booting each field device, evaluating each field device, and initialising each field device. The method may further include resource load balancing.
US11099853B2
Digit validation check control for execution of an instruction. A process obtains an instruction to perform operation(s) using input value(s). The instruction includes a no validation indicator for controlling whether digit validation check control is enabled for execution of the instruction. The process executes the instruction, including determining, based on the no validation indicator, whether digit validation check control is enabled for execution of the instruction, and performing processing based on the determining. Based on the no validation indicator being set to a defined value, digit validation check control is enabled and the processing includes forcing a digit check error indicator output by the executing to indicate no digit check error with respect to the at least one input value.
US11099848B1
An apparatus comprises: processing circuitry, an instruction decoder, and registers. In response to an overlapped-immediate/register-field-specifying (OIRFS) instruction comprising an opcode field specifying an OIRFS-indicating opcode value, and an overlapped immediate/register field specifying an immediate value and a register specifier, the instruction decoder controls the processing circuitry to use a selected register of the plurality of registers corresponding to the register specifier as a source register or destination register when performing a processing operation depending on the immediate value. The overlapped immediate/register field includes at least one shared bit decoded as part of the immediate value for at least one encoding of the OIRFS instruction and decoded as part of the register specifier for at least one encoding of the OIRFS instruction.
US11099838B1
A system and method for monitoring and recovering a heterogeneous integrated circuit, such as an FPGA, operating with firmware. A firmware image for the integrated circuit is stored in a storage device. The operational status of the integrated circuit is periodically determined via a controller such as a BMC. A failure of the integrated circuit is determined. The stored firmware image is sent to the integrated circuit. The firmware image is installed on the integrated circuit. The controller determines whether the installation of the firmware image results in restoration of the integrated circuit.
US11099837B2
A technique controls a new software build. The technique involves receiving abstract hash values for source code components. Each abstract hash value is derived from a most recent source code version of a respective source code component. The technique further involves generating new build fingerprints based on the abstract hash values. The new build fingerprints are different from the abstract hash values received for the source code components. The technique further involves building particular software components of the new software build based on comparisons between the new build fingerprints and respective previous build fingerprints generated during a set of previous software builds.
US11099835B1
A continuous integration framework for developing software for transaction processing and method for using the same are described. In one embodiment, the method comprises generating a trusted artifact with a forward immutable continuous integration (CI) implemented as a build pipeline, wherein the artifact comprises updated software comprising payment processing code with an EMV vector kernel for processing of EMV-based card present transactions; and in response to the software update, performing end-to-end testing of EMV card present transactions using code commits from one or more code repositories, wherein the end-to-end testing comprises executing the code commits that includes executing payment processing code for processing EMV-based card present transactions with an EMV vector kernel and one or more emulated EMV cards, and running tests against the executing code commits to validate behavior the payment processing code including the EMV vector kernel, wherein the tests comprise running one or more emulated EMV cards against the vector kernel as part of one or more emulated EMV-based card present transactions and monitoring communications related to the one or more emulated EMV-based card present transaction communications.
US11099833B2
A system and method of modifying an application implementation. Modification of application implementation may include modification, addition, and/or removal of machine-readable instructions. Modification of machine readable instructions prior to run-time may modify implementation of one or more features. Physical computer processor(s) may be configured by computer readable instructions to obtain machine-readable instructions. Machine-readable instructions may, cause a target computing platform to implement an application when executed. Physical computer processor(s) may obtain information regarding implementation of the application by the target computing platform and analyze the machine-readable instructions and/or the information to create one or more rules for modifying application implementation by the computing platform. Physical computer processor(s) may modify the machine-readable instructions based on the rules to add features to and/or remove features from the machine-readable instructions. The system may distribute the modified machine-readable instructions to effectuate the modified machine-readable instructions to be implemented by the target computing platform.
US11099832B2
Method for updating a bootloader of a controller of a light, comprising at least one processor, at least one bootloader storage area, at least one application storage area, and a file storage area, a first bootloader file stored in a first bootloader storage area, said method comprising: transfer-ring to the controller a bootloader updating programme packet provided outside of the controller and which comprises or can generate a bootloader updating file which comprises either a complete up-to-date second bootloader file or programme parts supplementing the first bootloader file to form an up-to-date second bootloader file, storing the bootloader updating file in the file storage area of the controller, and, in the case of a sufficient minimum voltage being available to the controller, writing the first bootloader storage area with the bootloader updating file from the file storage area.
US11099817B1
Operations may include generating a first graphical representation of a buggy version of source code of a software program and generating a second graphical representation of a repaired version of the source code. The buggy version may include an error and the error has been corrected in the repaired version. The operations may also include identifying, as matching nodes, a first node of the first graphical representation and a second node of the second graphical representation that match each other. The operations may additionally include applying a same reduction to the first node and to the second node concurrently to generate a reduced buggy version of the source code and a reduced repaired version of the source code. Further, the operations may include generating a repair example with respect to correcting the error in which the repair example is based on the reduced buggy version and the reduced repaired version.
US11099815B2
In described examples, an apparatus is arranged to generate a linear term, a quadratic term, and a constant term of a transcendental function with, respectively, a first circuit, a second circuit, and a third circuit in response to least significant bits of an input operand and in response to, respectively, a first, a second, and a third table value that is retrieved in response to, respectively, a first, a second, and a third index generated in response to most significant bits of the input operand. The third circuit is further arranged to generate a mantissa of an output operand in response to a sum of the linear term, the quadratic term, and the constant term.
US11099803B2
Provided is a method of providing information through a mobile device, in which an information providing screen is outputted only during the first activation performed within a predetermined time range designated by a user. Therefore, inconvenience resulting from repetitive outputs of the information providing screen can be resolved.
US11099802B2
An apparatus comprising means for: enabling a first virtual reality (VR) user to control movement of a first virtual user in a virtual space, wherein the one or more non-VR users are represented in the virtual space by one or more, respective, separate virtual visual elements; enabling selection in the virtual space of a virtual visual element representative of a non-VR user to select one of the one or more non-VR users; newly creating two-way audio communication between the selected one of the one or more non-VR users and a second VR user by enabling audio from the second VR user to be rendered to at least the selected one of the one or more non-VR users and audio from at least the selected one of the one or more non-VR users to be newly rendered to the second VR user.
US11099799B2
A method for controlling a display device includes: receiving history information about an operation to a first operation image for a setting of the display device, from a terminal device displaying the first operation image; generating display information used to display a second operation image for a setting of the display device, using the history information; and transmitting the display information to the terminal device.
US11099796B2
An information processing apparatus communicates with a plurality of network interfaces of an external apparatus, acquires identification information for identifying the external apparatus and apparatus information about the external apparatus from the external apparatus via a network connected to the plurality of network interfaces, and stores the acquired identification information and the acquired apparatus information in association with each other. If a plurality of pieces of identification information is stored and a plurality of pieces of identical identification information is present in the pieces of identification information, only one piece of apparatus information corresponding to the identification information is displayed.
US11099778B2
A first command is scheduled on a command bus, where the first command requires use of a data bus resource at a first time period after scheduling the first command. Prior to the first time period, a second command is identified according to a scheduling policy. A determination is made whether scheduling the second command on the command bus will cause a conflict in usage of the at least one data bus resource. In response to determining that scheduling the second command will cause the conflict in usage, a third lower-priority command is identified for which scheduling on the command bus will not cause the conflict in usage. The third command is scheduled on the command bus prior to scheduling the second command, even though it has lower priority than the second command.
US11099775B2
A data storage device includes at least one non-volatile memory and a controller with two-layer architecture. The two-layer architecture includes a front end coupled to a host and a back end coupled to the non-volatile memory. The controller includes a command processor and at least one non-volatile memory controller. The command processor is arranged on the front end to communicate with the host, and it schedules the operation of the data storage device based on an external command from the host. The non-volatile memory controller is arranged on the back end, and it controls the non-volatile memory based on the schedule of the command processor. When the non-volatile memory increases, the non-volatile memory controller also increases correspondingly while the amount of command processors remains the same.
US11099773B1
A memory system includes a memory device and a controller. The controller receives data from a host, allocates buffers after a throttling delay, buffers the data in the buffers, provides the buffered data to the memory device for a write operation, generates a response associated with the write operation, and transmits the response to the host. The controller inserts a throttling delay before allocating the buffers and/or transmitting the response. The throttling delay is determined based on a time elapsed since providing previously buffered data to the memory device and the size of the buffered data. The throttling delay is corrected based on the difference of the number of currently allocated buffers and a buffer reserve threshold.
US11099772B2
Methods, systems, and apparatus, including an apparatus for transferring data using multiple buffers, including multiple memories and one or more processing units configured to determine buffer memory addresses for a sequence of data elements stored in a first data storage location that are being transferred to a second data storage location. For each group of one or more of the data elements in the sequence, a value of a buffer assignment element that can be switched between multiple values each corresponding to a different one of the memories is identified. A buffer memory address for the group of one or more data elements is determined based on the value of the buffer assignment element. The value of the buffer assignment element is switched prior to determining the buffer memory address for a subsequent group of one or more data elements of the sequence of data elements.
US11099767B2
An apparatus includes at least one processing device comprising a processor coupled to a memory, with the processing device being configured to maintain throughput statistics for at least portions of one or more asynchronous replication cycles of a replication process carried out between a first storage system and a second storage system, and to control a transition of the replication process from an asynchronous replication mode to a synchronous replication mode based at least in part on the maintained throughput statistics. The throughput statistics are illustratively updated in conjunction with each of a plurality of detected suspensions of the synchronous replication mode, and the asynchronous replication mode is reinitiated responsive to each of the detected suspensions of the synchronous replication mode. Other embodiments include methods and computer program products.
US11099764B2
The present invention relates to a method for amending the firmware of a device with limited resources, the device comprises a memory unit, and a firmware amending software, and the firmware comprises: at least two functional components, wherein the first functional component comprises at least one public function, configured to be called by at least one second functional component different from the first functional component, a functional component table, wherein at least one of the functional components is registered, a call dispatch unit, where each call addressing one of the public functions is dispatched, wherein the firmware amendment comprises the steps for the firmware amending software of: storing a new functional component at a memory location of the memory unit, updating the functional component table with the memory location of said new functional component, and handing over control to the firmware.
US11099763B1
A method for utilizing a decentralized agreement protocol for data access operations in a dispersed storage network (DSN) including a legacy storage unit pool and one or more non-legacy storage unit pools. In response to obtaining a DSN address associated with a data access request, a DSN computing device(s) generates ranked scoring information for the legacy storage unit pool and the non-legacy storage unit pool, the ranked scoring information based at least in part on the DSN address, a first location weight associated with the legacy storage unit pool, and a second location weight associated with the non-legacy storage unit pool. In an embodiment, the first location weight decreases over time (e.g., as a generation of legacy storage units is retired). Based on the ranked scoring information, at least one of the legacy storage unit pool or the non-legacy storage unit pool is selected for processing the data access request.
US11099761B2
Techniques expand storage space. Such techniques can create a storage stripe group during a shuffling operation after a storage device being added, without waiting for full completion of the shuffling operation. Such techniques can effectively reduce the waiting time for creating the storage stripe group. Besides, such techniques can support partial mapping of the storage stripe group, such that the storage resources mapped to the storage stripe group can be rapidly utilized.
US11099748B1
A radiation hardened, digital to analog converter includes first and second serial communication circuits, a common bus interface configured to connect the first and second serial communication circuits to first and second digital serial communication buses, respectively, and a digital to analog converter circuit, where the first and second serial communication circuits are configured to receive data over the first and second digital serial communication buses, respectively, for use by the digital to analog converter circuit.
US11099747B2
Techniques are described herein for storing instances of data among nodes of a distributed store based on hierarchical scale unit values. Hierarchical scale unit values are assigned to the respective nodes of the distributed store. A first instance (e.g., a primary instance) of a data module is stored in a first node having a first hierarchical scale unit value. A primary instance of the data module with respect to a data operation is an instance of the data module at which the data operation with respect to the data module is initiated or initially directed. A second instance (e.g., a primary or secondary instance) of the data module is stored in a second node having a second hierarchical scale unit value based on a magnitude of a difference between the first hierarchical scale unit value and the second hierarchical scale unit value. A secondary instance is essentially a “back-up” instance.
US11099746B2
A method for data storage includes, in a network element, receiving from packet-processing circuitry at least a read command and a write command, for execution in a memory array that includes multiple single-port memory banks. When the read command and the write command are to access different memory banks in the memory array, the read command and the write command are executed for the packet-processing circuitry in the different memory banks in a same memory-access cycle. When the read command and the write command are both to access a first memory bank, a second memory bank of the memory array is selected. The read command is executed in the first memory bank and the write command is executed in the second memory bank, in the same memory-access cycle.
US11099740B2
Techniques manage a storage device. Such techniques involve: in response to receiving an I/O request for a storage device comprising a plurality of disks, determining, from the plurality of disks, at least one disk related to the I/O request; allocating, to each of the at least one disk, at least one access credit for completing the I/O request from total access credits of the disk, wherein the total access credits are associated with at least one of a type of the disk, a type of the I/O request and performance of the disk; and in response to respective access credits being allocated to the at least one disk, performing access requested by the I/O request to each of the at least one disk. Such techniques can effectively improve the overall access performance of the storage device.
US11099728B2
An electronic apparatus includes: a receiving unit configured to be receivable a user operation of designating a position on a display target displayed on a display and moving the designated position; and a control unit, wherein in a case where the display target is displayed at a second magnification that is higher than a first magnification at which an entire display target is displayed, the control unit performs, in response to a movement of the designated position within an edge region of a display range of the display target caused by the user operation, control to change a position of the display range in a direction corresponding to the designated position and to lower a display magnification of the display target to a magnification higher than the first magnification and lower than the second magnification.
US11099724B2
A medical imaging system (100) includes a user interface (110) and a magnifying view engine (130). The user interface displays a view of a medical image on a display device (114) and to provide a moveable indicator (116) identifying a moveable point positioned in the displayed medical image. The magnifying view engine (130) generates a localized enlargement of a region of interest within the displayed medical image in response to selection of an existing end point or an existing contour in the displayed medical image according to a first input by one or more input devices and indicated by a current position of the moveable indicator.
US11099717B2
A video playback method includes: obtaining playback progress information of all sub-files in a video file, where the video file includes at least two sub-files; displaying a playback progress bar list, where the playback progress bar list includes playback progress bars of the at least two sub-files, and a playback progress bar of any sub-file displays playback progress of the any sub-file according to playback progress information of the any sub-file; receiving a user instruction used for selecting, according to the playback progress bars, a target sub-file that needs to be played, where the target sub-file is any sub-file of the at least two sub-files; and playing the target sub-file according to the instruction.
US11099714B2
Systems and methods are directed to implementations involving creation, viewing, playing sharing and/or utilization of information modules, such as mixed-media modules. A processor communicates a mixed-media module creator interface to a first client device. The mixed-media module creator interface is configured to enable a first user of the first client device to create a mixed-media module, the mixed-media module comprising both an updatable portion and a searchable portion, and communicating a mixed-media module player interface to a second client device, the mixed-media module player interface different than the mixed-media module creator interface and configured to enable a second user using the second client device to play the mixed-media module in a non-linear format.
US11099708B2
In some examples, a system is to receive an input from an input device that senses a portion of a pattern on a three-dimensional (3D) object formed by 3D printing, map the sensed portion of the pattern onto a 3D location on the 3D object, and produce an output corresponding to the 3D location on the 3D object in response to the input.
US11099702B2
A touchscreen includes a first substrate, a second substrate, an adhesive, a first wiring layer, a second wiring layer, a through hole, and an electrically conductive adhesive. The first substrate includes a first transparent conductive film formed at a surface of the first substrate. The second substrate includes a second transparent conductive film formed at a surface of the second substrate. The adhesive adheres the first and second substrates to each other. The first wiring layer is formed on the surface of the first substrate. The second wiring layer is formed on the surface of the second substrate. The through hole pierces through the second substrate. The electrically conductive adhesive is provided in the through hole, and connects the first wiring layer and the second wiring layer.
US11099696B2
The present application discloses a touch substrate. The touch substrate includes a base substrate; a first touch electrode layer on the base substrate and including a plurality of first touch electrodes; a second touch electrode layer including a plurality of first coils; and a third touch electrode layer including a plurality of second coils. Each of the plurality of first touch electrodes is electrically connected to one of the plurality of first coils. The third touch electrode layer is insulated from the first touch electrode layer and the second touch electrode layer.
US11099678B2
The invention describes a device (101), in particular multimedia device, and a method, wherein the device at least comprises a screen (105), a processor unit (152) and at least one pressure sensor means (102), wherein the pressure sensor means (102) is mounted on a rigid element (106), wherein the rigid element (106) is more rigid than the screen (105), wherein the rigid element (106) is arranged on one side of the sensor means (102) and wherein the screen (105) is arranged on an opposing side of the sensor means (102), wherein a location detection unit (190) is provided, wherein the location detection unit (190) is configured to output a location signal, wherein the location signal provides location information for identifying the location where pressure is applied to the screen (105), wherein the pressure sensor means (102) is configured to output a pressure signal, wherein the pressure signal provides pressure information about the pressure measured by the pressure sensor means (102), wherein the processor unit (152) determines a pressure value for the pressure applied to the screen (105) by means of a location-pressure-function, wherein the location-pressure-function defines at least a dependency between the location information and the pressure information and wherein the processor unit (152) causes a function, an operation or an effect in dependency of the pressure value.
US11099660B2
A method for detecting digital ink described herein can include detecting an environmental characteristic of a system. The method can also include modifying a user interface mode based on the environmental characteristic, the user interface mode to modify an input panel of a first display screen of a user interface for detecting the digital ink. Furthermore, the method can also include storing the digital ink provided via the user interface and displaying the stored digital ink in a second display screen of the user interface.
US11099657B2
Remote information input method, device and system are disclosed. The method includes: receiving a screen snapshot of a terminal device and sending the screen snapshot to a remote input device; receiving a keyboard input instruction from the remote input device, the keyboard input instruction including an identification of the terminal device and a keyboard code; determining a corresponding target key in the terminal device based on the keyboard code and a key code mapping table; identifying the screen snapshot of the terminal device and determining whether the target key exists in the screen snapshot; acquiring a coordinate of the target key in a screen snapshot in response to determining that the target key exists in the screen snapshot; and sending a click instruction to the terminal device, according to the coordinate of the target key in the screen snapshot and the identification of the terminal device.
US11099649B2
A device includes a display portion that includes a display housing and a display within the display housing. The device also includes a base portion flexibly coupled to the display portion and comprising a glass member defining a keyboard region configured to receive user input, a first haptic actuator configured to produce a first haptic output at a first area of the keyboard region, and a second haptic actuator configured to produce a second haptic output at a second area of the keyboard region that is different from the first area.
US11099646B2
A brain-controlled wearable display device includes a display panel, a display control circuit, and a brain control circuit connected with the display control circuit. The brain control circuit is configured to generate a control instruction according to a brain wave, and the display control circuit is configured to control the display panel according to the control instruction.
US11099642B2
Eye data is recorded and a visual impairment of an eye viewing a screen is determined. A correction value is determined based on the visual impairment, and a display connected to a personal computing device is adjusted based on the correction value.
US11099641B2
The present disclosure relates to calibration, customization, and improved user experiences for smart or bionic lenses that are worn by a user. The calibration techniques include detecting and correcting distortion of a display of the bionic lenses, as well as distortion due to characteristics of the lens or eyes of the user. The customization techniques include utilizing the bionic lenses to detect eye characteristics that can be used to improve insertion of the bionic lenses, track health over time, and provide user alerts. The user experiences include interactive environments and animation techniques that are improved via the bionic lenses.
US11099632B2
A virtual/augmented reality-based system for guiding patients through rehabilitation exercises and providing real time feedback is disclosed. In various embodiments the system, methods, and computer program products relate to guiding and measuring neck and shoulder motion, specifically protraction and retraction motions. A virtual reality environment includes a fixed object having a guidance feature and a moveable object having a complementary shape to the guidance features. Whether the fixed object is in a complimentary orientation to the movable object is determined. When the fixed object is in a complimentary orientation with the movable shape, an indication is presented to the user to perform a motion. A plurality of sensors determines a plurality of measurements relating to the motion of the user. Whether the fixed object is in a complementary orientation with the movable object is determined based on the plurality of measurements.
US11099631B2
Systems, apparatuses and methods for outputting fields of view of a virtual reality system according to postures of a user of the virtual reality system can include a sensor for detecting a posture of the user of the virtual reality system and a display for outputting data indicative of a field of view according to the user's posture. When the sensor detects a user's posture, the virtual reality system can display an alternate field of view that indicate to the user that the posture has been detected. When the sensor no longer detects the posture, the virtual reality system can display the original field of view again.
US11099628B2
An apparatus is provided, where the apparatus includes a plurality of components, wherein an individual component has a corresponding throttling priority of a plurality of throttling priorities. The apparatus further includes logic to selectively throttle one or more of the plurality of components. In an example, an order in which the one or more of the plurality of components are to be throttled may be based on the plurality of throttling priorities.
US11099626B2
Disclosed are examples of apparatuses including memory devices and systems comprising memories sharing a common enable signal, wherein the memories may be put into different power modes. Example methods for setting the different power modes of the memories are disclosed. In some examples, different power modes may be set by issuing memory group-level commands, memory-level commands, or combinations thereof.
US11099624B2
A sensor device includes an image sensing array, a frame buffer, a first read line, a second read line and an energy accumulator. The image sensing array is configured to sense reflected light from a working surface and includes a plurality of sensing pixels and a plurality of self-powered pixels. The sensing pixels respectively output image data according to the sensed reflected light. The self-powered pixels respectively output photocurrent according to the sensed reflected light. The first read line is coupled between the sensing pixels and the frame buffer. The second read line is coupled between the self-powered pixels and the frame buffer. The energy accumulator stores electrical energy of the photocurrent via a charge path between the self-powered pixels and the energy accumulator.
US11099623B2
Described are mechanisms and methods to facilitate power saving in Type-C connectors. Some embodiments may comprise an interface to a Configuration Channel (CC) signal path and to a ground signal path of a Universal Serial Bus (USB) Type-C connector port, a first circuitry, and a second circuitry. The first circuitry may be operable to place toggled values on the CC signal path. The second circuitry may be operable to couple the ground signal path to a detection signal path. The placement of the toggled values on the CC signal path is enabled when the detection signal path carries a first value that corresponds with the USB Type-C connector port being connected to a USB Type-C device, and may be disabled when the detection signal path carries a second value that corresponds with the USB Type-C connector port not being connected to a USB Type-C device.
US11099620B2
A fail-safe power limit (FSPL) can be applied to components that lose communication with a management module (MM) to determine a safe power level at which to operate. The FSPL may be computed by the management module (MM) for the information handling system and distributed to components in the information handling system. By computing a FSPL and transmitting the FSPL to the components, a larger amount of the available power can be used by the components. This allows the components to continue operating at performance levels closer to or equivalent to levels available when the management module (MM) is operating normally. The FSPL may be updated at set times and/or on a periodic schedule such that the FSPL used by the components when communication is lost with the management module (MM) reflects a recent operating state of the components.
US11099613B1
The front of a rack-mounted 2RU (Rack Unit) chassis includes bays that receive replaceable components, such as storage drives. Two rear slots of such chassis may each receive 1RU servers that couple to a chassis midplane via interposers. Administration of such 2RU chassis is simplified when a 1 RU server can be installed identically in the top or bottom chassis slot. Embodiments provide this capability while avoiding locating interposers along the center of the midplane. A lower guide routes a floating interposer of the server to lower midplane connectors as the server is inserted in the lower slot. An upper guide routes the floating interposer to upper midplane connectors as the server is inserted in the upper slot. The floating interposer moves up and down based vertical travel of guidewheels that protrude from the server and are routed by the guides as the server is inserted in a slot.
US11099609B2
This is directed to providing a cosmetic finish on a component constructed by connecting several elements. A single manufacturing process, such as machining or grinding, can be applied to the connected elements to remove material from some or all of the elements and to form a smooth and continuous surface across interfaces between the individual elements of the component. In some cases, settings of the material removal process can be adjusted based on the material of the component elements. For example, the settings can be adjusted based on the manufacturing or mechanical properties of each element material.
US11099601B2
A calibration controller determines a latest arriving data strobe from at least one data chip at a first data buffer in a read data path between at least one memory chip and a host on a high speed interface. The calibration controller determines whether external feedback of the at least one data chip is required. The calibration controller, in response to determining that external feedback of the at least one data chip is required, aligns a chip clock distributed to a second data buffer in the read data path with the latest arriving data strobe by applying a 180 degree phase align of the chip clock through one or more latches, wherein data cross a first clock boundary from the first data buffer to the second data buffer, to minimize a latency in the read data path across the first clock boundary.
US11099595B2
A bandgap circuit includes a supply node as well as a first and second bipolar transistors having jointly coupled base terminal at a bandgap node providing a bandgap voltage. First and second current generators are coupled to the supply node and supply mirrored first and second currents, respectively, to first and second circuit nodes. A third circuit node is coupled to the first bipolar transistor via a first resistor and coupled to ground via a second resistor, respectively. The third circuit node is also coupled to the second bipolar transistor so that the second resistor is traversed by a current which is the sum of the currents through the bipolar transistors. A decoupling stage intermediate the current generators and the bipolar transistors includes first and second cascode decoupling transistors having jointly coupled control terminals receiving a bias voltage sensitive to the bandgap voltage.
US11099594B1
The disclosed bandgap circuit is configured to provide a temperature stable reference current and/or voltage that is also adjustable. The stability can be facilitated by an improved matching of current mirrors provided by a source degeneration topology. The source degeneration can reduce random mismatches without requiring increased size or complexity of the current mirrors and can facilitate operation of the current mirrors in a weak inversion condition, in which random mismatches may be most severe. Further, the source degeneration may be adjusted to adjust a level and/or a temperature coefficient of the generated reference current and/or voltage.
US11099592B2
This invention provides a current self-checking regulation circuit based on voltage calibration including a bandgap reference unit, a self-calibration unit, a detection and regulation unit, current mirror units, and a current mirror control unit. The bandgap reference unit is configured to generate a voltage signal, the self-calibration unit is configured to respond to a digital signal of the detection and regulation unit and calibrate the voltage signal of the bandgap reference unit. The detection and regulation unit samples the reference current signal and a mirror current signal of the regulation group current mirror unit and generate a digital control signal according to the reference current signal. and the reference group current mirror unit responds to the digital control signal and outputs a regulated bias current signal meeting needs of the laser driver.
US11099591B1
A DLDO has a configuration that mitigates performance degradation associated with limit cycle oscillation (LCO). The DLDO comprises a clocked comparator, an array of power transistors, a digital controller and a clock pulsewidth reduction circuit. The digital controller comprises control logic configured to generate control signals that cause the power transistors to be turned ON or OFF in accordance with a preselected activation/deactivation control scheme. The clock pulsewidth reduction circuit receives an input clock signal having a first pulsewidth and generates the DLDO clock signal having the preselected pulsewidth that is narrower that the first pulsewidth, which is then delivered to the clock terminals of the clocked comparator and the digital controller. The narrower pulsewidth of the DLDO clock reduces the LCO mode to mitigate performance degradation caused by LCO.
US11099584B2
A method and apparatus for stabilizing gas/liquid flow in a vertical conduit by utilizing one or more flow stabilizing devices positioned inside the conduit along a structural support tube. The flow stabilizing devices are configured and dimensioned to accelerate the velocity of the flowing two-phase fluid mixture in the conduit to sustain upward liquid flow.
US11099581B2
The position of a UAV within a three-dimensional space is changed based on a change in position of a controller of the UAV. First and second sensor data are produced using sensors of the controller to maintain stable altitude output for the UAV. The first sensor data indicates a geolocation of the controller, and the second sensor data indicates a barometric pressure of an environment in which the controller is located. The first and second sensor data are post-processed using a complementary filter based on respective altitude measurements of the first and second sensor data to determine an altitude of the controller. A position of the controller is determined within a three-dimensional space based on the altitude. Data indicative of the position of the controller within the three-dimensional space is then transmitted to the UAV to cause a change in a position of the UAV within the three-dimensional space.
US11099570B2
The present invention relates to a system for automatically adjusting a vehicle feature of a vehicle, where the system includes a first sensor, an onboard computer, a camera, a mirror, a controller; an actuator; and an algorithm. The algorithm instructs the onboard computer in steps for adjusting one or more vehicle features. The first sensor and the controller are in electronic communication with the onboard computer and the controller is in electronic communication with one or more actuators that connect to and adjust the various vehicle features. The onboard computer includes or accesses a database that correlates users, features, and vehicle feature settings. Such vehicle features include seat position and camera viewing angle.
US11099568B2
A self-driving vehicle system comprising a body having one or more motorized wheels, and a sensor head coupled to the body. The sensor head is movable from a retracted position to an extended position relative to the body. The sensor head comprises one or more proximity sensors and one or more cameras.
US11099559B2
An automated driving system includes a determiner, a driving switch controller, and a notification controller. The determiner determines each of a plurality of determination items that is a condition for switching from an automated driving to a manual driving. The driving switch controller switches from the automated driving to the manual driving when all of the plurality of determination items are determined as positive. The notification controller notifies a driver of notification information for urging a reaction of the driver when at least one of the plurality of determination items is determined as negative. The determiner determines the at least one or all of the plurality of determination items before a vehicle passes through a switch determination point. The determiner determines the at least one or all of the plurality of determination items when or after the vehicle passes through the switch determination point.
US11099552B2
Embodiments of the invention provide a method and system for accelerating convergence of Recurrent Neural Network (RNN) for machine failure prediction. The method comprises: setting initial parameters in RNN wherein the initial parameters include an initial learning rate which is determined based on a standard deviation of a plurality of basic memory depth values identified from a machine failure sequence; training RNN based on the initial parameters and at the end of each predetermined time period, calculating current pattern error based on a vector distance between the machine failure sequence and current predicted sequence; and if the current pattern error is less than or not greater than a predetermined error threshold value, determining, by the processor, an updated learning rate based on the current pattern error, and updating weight values between input and hidden units in RNN based on the updated learning rate.
US11099551B2
Example implementations described herein involve a system for maintenance predictions generated using a single deep learning architecture. The example implementations can involve managing a single deep learning architecture for three modes including a failure prediction mode, a remaining useful life (RUL) mode, and a unified mode. Each mode is associated with an objective function and a transformation function. The single deep learning architecture is applied to learn parameters for an objective function through execution of a transformation function associated with a selected mode using historical data. The learned parameters of the single deep learning architecture can be applied with streaming data from with the equipment to generate a maintenance prediction for the equipment.
US11099548B2
An automation system, a method and an apparatus for suggesting and/or creating an agent in an industrial automation system that includes automation devices having a framework which is formed to execute the agent and which at least partially includes a data source that collects and/or processes data of the automation devices, and includes a data sink, in which data, in particular status data, of the data sources is saved, wherein an agent suggestion component processes data of the data sink into clusters via a cluster analysis, and wherein the agent suggestion component makes the clusters available at an interface such that a model for the agents becomes creatable by an agent generation component based on at least one selection of the clusters such that it becomes possible to suggest and/or create agents in a simpler and more efficient manner.
US11099538B2
An analysis system, controller, and data processing device that are capable of avoiding the influence on control in the case where the names of the constituent elements are changed. The analysis system includes a plurality of constituent elements used for analysis; a controller configured to perform control on a basis of data received from the constituent elements; and a data processing device configured to process data received from the controller. The controller receives the control code, the additional code, and the name information from the plurality of constituent elements to generate an ID code on the basis of the control code and the additional code. The data processing device receives the ID code and the name information from the controller, and performs control on the basis of the control code included in the ID code.
US11099535B2
An on-demand production system for accessories for use with electronic devices is configured to generate digital templates defining the design of the accessories and provide the digital templates to retail or other locations. The retail or other locations may receive access to the digital templates automatically and/or electronically within a week, a day, or even minutes, of the digital template being created. When a customer requests an accessory, the digital template may be accessed. Using an electronic production machine and a supply of stock material, the accessory can be cut, formed, printed, or otherwise produced based on instructions or designs of the digital template. The electronic production machine may automatically read the digital template to automate the production at a retail location. The electronic production machine may produce the accessory on-demand, and production of the accessory may be completed within two hours, or potentially within ten minutes, of a request.
US11099534B2
In one embodiment, a configuration application executing on a tablet computer or smartphone presents a configuration user interface on a touch screen for configuring a home automation system of a structure. A plurality of components of the home automation system that have wireless capabilities are detected. The configuration application receives an indication of a zone of the structure within which each component is located, the indication provided by the user dragging a representation of each component to a location provided in the configuration user interface. Based on the indication of the zone of the structure in which each component is located and the type of each component, automatically generate one or more user interface screens for accessing and controlling the components in each zone, where the automatically generated user interface screens are displayable during use of the home automation system.
US11099516B2
A drawer includes: a photosensitive drum rotatable about a drum axis extending in an axial direction; and a frame to which a developing cartridge including a developing roller is attachable. The developing cartridge is attachable to the frame in a state where an outer circumferential surface of the developing roller faces an outer circumferential surface of the photosensitive drum. The frame is configured to move the developing roller in a separation direction in which the outer circumferential surface of the developing roller moves away from the outer circumferential surface of the photosensitive drum. The frame includes a first guide roller for guiding the developing cartridge in the axial direction. The first guide roller is configured to move the developing cartridge in the separation direction relative to the frame in response to the movement in the axial direction of the developing cartridge relative to the frame.
US11099510B2
A presser presses a pressed object and includes a first rotation shaft and a pressurizing portion that is supported by the first rotation shaft and pivots about the first rotation shaft. A depressurizing portion is supported by a second rotation shaft and pivots about the second rotation shaft with respect to the pressurizing portion. The depressurizing portion includes an engagement. An interlock lever includes an opening that engages the engagement. The depressurizing portion pivots to switch between a pressurization state in which the engagement contacts and presses the opening to cause the pressurizing portion to press the pressed object and a depressurization state in which the pressurization state is released. The depressurizing portion pivots to define a gap between the engagement and the opening in a moving direction in which the engagement moves.
US11099499B2
The present invention configures an image removing device capable of certainly and cleanly removing an image comprising an image forming substance and formed on the surface of a plastic recording material. An image removing device is provided with a means 2 for applying an ultraviolet curable resin and a means 4 for emitting ultraviolet light above a conveyance path for a recording material 1 on the surface of which an image is formed, and removes the image from the surface of the recording material 1 by transferring an image forming substance 1a to the ultraviolet curable resin and attaching the image forming substance, together with the ultraviolet curable resin, to the surface of a release body 5 by irradiating the ultraviolet light.
US11099492B2
An electrophotographic photoreceptor includes a conductive substrate and a photosensitive layer disposed on the conductive substrate. An outermost surface layer of the electrophotographic photoreceptor contains a fluorine-containing resin particle and a fluorine-based graft polymer having a fluorinated alkyl group. A ratio of an amount of a fluorine-based graft polymer separated from the fluorine-containing resin particle to a total amount of the fluorine-based graft polymer in the outermost surface layer is 15% or less.
US11099487B2
A lithographic process is performed on a set of semiconductor substrates consisting of a plurality of substrates. As part of the process, the set of substrates is partitioned into a number of subsets. The partitioning may be based on a set of characteristics associated with a first layer on the substrates. A fingerprint of a performance parameter is then determined for at least one substrate of the set of substrates. Under some circumstances, the fingerprint is determined for one substrate of each subset of substrates. The fingerprint is associated with at least the first layer. A correction for the performance parameter associated with an application of a subsequent layer is then derived, the derivation being based on the determined fingerprint and the partitioning of the set of substrates.
US11099485B2
A method of maintaining a set of fingerprints representing variation of one or more process parameters across wafers subjected to a device manufacturing method, the method including: receiving measurement data of one or more parameters measured on wafers; updating the set of fingerprints based on an expected evolution of the one or more process parameters; and evaluation of the updated set of fingerprints based on decomposition of the received measurement data in terms of the updated set of fingerprints. Each fingerprint may have a stored likelihood of occurrence, and the decomposition may involve: estimating, based the received measurement data, likelihoods of occurrence of the set of fingerprints in the received measurement data; and updating the stored likelihoods of occurrence based on the estimated likelihoods.
US11099472B2
An image display apparatus according to an embodiment of the present technology includes a light source section (610, 650), an optical element (620), and a holding section. The light source section (610, 650) emits light. The optical element (620) includes a light reflection part (626, 656) and a light transmission part (627, 657) provided at a position different from a position of the light reflection part (626, 656). The holding section movably or rotatably holds the optical element (620) and is capable of switching, for example, between a first state in which the light reflection part (626, 656) is arranged on a light path of the emitted light of the light source section (610) and a second state in which the light transmission part (627, 657) is arranged on the light path of the emitted light of the light source section (610).
US11099468B2
A light source device includes: a light source configured to emit laser light; an optical system having an optical axis for guiding the laser light; a first prism which is disposed between the light source and the optical system and includes a first incident surface on which the laser light is incident, and a first exit surface inclined with respect to the first incident surface; a second prism which is disposed between the first prism and the optical system and includes a second incident surface facing the first exit surface at an interval, and a second exit surface inclined with respect to the second incident surface; and a driver configured to rotate the first and second prisms around the optical axis in a state in which the first exit surface and the second incident surface are inclined with respect to the optical axis.
US11099467B2
A micro laser diode projector comprises: an MEMS scanning device, which rotates around a first axis and a second axis that are orthogonal to each other; and a micro laser diode light source including at least one micro laser diode, wherein the micro laser diode light source is mounted on the MEMS scanning device and rotates around the first and second axes with the MEMS scanning device to project light to a projection screen. An electronics apparatus including the micro laser diode projector is also discussed.
US11099458B2
A VCM is disclosed, the motor including a stator including a first driving unit, a rotor arranged inside the stator, including a second driving unit responding to the first driving unit and mounted therein with a lens, a base fixing the stator, and an elastic member coupled to the rotor to float the rotor from the base in a case a driving signal for driving the first and second driving units is not applied to the first and second driving units.
US11099457B2
An holding device can hold an optical component and a masking component with high precision in a simple configuration and a limited space. A first holding member includes a first receiving face that is in contact with a first optical component in an optical axis direction to fix a position of the first optical component in the optical axis direction and a second receiving face that is in contact with a second optical component in the optical axis direction to fix a position of the second optical component in the optical axis direction.
US11099453B1
Some embodiments are directed to a light modulator comprising transparent substrates, or a transparent substrate and a reflective or partially reflective substrate, multiple electrodes being applied to the substrates in a pattern across the substrate. A controller may apply an electric potential to the electrodes to obtain an electro-magnetic field between the electrodes providing electrophoretic movement of the particles towards or from an electrode.
US11099452B2
An electrophoretic display medium includes a front and a rear electrode, at least one of the front and rear electrodes being transparent, and an encapsulated dispersion fluid containing a plurality of pigments positioned between the front and rear electrode. The plurality of pigments includes a first and a second type of organic pigment particle. The first type of organic pigment particle has a first color and a first charge polarity. The second type of organic pigment particle has a second color different from the first color and a second charge polarity the same as the first charge polarity. At least one of the first and second types of organic pigment particle includes a silica coating and a polymeric stabilizer covalently bonded to the silica coating.
US11099447B2
A switchable privacy display apparatus comprises a spatial light modulator, a light control film, and a polar control retarder that comprises plural retarders arranged between a display polariser of the spatial light modulator and an additional polariser. The display achieves high image visibility to an off-axis user in a public mode of operation and high image security to an off-axis snooper in privacy mode of operation.
US11099445B2
A display panel and a display apparatus are provided. The display panel includes a first substrate and a second substrate which are arranged oppositely. A liquid crystal layer is filled between the first substrate and the second substrate, the liquid crystal layer has dielectric anisotropy of parameter in a range from −1 F/m to 1 F/m, a sum of a bending flexural coefficient and a splaying flexoelectric coefficient of the liquid crystal layer is greater than 1 pc/m, and liquid crystal molecules in the liquid crystal layer are deflected by a flexoelectric effect, so that deflecting speed of the liquid crystal molecules in the liquid crystal layer is improved and the response time of the liquid crystal layer is shortened.
US11099443B2
The present application discloses a display panel having a plurality of wirings in the fan-out area respectively connected to a plurality of signal lines in the display area, each of the plurality of wirings in the fan-out area configured to transmit a signal to one of a plurality of subpixels through one of the plurality of signal lines in the display area; and a plurality of bonding pads respectively connected to the plurality of wirings, configured to bond the plurality of wirings with a driver integrated circuit. The plurality of wirings are grouped into a plurality of groups of wirings comprising a first group of a plurality of first wirings and a second group of a plurality of second wirings. The plurality of first wirings are made of a first conductive material. The plurality of second wirings are made of a second conductive material. The second conductive material has a resistivity greater than that of the first conductive material.
US11099438B2
A display portion of a display device includes a gate wiring formed of a first metal layer, a signal line formed of a second metal layer, a metal wiring formed of a third metal layer. A terminal portion of the display device includes a first metal portion formed of the second metal layer, and a second metal portion that is laminated on the first metal portion and formed of the third metal layer. The second metal portion covers an upper surface and a side surface of the first metal portion, and a peripheral portion of the second metal portion is covered by an organic insulating film, and the inside of the peripheral portion of the second metal portion is exposed via a first through hole formed in the organic insulating film.
US11099433B2
A switchable directional display apparatus comprises a spatial light modulator and a backlight comprising a waveguide, two light sources arranged to provide illumination through the edge of the waveguide and a switchable liquid crystal retarder. The light sources and switchable liquid crystal retarder may be controlled to provide a first operating state with a narrow field of view and a second operating state with a wide field of view. Image visibility in wide angle mode of operation may be maximised while visual security level may be maximised in a narrow angle mode of operation, to provide an efficient privacy mode of operation.
US11099431B2
The present disclosure relates to an edge type backlight unit and a display device including the same, and is capable of enabling other optical components including a reflecting plate, a diffusion plate, and a prism sheet to perform a light guiding function by eliminating a light guide plate from a backlight unit. Such an edge type backlight unit according to the present disclosure and the display device including the same are configured by eliminating the light guide plate so that there are effects in which the number of components and manufacturing costs may be reduced, and further an upper end of the display device may be slimmed down to improve an exterior quality.
US11099422B2
The present disclosure relates to a display panel, a display device, a reflective filter and a control method thereof. The reflective filter includes: a substrate; a first dielectric layer having a first refractive index, and located on one side of the substrate; a periodic array structure located on one side of the first dielectric layer away from the substrate and in direct contact with the first dielectric layer, wherein the periodic array structure includes a plurality of solid material patterns spaced apart by gaps; and a second dielectric layer covering the periodic array structure and filling the gaps, wherein a material of the second dielectric layer is a variable refractive index material; wherein the first refractive index of the first dielectric layer is lower than an equivalent refractive index nneff of the periodic array structure with the gaps filled with the variable refractive index material.
US11099421B2
A liquid crystal display device and a method of manufacturing the same are provided. The LCD device includes a substrate including a display area and a non-display area, a blue light blocking filter on the substrate, a plurality of color pattern layers spaced apart from one another in a plan view, a black matrix among the plurality of color pattern layers in a plan view, a planarization layer on the color pattern layer and the black matrix, and a polarizer on the planarization layer. The color pattern layer includes a red color conversion unit on the blue light blocking filter, which converts a light into a light having a red wavelength and a green color conversion unit on the blue light blocking filter, which converts a light into a light having a green wavelength. The red color conversion unit and the green color conversion unit include wavelength converting particles.
US11099415B2
A support part for an LCD display module of an electronic device includes at least one element for receiving a press device for pressing a dummy key. The support part at least one attachment element for securing the part to a printed circuit board of the electronic device such that the press device is compressed between the support part and the printed circuit board.
US11099414B2
A method of manufacturing a curved display panel, includes: polishing a portion of the flat display panel that is to form a protrusion, which protrudes in order to protect a portion, to which a drive circuit board is attached, through mechanical polishing so as to have a preset thickness; installing a sealing member, which protects the flat display panel, polished in the polishing, from an etchant by surrounding both the portion that is to form the protrusion and the drive circuit board; and etching an entirety of both surfaces of the flat display panel using the etchant, excluding a portion on which the sealing member is provided, so that the flat display panel, having the sealing member installed in the installing, has a thickness smaller than a thickness of the protrusion.
US11099411B2
The present disclosure relates a privacy film and a display device including the privacy film. More specifically, by including a light collector including a plurality of first light blocking patterns arranged to be spaced apart from one another, an adhesive layer disposed on the light collector and having at least one first groove in at least a part overlapping the plurality of first light blocking patterns, and a light diffuser disposed on the adhesive layer and including a plurality of capsules, the privacy film and the display device including the privacy film can prevent light discharge efficiency of the privacy film from being degraded and be easily reworked.
US11099396B2
A method implemented by an extended reality (XR) display device includes rendering a current image frame received from an external electronic device associated with the XR display device. The current image frame is associated with a current pose of the XR display device. The method further includes receiving an updated image frame from the external electronic device, calculating an updated pose based on one or more characteristics of the updated image frame, and determining whether the updated pose is within a pose range with respect to the current pose. The method thus further includes re-rendering, on one or more displays of the XR display device, a previous image frame based on whether the current pose is determined to be within the pose range.
US11099391B2
A display device includes a frame and an image display device. The image display device includes an image forming device, a light guide device, and a lens system. The image forming device includes light emitting elements 300 arranged in a two-dimensional matrix. Each of the light emitting elements 300 has a laminated structure 301 including at least one layer of light emitting laminates 310, 320, and 330 each including a first electrode, a second electrode, and a light emitting layer provided between the first electrode and the second electrode. The laminated structure 301 has a through hole 360 through which light from the light emitting layer is emitted toward the lens system. An antireflection layer 370 is formed in a portion of the laminated structure facing the lens system.
US11099385B2
A virtual reality headset system includes a vision correction module. The vision correction system can detect a degree of myopia or other visual ailment of a user of the VR system, and then adjust a vision correction lens to adjust for user myopia. An implementation of the vision correction module can adjust right and left lenses separately.
US11099383B2
The present invention provides a head-up display device wherein a light shielding part for preventing a washout phenomenon is prevented from shining. A head-up display according to the present invention, in which a display unit for emitting display light (L) is housed in a case and the upper portion of the display unit is covered by the light shielding part, has strip-shaped protrusion parts formed on the bottom surface of the light shielding part (42). With this constitution, the strip-shaped protrusion parts prevent the scattered light (SL) resulting from the light (L) output from the display unit from illuminating the bottom surface of the anti-washout light shielding part, thereby preventing the bottom surface from being displayed as a virtual image.
US11099380B2
Aspects of the present invention relate to methods and systems for imaging, recognizing, and tracking of a user's eye that is wearing a HWC. Aspects further relate to the processing of images reflected from the user's eye and controlling displayed content in accordance therewith.
US11099375B2
A portable inspection unit is provided. The portable inspection unit may include a unit body, a flexible cable, and an imager housing. The flexible cable may extend from the unit body and the imager housing may be disposed at a distal end of the flexible cable. The portable inspection unit may be configured to receive an actuating accessory.
US11099371B2
An optical system (e.g., a telescope) comprising an optical assembly that reflects and refracts light rays through a single window about an optical path to a detector. A field-of-view bypass assembly comprises a bypass mirror movably coupled with respect to the optical assembly. The bypass mirror is selectively translatable and tiltable between a bypass configuration and a retracted configuration. In the bypass configuration, the bypass mirror is disposed in and interrupts the primary optical path and oriented to define a secondary optical path to the detector. In the retracted configuration, the bypass mirror is both disposed out of the primary optical path and is properly shielded to prevent stray light reflections.
US11099370B2
This specification describes methods for imaging a sample using fluorescence microscopy, systems for imaging a sample using fluorescence microscopy, and illumination systems for fluorescence microscopes. In some examples, a system includes a cylindrical lens shaped to form a light sheet from a collimated light beam at a focal line of the cylindrical lens, a photomask shaped for elongating a diffraction limited length of the light sheet by creating an interference pattern at the cylindrical lens focal line, and a structure for tilting the cylindrical lens and the photomask relative to an imaging axis of objective lens so that a propagation axis of the collimated light beam is at an oblique angle relative to the imaging axis of the objective lens for tilted illumination of a sample.
US11099369B2
A fully automatic microscopic scanner, comprising an image acquisition mechanism (IAM) with a line array camera. The IAM and the microscopic scanning mechanism move along X/Y/Z axis under the action of a power control mechanism. The light source mechanism illuminates an area greater than or equal to the total area of the tray and has a flat light source with a condenser, a cooling fan, a water cooling unit. A general control mechanism and a laser pre-focus system connects to the light source mechanism. The fully automatic microscopic scanner links the microscopic scanning mechanism and the IAM with the light source mechanism. Flexible adjustment of lens is achieved by making the lens move forwards and backwards, leftwards and rightwards and up and down. The light source mechanism and laser pre-focus system, the stage and the light source are fixed during the scanning process to achieve real-time accurate and fast focusing.
US11099366B2
A zoom lens, comprises: in order from an object, a first lens group (G1) having positive refractive power; a second lens group (G2) having negative refractive power; a third lens group (G3) having positive refractive power; a fourth lens group (G4) having negative refractive power; and a fifth lens group (G5) having positive refractive power, wherein, upon zooming from a wide-angle end state to a telephoto end state, a distance between each of lens groups and a lens group adjacent thereto changes to satisfy the following conditional expression: 2.90<|MV5/MV2|<11.50 where, MV5 denotes, upon zooming from a wide-angle end state to a telephoto end state, a moving amount of the fifth lens group with an image surface as a reference; and MV2 denotes, upon zooming from the wide-angle end state to the telephoto end state, a moving amount of the second lens group with the image surface as the reference.
US11099364B2
A zoom lens consists of a positive first lens group that is fixed during zooming, a negative second lens group that moves during zooming, a positive third lens group that moves during zooming, a positive fourth lens group that moves during zooming, and a positive fifth lens group that is fixed during zooming. During zooming from a wide angle end to a telephoto end, the fourth lens group moves from an image side to an object side, the second lens group and a composite group consisting of the third lens group and the fourth lens group pass through points where respective lateral magnifications are −1 at the same time, the fifth lens group consists of a negative fifth A lens group that moves during anti-shake operation, and a positive fifth B lens group that is fixed during the anti-shake operation, and the lateral magnification of the fifth A lens group is negative.
US11099363B2
A lens device consists essentially of a first lens, a second lens, a third lens, a fourth lens, a fifth lens, a sixth lens, and a seventh lens. The first lens is with negative refractive power and includes a convex surface facing an object side and a concave surface facing an image side. The second lens is a biconcave lens with negative refractive power. The third lens is with positive refractive power. The fourth lens includes a concave surface facing the object side. The fifth lens is with refractive power and includes a convex surface facing the object side. The sixth lens is with refractive power. The seventh lens is with positive refractive power. The first, second, third, fourth, fifth, sixth, and seventh lenses are arranged in order from the object side to the image side along an optical axis. The third lens and the fourth lens are cemented.
US11099362B2
There are provided a subminiature optical system having a miniature size and capable of obtaining a narrow view angle using only five sheets of lenses, and a portable device having the same. The subminiature optical system includes a first lens convex toward the object side and having positive refractive power. a second lens concave toward an image side and having negative refractive power, a third lens convex toward the object side and having positive refractive power, a fourth lens concave toward the image plane and having negative refractive power, and a fifth lens convex toward the image plane and having negative or positive refractive power, sequentially from an object side.
US11099349B2
An optical driving mechanism is provided, configured to force an optical element, including a base, a movable portion, and a driving portion. The movable portion is disposed and connected to the base. The movable portion includes a holder configured to sustain the optical element, a magnetic element, and a fixing member. The magnetic element and the fixing member are affixed to the holder, wherein the fixing member has a permeable material. The driving portion is configured to force the movable portion to move relative to the base, wherein the driving portion includes a piezoelectric element and a support member connecting thereto. The piezoelectric element and the support member are disposed on the base and connected to the movable portion. The fixing member makes contact with the support member via a magnetic attraction force between the magnetic element and the fixing member.
US11099346B1
An optical cable includes a plurality of buffer tubes, each of the buffer tubes includes a flexible ribbon, the flexible ribbon including a plurality of optical fibers, the flexible ribbon being wrapped with a finished tape.
US11099345B2
A method of winding an optical fiber includes winding the optical fiber using a bobbin that includes: a body portion having two end portions; and a pair of flanges, respectively disposed at the end portions in an axial direction of the body portion. An inner surface of each of the flanges is inclined toward an outer side in the axial direction and toward a radial outer side. The method further includes guiding the optical fiber to the bobbin using a final pulley. The bobbin and the final pulley reciprocate relative to each other in the axial direction at a traverse speed V (mm/sec) such that 0.0050≤θ (rad)≤0.1000, where θ is a delay angle, θ=arctan (V/L), and L (mm) is a distance from a winding position of the optical fiber at the bobbin to the final pulley in a radial direction.
US11099343B2
The present disclosure relates to a re-enterable enclosure for a fiber optic network. The enclosure can include features such as a low compression-force perimeter gasket, cable seals constructed to seal effectively seal triple points, multi-function port size reducer plugs and multi-function blind plugs.
US11099338B2
A method for forming hermetic seals between the cap and sub-mount for electronic and optoelectronic packages includes the formation of metal mounds on the sealing surfaces. Metal mounds, as precursors to a metal hermetic seal between the cap and sub-mount of a sub-mount assembly, facilitates the evacuation and purging of the volume created within cap and sub-mount assemblies prior to formation of the hermetic seal. The method is applied to discrete cap and sub-mount assemblies and also at the wafer level on singulated and non-singulated cap and sub-mount wafers. The method that includes the formation of the hermetic seal provides an inert environment for a plurality of electrical, optoelectrical, and optical die that are attached within an enclosed volume of the sub-mount assembly.
US11099327B2
The present application discloses a Transverse Electric (TE) polarizer. The TE polarizer includes a semiconductor substrate having an oxide layer. The TE polarizer further includes a waveguide embedded in the oxide layer. Additionally, the TE polarizer includes a plate structure embedded in the oxide layer substantially in parallel to the waveguide with a gap distance. In an embodiment, the plate structure induces an extra transmission loss to a Transverse Magnetic (TM) mode in a light wave traveling through the waveguide.
US11099313B2
A diffractive waveguide stack includes first, second, and third diffractive waveguides for guiding light in first, second, and third visible wavelength ranges, respectively. The first diffractive waveguide includes a first material having first refractive index at a selected wavelength and a first target refractive index at a midpoint of the first visible wavelength range. The second diffractive waveguide includes a second material having a second refractive index at the selected wavelength and a second target refractive index at a midpoint of the second visible wavelength range. The third diffractive waveguide includes a third material having a third refractive index at the selected wavelength and a third target refractive index at a midpoint of the third visible wavelength range. A difference between any two of the first target refractive index, the second target refractive index, and the third target refractive index is less than 0.005 at the selected wavelength.
US11099310B2
An image pickup device according to the present technology that includes an on-chip lens, a low-refractive index layer, and an infrared absorption layer. The on-chip lens is formed of a high-refractive index material. The low-refractive index layer is formed to be flat on the on-chip lens, the low-refractive index layer being formed of a low-refractive index material. The infrared absorption layer is formed of an infrared absorption material including at least one kind of organic infrared absorption dye and binder resin, a glass transition temperature of the binder resin being not less than 100° C., a concentration of the infrared absorption dye in the infrared absorption material being not less than 15 wt % and not more than 50 wt %, the infrared absorption layer being laminated above the low-refractive index layer.
US11099305B2
A near-eye display apparatus includes a pixel island configured to emit first light, and a combined micro lens disposed at a light exit side of the pixel island. The combined micro lens includes an additional micro lens and a first micro lens. The additional micro lens is configured to diverge the first light emitted by the pixel island. The first micro lens is disposed at a side of the additional micro lens away from the pixel island, and is configured to collimate light passed through the additional micro lens. The pixel island is disposed on a focal plane of the combined micro lens.
US11099303B2
An LCD device is disclosed, which may include display panel and a hard coating layer on the display panel from a photo curable resin composition that includes a fluorinated polymer, wherein the fluorinated polymer is included into the photo curable resin composition by about 15 to about 35 wt %.
US11099281B2
A method and device for measuring the magnetic rigidity of penetrating charged particles uses an elongated transparent ionizable medium, surrounded by a reflective interface, extending along a helical path around a longitudinal axis. A magnet applies a magnetic field to the medium in a direction along the longitudinal axis. A single luminosity proportional photon detector is operationally associated with the medium and adapted to generate signals indicative of the number of photons transiting the medium. A controller is adapted to receive the signals and calculate a penetration depth of the ionizing particle through the medium based on the number of photons transiting the medium and a magnetic rigidity of the charged particle based upon the penetration depth.
US11099277B2
Some demonstrative embodiments include apparatuses, devices, systems and methods of synchronizing time. For example, an apparatus may include a GNSS receiver to output GNSS measurements, and an output-timing signal including a plurality of pulses based on a clock of the GNSS receiver; an IMU to output inertial measurements, the IMU including a magnetometer to output magnetometer measurements; an antenna to emit an electromagnetic signal based on the output-timing signal, the electromagnetic signal to be measured by the magnetometer; and a processor to process the GNSS measurements and the inertial measurements, to detect in the magnetometer measurements one or more detected pulses of the output-timing signal, to determine a time delay between a clock of the IMU and the clock of the GNSS receiver based the detected pulses, and to adjust a time-base of the inertial measurements to a time-base of the GNSS measurements based on the time delay.
US11099276B2
Systems and methods for identifying which of a plurality of signal types received by a global navigation satellite system (GNSS) receiver includes a spoofing signal. One method may include, for each particular signal type of the plurality of signal types, excluding the particular signal type, calculating a parameter of a GNSS receiver based on the received wireless signals having a plurality of remaining signal types, and calculating a residual score based on a variability associated with calculating the parameter, the residual score being one of a plurality of residual scores. The method may also include identifying an outlier of the plurality of residual scores and identifying which of the plurality of signal types includes a spoofing signal based on the outlier.
US11099269B2
The disclosure relates to a radar device for a vehicle, enabling to determine a target satisfying a pairing condition for finding an intersection point by using a combination of a pair of up-chirp and down-chirp signals with an added down-chirp signal, without an additional hardware resource. The radar device includes at least: a transmission unit configured to transmit, through the transmission antenna, a transmission signal including a pair of up-chirp and down-chirp signals having predetermined slopes, and an added chirp signal having a slope different from the slopes; a reception unit configured to receive, through the reception antenna, a reception signal that is the transmission signal reflected on the target located before the vehicle; and a signal processing unit configured to determine the target satisfying the pairing condition for finding an intersection point through a combination of at least one of a pair of the up-chirp and down-chirp signals.
US11099249B2
The present invention is directed to a system comprising a body coil (9) for magnetic resonance imaging and an RF amplifier connected to the body coil (9) for feeding the body coil (9) with an RF signal, wherein the body coil (9) comprises two different ports (21, 22) for feeding the RF signal into the body coil (9), the body coil (9) is provided with a switch for selectively activating only one single port (21, 22) for feeding the RF signal to the body coil (9) at a time, and the two ports (21, 22) are located at different locations of the body coil (9) such that the dependence of the reflected part of the RF signal fed into the body coil (9) from the weight of the examination object (1) to which the body coil (9) is applied is different for the two ports (21, 22). In this way, a possibility for adapting a MRI measurement to different load situations due to different weights of an examination object (1) in an easy and efficient way is provided, thereby providing the possibility for impedance matching of the body coil by selecting the appropriate driven port.
US11099243B2
Magnetic load cells that measure force and/or torque are constructed from magnets and one or more arrays of magnetic field sensors. The magnetic field sensors are structured in a tight array where the array is attached to a first portion of a frame. The magnets are operated in pairs polarized in opposition to one-another. In particular, pairs of concentric magnets create sharp field boundaries. The magnets are attached to a second portion of the frame with the magnets separated from the array of field sensors by a small gap. The second portion of the frame is free to displace or rotate in relation to the first portion of the frame when a force or torque is applied to it. The displacement results in a measurable differential change in magnetic field reported by the array that can be sampled and processed to relate to the applied force or torque.
US11099241B2
A power tool includes: a rechargeable battery; a motor; a drive circuit; an operation unit; a battery state detection circuit; a control circuit; and an interruption circuit. The battery state detection circuit detects a battery voltage, and when the detected battery voltage is lower than or equal to a prescribed voltage, the battery state detection circuit outputs a low-voltage signal. The control means outputs a control signal to the drive circuit instructing to drive the motor when the operation unit is operated and halts the output of the control signal to the drive circuit instructing to halt driving the motor in response to the low-voltage signal. The interruption circuit outputs an interruption signal to the drive circuit in response to the low-voltage signal to thereby interrupt the drive circuit and halt driving the motor irrespective of whether or not the control signal is outputted to the drive circuit.
US11099238B2
A distributed control system having at least a distributed control module is disclosed. The distributed control module may be configured to determine a fault state associated with a control loop using a built-in test module. The built-in test module may be incorporated into the distributed control module. The fault state may include no faults, a communication fault, a sensor operation fault, or a controllable component fault. The distributed control module may be configured to transmit a closed-loop control command from the distributed control module to a controllable component when the fault state comprises no faults, or transmit an augmented control command from the distributed control module to the controllable component when the fault state comprises a communication fault or a sensor operation fault, or transmit a disconnect control command from the distributed control module to a controllable component when the fault state comprises a controllable component fault.
US11099230B2
An electromigration (EM) test structure for localizing EM-induced voids is provided. The EM test structure includes an EM test element, a via, and a stress line. The EM test element includes a first force pad and a first sense pad. The via electrically connects the EM test element to the stress line. A second end portion of the stress line includes a second force pad and a second sense pad. The second force pad defines, at least in part, a conductive pathway between the first and second force pads. The second sense pad defines, at least in part, a conductive pathway between the first and second sense pads to facilitate four-terminal resistance measurements. A first end portion of the stress line includes a third sense pad that defines, at least in part, a conductive pathway between the first and third sense pads to facilitate four-terminal resistance measurements.
US11099194B2
The present invention relates to methods and compositions for monitoring, diagnosis, prognosis, and determination of treatment regimens in subjects suffering from or suspected of having a renal injury. In particular, the invention relates to using a measured urine concentration of one or more of TIMP2 and IGFBP7 in combination with one or more of a measured serum creatinine and a measured urine output, which results are correlated to the renal status of the subject, and can be used for diagnosis, prognosis, risk stratification, staging, monitoring, categorizing and determination of further diagnosis and treatment regimens in subjects suffering or at risk of suffering from an injury to renal function, reduced renal function, and/or acute renal failure.
US11099189B2
A pyrogenicity test assay and method of pyrogen testing that allows for rapid and ultrahigh sensitivity testing of parenteral pharmaceuticals or medical devices that contact blood or cerebrospinal fluid by employing a Limulus Amoebocyte Lysate (LAL) assay utilizing a photonic-crystal biosensor. The photonic-crystal biosensor is capable of determining the presence of endotoxins in a test sample by monitoring shifts in the resonant wavelength of an open microcavity affected by the changes in the refractive index of the analyte solutions used.
US11099183B2
The present invention provides an apparatus for detecting an analyte in a fluid sample, comprising a fluid sample collection element, comprising a fluid sample collection element that comprises an absorbing element; a carrier for accommodating a testing element; and a chamber for accommodating a testing element carrier, wherein the testing element carrier is located in the chamber, and the carrier further comprises an extrusion structure that is in contact with the absorbing element and extrudes the absorbing element.
US11099175B2
Apparatus and methods are described for use with a blood sample (48, 50), including measuring hemoglobin concentration within at least a portion (48) of the blood sample, by performing a first measurement on the blood sample. Mean corpuscular hemoglobin in the blood sample (48, 50) is measured, by performing a second measurement on the blood sample (48, 50). A parameter of the blood sample is determined, based on a relationship between the concentration of hemoglobin and the mean corpuscular hemoglobin. Other applications are also described.
US11099168B2
Methods and apparatus for detecting water in multiphase flows are disclosed. An example apparatus includes a conduit including an inlet to receive a multiphase flow and an electromagnetic sensor coupled to a liquid-rich region of the conduit to measure a permittivity of the multiphase flow, and a water detection manager to determine that water is detected in the multiphase flow based on the permittivity.
US11099161B2
An ionizer includes an ionization probe (21) provided with a capillary (211), a metallic slender tube (212), and a nebulizing gas pipe (213). The ionization probe (21) is equipped to perform ESI-based ionization of components in a liquid sample. An electroconductive capillary (22) is disposed at a position forward in a flow direction of a nebulized flow of the liquid sample from the ionization probe (21). A high voltage from a high voltage power supply (23) is applied to the electroconductive capillary (22) to induce corona discharge so that the components in the liquid sample are ionized by the APCI as well. At the time of tuning the ionizer, a standard sample solution is provided through the electroconductive capillary (22), and a high voltage from the high voltage power supply (23) is applied to the electroconductive capillary (22) so that components in the standard sample solution are ionized by the ESI or due to an ion molecular reaction with solvent molecular ions produced in the ionization probe (21). Thus, components in a standard sample can be ionized and subjected to mass spectrometry without pipe rearranging operations or without switch to and from different flow paths using a valve.
US11099154B2
A method of quantifying the amount of at least two analytes A1 and A2 involving (a) adding at least one salt (S) to at least a portion (P1) of the sample comprising the at least two analytes A1 and A2, (b) ionizing at least a portion of the sample according to (a) thereby forming an analyte flow comprising the analytes A1 and A2 in ionized form, (c) separating the ionized analytes A1 and A2 from each other by using at least one ion mobility separator (124), wherein the analyte flow according to (b) at least partially passes through the ion mobility separator (124), and (d) quantifying the amount of the separated ionized analytes obtained according to (c), wherein A1 is a pharmaceutically active compound C or derivative thereof and A2 is a metabolite or stereoisomer of C.
US11099151B2
An oxygen sensor (1, 2, 3, 4, 5) comprises a working electrode (WE) and a comparatively larger Ag/AgCl reference electrode (RE). A floating voltage between the electrodes (WE, RE) is temporarily retained and a measurement voltage is applied to between the electrodes (WE, RE) during a first period to cause reduction of oxygen and production of an evoked current at the working electrode (WE). The temporarily retained floating voltage is then applied between the electrodes (WE, RE) during a second period to produce a current out from the working electrode (WE). The pO2 in a liquid medium is then representative of a measured net charge to the working electrode (WE) equal to a sum of a charge transferred to the working electrode (WE) during at least a last part of the first period and a charge transferred to the working electrode (WE) during at least a last part of the second period.
US11099148B1
In one embodiment, reinforced soil is assessed using a non-contact method including positioning a reference electrode in close proximity to a surface of the soil without contacting the electrode to the soil surface, vibrating the electrode with a vibration generator, and measuring an electrical potential difference between the electrode and the soil surface, the potential difference being indicative of the condition of a portion of a reinforcement member positioned below the soil surface at the location of the electrode.
US11099145B2
Systems and methods electronic barcoding of particles. The methods comprise: performing operations by a spin coater to spin coat a single layer of particles onto a substrate; performing operations by a heat applicator to apply heat to the substrate so as to evaporate a liquid; and performing operations by at least one material depositor to transform the particles into Electronically Barcoded Particles (“EBPs”). EBPs are fabricated by: coating a portion of each said particle of the particles with a first conductive layer; depositing an insulative layer on the first conductive layer; and/or depositing a second conductive layer on the insulative layer so as to form a parallel plate capacitor on the particle. The parallel plate capacitor is tuned so that the particle has a capacitance that is different than the capacitances of other ones of the electronically barcoded particles.
US11099138B2
A phase calculation unit (12) calculates, as a first phase, a deflection angle of a first similarity vector having a first similarity and a second similarity calculated by a similarity calculation unit (11) as elements. The phase calculation unit (12) calculates, as a second phase, a deflection angle of a second similarity vector having a third similarity and a fourth similarity calculated by the similarity calculation unit (11) as elements. A period calculation unit (13) calculates a period of a pattern formed on a long body on the basis of the first phase and the second phase calculated by the phase calculation unit (12). An abnormality detection unit (14) detects an abnormality in the long body on the basis of the period calculated by the period calculation unit (13).
US11099128B2
In order to analyze a solution component and a scatterer component in a liquid sample more quickly, there is provided an optical analysis device including a light source unit configured to irradiate a liquid sample with light; a first light receiving unit configured to receive transmitted light emitted from the light source unit and transmitted through the liquid sample; a second light receiving unit configured to receive scattered light emitted from the light source unit and scattered by a scatterer in the liquid sample; an ultrasonic irradiation unit configured to irradiate the liquid sample with an ultrasonic wave; a reflection plate configured to reflect the ultrasonic wave that is emitted from the ultrasonic irradiation unit and propagated through the liquid sample; and a control unit configured to control the light source unit, the first light receiving unit, the second light receiving unit, and the ultrasonic irradiation unit.
US11099108B2
A non-transitory storage medium having stored thereon logic is disclosed. The logic is executable by one or more processors to perform operations including: determining, according to first user input received via a user interface (UI), a type of sampling to be performed, and generating (i) a randomized sampling plan for a substance stored in a first container, and (ii) a corresponding data object representing a three-dimensional (3D) model of the first container, wherein the 3D model includes a plurality of increments, wherein a subset of the plurality of increments to be sampled includes a visual indicator. A first type of sampling to be performed includes bulk sampling, and a second type of sampling to be performed includes packaged sampling. The logic, when executed by the one or more processors, may perform further operations including receiving additional user input, via the UI, corresponding to information pertaining to sampling environment conditions.
US11099106B2
A diagnosis control method of an air conditioner is provided to clearly inform a user of an air conditioner installation error. The diagnosis control method includes receiving a test run command or a self-diagnosis command for diagnosis of the air conditioner, performing a first test run to diagnose an assembly state of the air conditioner, performing a second test run to diagnose pipe connection of the air conditioner and an amount of refrigerant in the air conditioner, performing a determination including diagnosing a state of the air conditioner based on operation results of the first test run and the second test run, and displaying the diagnosis result through a display device provided at an indoor unit of the air conditioner.
US11099103B2
One example is test system for testing the propulsion system(s) of vehicles. The test system includes a retention fixture, a linking device, a test logic, a measurement device and a result logic. The retention fixture is for rigidly mounting first and second vehicles to the retention fixture. The linking device links propulsion systems of the first and second vehicles so that the propulsion systems operate a different rates. The test logic subjects the second vehicle's propulsion system to a propulsion test. The measurement device measures at least one parameter associated with the propulsion system of the first vehicle while the first vehicle is subjected to the propulsion test. The result logic determines if the first vehicle under test passed the propulsion test based, in part, on the at least one parameter and generates an indication if the first vehicle passed or failed the propulsion test.
US11099088B2
A torque sensor assembly is used with a driveline component. The torque sensor assembly includes a holder, a sleeve, and at least one strain sensor. The holder includes a side wall that has a holder outer surface and a holder inner surface. The holder outer surface is corresponding to and attached to an aperture of the driveline component. The sleeve is corresponding to and attached to the holder inner surface. The strain sensor is attached to the sleeve and used to sense a strain in the driveline component.
US11099087B2
A torque detecting device detects a torsional torque between a first shaft and a second shaft based on a torsional displacement of a resilient member linking the first shaft and the second shaft coaxially. The torque detecting device is provided with: a magnet fixed to the first shaft; a first yoke fixed to the second shaft and arranged to be rotatable with respect to the magnet; a second yoke fixed to the second shaft and arranged to be rotatable together with the first yoke with respect to the magnet; a magnetic flux collector which collects magnetic flux; and a magnetic sensor which detects magnetic flux density. The magnetic flux collector is located to face both the first yoke and the second yoke. The magnetic sensor is located between the first yoke, from among the first yoke and the second yoke, and the magnetic flux collector, and detects the magnetic flux density between the first yoke and the magnetic flux collector.
US11099083B2
Provided are embodiments including a system for performing aircraft overheat detection using fiber optic monitoring of light reflectance changing temperature strips. Embodiments also include a sensing strip configured to detect a temperature of an object, a controller configured to monitor the sensing strip, and a fiber optic cable configured to transmit or receive a light signal to the sensing strip, wherein the fiber optic cable is operably coupled to the sensing strip and the controller. Embodiments also include a method for operating an aircraft overheat detection system.
US11099080B2
The digital temperature sensing circuit includes a temperature voltage generator configured to generate a temperature voltage varying with a temperature in response to a first reference voltage, divide a supply voltage in response to a second reference voltage, and generate a high voltage and a low voltage, a code voltage generator configured to divide the second reference voltage based on the high voltage and the low voltage and output divided voltages having different voltage levels, and a mode selector supplied with the temperature voltage and the divided voltages, and configured to output a first code or a second code in response to a mode select signal, wherein the first code and the second code have different numbers of bits.
US11099075B2
Systems and methods directed toward acoustic analysis can include an acoustic sensor array comprising a plurality of acoustic sensor elements, an electromagnetic imaging tool, a distance measuring tool, and a processor in communication with the acoustic sensor array, the electromagnetic imaging tool, and the distance measuring tool. The processor can be configured to generate acoustic image data based on acoustic signals received from the acoustic sensor array and distance information received from the distance measuring tool. The processor can combine the generated acoustic image data and received electromagnetic image data from the electromagnetic imaging tool to create a display image including acoustic image data and electromagnetic image data. The processor can be configured to correct a parallax error between the electromagnetic image data and the acoustic image data based on the received distance information.
US11099071B2
An imaging condition evaluation device according to the present disclosure includes: a spectrometer configured to capture a spectral image under an arbitrarily set imaging condition; and an evaluation unit configured to set a first region and a second region different from each other in the spectral image, and calculate an evaluation value of the imaging condition based on an optical spectrum of the first region and an optical spectrum of the second region.
US11099070B2
The present disclosure relates to a high-fineness Fabry-Perot cavity (for use in the THz range) with a guide comprising lateral cavities arranged to guide an electromagnetic wave into the cavity. The invention also relates to a method for implementing a device including such a Fabry-Perot cavity.
US11099057B2
A grossing workstation comprising an electronic scale, screen, and camera holder is described. The camera holder may be mounted on a flexible or articulating arm in order to attach a digital camera for specimen imaging. A computing device in the scale may store digital copies of specimen images or measurements. The computing device may furthermore control movements of the balance pan and camera holder in order to automatically image a specimen at different view angles.
US11099051B2
A method for determining the fill level of a medium involves continuous wave radar measurement and a corresponding fill level measuring device. A coded transmit signal is emitted by a transmitter, reflected at the medium, and received by a receiver as a reflection signal. The reflection signal and a signal derived from the transmit signal are subjected to a correlation analysis, and a correlation outcome results. A control and evaluation unit determines the time offset of the correlated signals with the correlation outcome, and uses it to determine the fill level of the medium. The reflection signal and the derived signal are mixed with the analog mixer into a mixer output signal that is sampled and quantized to a digital mixer output signal. The correlator has a digital integrator with which a sequence of digital mixer output signals is digitally integrated into the correlation outcome.
US11099030B2
An attitude estimation apparatus (30) includes: a data acquiring unit (32) for acquiring observation data; a range-measurement point coordinate calculator (33A) for calculating geodetic coordinates of a range-measurement point in a geodetic coordinate system using positioning data, ranging data, actual attitude data, and an estimated value of an unknown parameter representing an attitude of a flying object; an image coordinate calculator (33B) for calculating coordinates of a projected point by performing projection transformation from the geodetic coordinate system to an image coordinate system on the geodetic coordinates; an image matching processor (34) for detecting image coordinates of the range-measurement point appearing in a first captured image by executing image matching between the first captured image and a second captured image selected from captured images; and an attitude estimator (35) for correcting the estimated value such that a magnitude of a difference between the coordinates of the projected point and the image coordinates decreases.
US11099025B2
An interactive two-dimensional digital map is provided via a user interface. A request to obtain travel directions to a destination is received. An indication of a ride from a pick-up location to a drop-off location to traverse at least a portion of the route is obtained from a third-party provider of a ride service. Street-level imagery for the pick-up location is obtained and displayed on the digital map. In response to detecting a selection of the street-level imagery via the user interface, the two-dimensional digital map is transitioned to an interactive three-dimensional panoramic display of street-level imagery.
US11099012B2
The present invention provides an aerial vehicle for which flight information for the aerial vehicle can be identified by people in the surrounding area. Also provided is a control method for the aerial vehicle. The aerial vehicle is provided with a display device that displays toward the exterior of the vehicle and a display control device that controls the display device. In addition, the aerial vehicle is provided with an altitude acquisition device that acquires altitude as the distance from the ground surface. The display control device is provided with an altitude display control unit that selectively performs display on the display device on the basis of the altitude.
US11099009B2
An imaging apparatus includes a circuitry configured to perform depth analysis of a scene by time-of-flight imaging and to perform motion analysis in the scene by structured light imaging, wherein identical sensor data is used for both, the depth analysis and the motion analysis.
US11099000B2
Systems for coherent light detection are provided, including a system comprising a light source configured to generate light; a first optical assembly configured to split the light into a reference arm and a sample arm; a second optical assembly configured to illuminate a sample with light of the sample arm, thereby generating a sample signal; a third optical assembly configured to combine the sample signal with light of the reference arm, thereby generating an interference signal; and a detector assembly comprising an array of carrier injection photodetectors, the array arranged to collect the interference signal. Methods of using the systems are also provided.
US11098997B2
Disclosed herein are interferometric measurement systems and methods. In one exemplary embodiment an interferometric measuring system for measuring the distance to or displacement of an object includes: a light source; an interferometer with a measuring arm and a reference arm; a dispersive medium; and a detector. The interferometer is disposed between the light source and the object. The dispersive medium is arranged to unbalance the dispersion between the measurement arm and the reference arm. The detector is arranged to detect spectrum interference from the interferometer. In one example, the dispersive medium is a chirped fiber Bragg grating. In another example, the dispersive medium is a highly dispersive optical fiber. In one example, the light source is a broadband light source, and the detector includes a spectrometer. In another example, the light source is a wavelength swept laser, and the detector includes a photodetector or a balanced photodetector.
US11098992B2
The present invention provides ammunition cartridge having a two piece primer insert with a flange, a polymeric middle body extending from the primer insert to a cylindrical middle body coupling region, and a polymeric projectile end having a projectile aperture mated to the polymeric middle body.
US11098991B2
The present invention provides ammunition cartridge having a two piece primer insert with a flange, a polymeric middle body extending from the primer insert to a cylindrical middle body coupling region, and a polymeric projectile end having a projectile aperture mated to the polymeric middle body.
US11098988B1
An apparatus for a directed-energy weapon comprises an assessment system arranged to, during an assessment phase, perform an assessment of a target environment, wherein the target environment comprises a target, and the assessment comprises receiving data relating to a map of at least a portion of a target environment; and a controller arranged to, during an engaging phase, control the directed-energy weapon to direct energy towards the target environment conditionally upon the data.
US11098977B2
A pneumatic gun designed to provide uniform, constant acceleration to a projectile which includes a gas storage tank designed to store a blend of gases under pressure. The pneumatic gun also includes a buttstock that includes a pre-chamber storage vessel in fluid communication with the storage tank. The pneumatic gun further includes a sleeve valve in fluid communication with the pre-chamber storage vessel and designed to control flow of the blend of gases from the pre-chamber storage vessel into a nozzle located adjacent the sleeve valve. The nozzle is shaped to accelerate a velocity of the blend of gases across an axial length of the nozzle. The pneumatic gun also includes a trigger that is designed to open the sleeve valve when the trigger is actuated such that the sleeve valve remains open until a projectile exits a barrel of the pneumatic gun.
US11098970B2
Adjustability of trigger pull force is enable by the use of a spring interfacing with a trigger shoe counterweight. The spring force is adjustable by use of a set screw interfacing with the spring. A pivot arm member acts between a trigger shoe counterweight and a firing pin release arm to fix the ratio of trigger shoe pull force and firing pin release arm force.
US11098964B1
An air-cooled heat exchanger is connectable between an upstream fluid source and a downstream fluid destination by a plurality of external pipes having connection ends arranged in one or more external pipe connection configurations. The air-cooled heat exchanger has a cooling tubes assembly that includes a plurality of headers, a plurality of intermediate pipes connected to the plurality of headers, and a modular manifold system that connects the plurality of intermediate pipes to the plurality of external pipes. The modular manifold system includes a plurality of pipe elbows each connected to a corresponding one of the plurality of intermediate pipes, and one or more trays. Each of the plurality of pipe elbows is retained within the one or more trays in a configuration that matches the one or more external pipe connection configurations.
US11098957B2
A loop-type heat pipe includes an evaporator configured to vaporize an operating fluid, a condenser configured to liquefy the operating fluid, a liquid pipe configured to interconnect the evaporator and the condenser, a steam pipe configured to interconnect the evaporator and the condenser and to form a loop together with the liquid pipe, a porous body provided in the liquid pipe and configured to retain therein the liquid operating fluid, and a solid columnar support provided in the liquid pipe and configured to guide the operating fluid liquefied by the condenser to the porous body. At least one first groove is formed at a side surface of the columnar support.
US11098956B2
The present invention relates to a plate heat exchanger system with a plate heat exchanger (10) comprising an inlet (11) and an outlet (12) of a primary circuit (13), an inlet (14) and an outlet (15) of a secondary circuit (16), at least one plate (17) separating the two circuits in a housing of the plate heat exchanger from each other, and preferably a pipe which connects the primary circuit to a heating device. For improving heat transfer between the primary circuit (13) and the secondary circuit (16), the plate heat exchanger (10) is according to the invention in the direction of gravity (G) arranged such that the plane (E), in which the plate (17) is located, is inclined relative to the gravity vector (G) and the horizontal (H).
US11098947B2
Disclosed is a refrigerator including an ultrathin wall-type insulating wall of which the thickness is made to be thin so as to increase the capacity of a storage chamber, while maintaining heat-insulating performance. A vacuum insulating material, provided inside the insulating wall, is provided so as to come into contact with an outer chamber such that the length between the outer chamber and an inner chamber is reduced. In addition, a foam material, which is formed by being foamed between the inner chamber and the outer chamber and is provided between the vacuum insulating material and the inner chamber, is formed to have a thin thickness so as to reduce the total thickness of the insulating wall, thereby increasing the capacity of the storage chamber and enabling the refrigerator to have a slim design so as to improve the aesthetics of the refrigerator.
US11098945B2
A refrigerator door and a manufacturing method of the same are disclosed. The refrigerator door includes a front panel that includes a first through hole and an input unit, a door liner, an upper cap decoration unit configured to seal an upper side of a first space defined between the front panel and the door liner, a frame attached to an inside of the front panel and defining a second space, a display assembly provided between the frame and the front panel and configured to emit light through the first through hole, and a touch sensor assembly provided between the frame and the front panel, the touch sensor assembly being fixed to a rear of the front panel at a position that corresponds to a location of the input unit. The upper cap decoration unit includes a communication hole for communicating with the second space and includes a cap cover.
US11098943B2
A transportation refrigeration system includes a refrigeration circuit that includes a compressor, a condenser, a first expansion device upstream of a first heat exchanger and a second expansion device upstream of a second heat exchanger. The first heat exchanger includes a first cooling capacity that is different from a second cooling capacity of the second heat exchanger.
US11098935B2
A method for operating an air-conditioning system of a motor vehicle, wherein the air-conditioning system comprises a refrigerant circulation and a water circulation which are thermally coupled with one another across a condenser/gas cooler. Water circulation flows through the condenser/gas cooler at a low volumetric rate of flow and a high temperature difference so the water circulation transfers heat in the heating heat exchanger to the air in a similar temperature range. Refrigerant circulation cools from 65° C. to 70° C. to −10° C. to +30° C. and water circulation raises to a temperature of 55° C. to 65° C. and that an adaptation of the temperature profile of the water circulation to the temperature profile of the refrigerant circulation takes place in the condenser/gas cooler utilizing a temperature glide of the refrigerant. The refrigerant is significantly cooled.
US11098933B2
A direct heat exchange system uniformly transfers heat through a multiphase substance, such as a refrigerant, to a barrier that emits heat radiantly and convectively. The system solely uses the multiphase substance to exchange heat between the multiphase substance and the barrier. No intermediary fluids are used. A heat exchange portion, such as a heat pump, absorbs and emits heat and transfers it to the multiphase substance. A tube portion carries the multiphase substance to the barrier. The heat is directly exchanged between the tube and the barrier. The barrier emits radiant heat or absorbs heat. A tube fastener fastens the tube to the barrier. A thermal mass portion stores heat behind the barrier. A dehumidification coil helps prevent indoor condensation and tempers the temperature of the air proximal to the barrier by drying the air. A decorative panel covers the tube portion and the thermal mass portion.
US11098928B2
A speed estimation apparatus for an AC motor includes a model deviation calculation unit, first and second angular velocity estimation units, and an adder. The deviation calculation unit calculates a model deviation based on a voltage, a current, and an estimated angular velocity of the motor. The first angular velocity estimation unit calculates a first estimated angular velocity as a low-frequency component including a DC component of a real angular velocity based on the model deviation. The second angular velocity estimation unit calculates a second estimated angular velocity as a high-frequency component of a real angular velocity based on a specific high-frequency component of the model deviation. The adder adds the first and second estimated angular velocities together. An addition value of the first and second estimated angular velocities is fed back as the estimated angular velocity to the deviation calculation unit.
US11098923B2
An electric radiator is provided. The electric radiator includes: a housing provided with an air channel cover therein; a heating assembly disposed in the housing and defining a natural convection air channel with the air channel cover, an air supply inlet being formed at a first end of the natural convection air channel and an air supply outlet being formed at a second end of the natural convection air channel above the air supply inlet, air in the natural convection air channel being heated by the heating assembly to form a natural convection in the natural convection air channel; a mesh hood mounted onto a front surface of the housing and covering the heating assembly and the air supply outlet; a first temperature limiter mounted onto the heating assembly and adjacent to the air supply outlet in an up-down direction.
US11098918B2
Systems and methods are disclosed for using one or more gateway systems for integrating multiple load control systems such that the load control systems may appear to a user and be controlled by the user as a unified load control system.
US11098917B2
The present disclosure provides a method for controlling a fresh air machine. The method for controlling the fresh air machine of an air-conditioner includes: determining whether a fault occurs in a return air temperature sensor of the fresh air machine when the fresh air machine operates normally; closing an internal valve corresponding to the fresh air machine and keeping a fan motor operating, when the fault occurs in the return air temperature sensor; determining whether a fault occurs in an delivery air temperature sensor of the fresh air machine; when the fault does not occur in the delivery air temperature sensor of the fresh air machine, obtaining an delivery air temperature of the fresh air machine and controlling the fresh air machine to operate again by using the obtained delivery air temperature as a new return air temperature. The present disclosure also provides a fresh air machine. The method for controlling the fresh air machine of the present disclosure may solve the problem that the fresh air machine cannot operate again when the fault occurs in the return air temperature sensor of the fresh air machine, thereby improving the usage experience of the user for the air-conditioner.
US11098916B2
A storage device of a system control device stores grouping information that defines an association among a refrigerant sensor, a plurality of indoor units, at least one outdoor unit, and a plurality of refrigerant leakage suppression devices. When refrigerant leakage is detected by the refrigerant sensor, the system control device performs a process for specifying, from the plurality of indoor units, an indoor unit in which the refrigerant leakage has occurred. Further, the system control device makes reference to the grouping information to operate a refrigerant leakage suppression device corresponding to the indoor unit specified by performing the above-described process.
US11098915B2
In a heating, ventilating, and air conditioning (HVAC) system using a flammable refrigerant, a concentration sensor is used to check concentrations in the conditioned air or other locations. If concentrations are detected indicative a catastrophic or large leak, a purge valve is activated to immediately purge the refrigerant from the closed-conduit circuit of the system to a safe location. With lesser leaks, the blower may be activated and the leak monitored.
US11098910B1
An HVAC decontamination system with regulated ozone output based on monitored ozone level in ambient air is disclosed. The HVAC decontamination system includes an ozone supply unit and an air analyzer. Based on one or more control signals from the air analyzer, the ozone supply unit is configured to: (i) generate ozone when an amount of ozone per unit volume of air is less than a predetermined threshold; and (ii) cease to generate ozone when the amount of ozone per unit volume of air exceeds the predetermined threshold.
US11098909B2
Disclosed are various turbulent, corrosion-resistant heat exchangers used in desiccant air conditioning systems.
US11098907B1
A containment apparatus, kit and method for containing liquid waste when cleaning a kitchen ventilation system wherein the containment apparatus includes a funnel that is removably attachable to an attachment device on a kitchen ventilation hood.
US11098901B2
In a gas turbine combustor, a sectional shape in a radial direction of either one of an inner peripheral surface of a second inner tube member and an outer peripheral surface of a first inner tube member, in a fitting portion of a crossfire tube assembly, has a plurality of small-curvature portions having a curvature smaller than a reference curvature, the reference curvature being a curvature of a portion at a maximum distance from the center of the sectional shape. This configuration ensures the crossfire tube assembly is cooled, and the Possibility of thermal deformation or fire damage is lowered, without lowering the temperature of a combustion exhaust gas passing through the crossfire tube assembly of the gas turbine combustor.
US11098895B2
An innovative oxyhydrogen (HHO) burner system including one or more burner systems is provided to eliminate emissions through total combustion. Each burner system includes at least one HHO gas supply and an external natural gas supply, both of which are connected to a gas mixer. A controller regulates the amounts of incoming HHO gas and the natural gas through being mixed. The mixed gas is supplied to each burner assembly with a predetermined pressure and flowrate to generate a flame for the total combustion of the exhaust stream inside the exhaust pipe. With feedback from an exhaust measuring system inside the exhaust pipe adjacent the outlet, the controller can adjust the burner system for optimal operations and achieve total combustion. Thus, by passing the exhaust or gases through a substantial cross-section covered by each flame, emissions can be greatly reduced or eliminated.
US11098893B2
The present disclosure provides a nozzle structure for a hydrogen gas burner apparatus capable of reducing an amount of generated NOx. A nozzle structure for a hydrogen gas burner apparatus includes an outer tube and an inner tube concentrically disposed inside the outer tube. The inner tube is disposed so that an oxygen-containing gas is discharged from an opened end of the inner tube in an axial direction of the inner tube. The outer tube extends beyond the opened end of the inner tube in the axial direction of the inner tube so that a hydrogen gas passes through a space between an inner circumferential surface of the outer tube and an outer circumferential surface of the inner tube.
US11098892B2
A cooking appliance is provided, including a gas burner assembly for a cooktop floor of a cooking appliance. The gas burner assembly includes a burner body having a single combustion chamber and a plurality of flame ports in fluid communication with the single combustion chamber, a first mixing tube in fluid communication with the single combustion chamber and configured to supply a first air-gas mixture to the single combustion chamber, and a second mixing tube in fluid communication with the single combustion chamber and configured to supply a second air-gas mixture to the single combustion chamber.
US11098891B2
A gas burner unit for a cooktop includes a spreader having a first side with a plurality of gas outlets and a second side opposite the first side and defining a portion of a fluid path. The spreader further defines a venturi in fluid communication with the gas outlets and extending away from the second side. The gas burner unit further includes an orifice holder having a protrusion defining an upwardly directed primary air inlet therethrough. The upwardly directed primary air inlet is in fluid communication with the fluid path associated with the spreader on a first end thereof and with the venturi on a second end thereof opposite the first end.
US11098890B2
The object of the present invention is an atmospheric gas burner (300) for cooking tops (400), in particular household cooking tops (400), where the air-gas mixture is obtained by the effect of the gas supply pressure using the principle of the tube ejector (10; 310) of Venturi that has a sufficient quantity Z≥1 of ejectors (310) to supply, globally, the maximum power (Wb) provided for the same burner (300). Each of said ejectors (310) develops on a horizontal plane, has the axis of its diffuser (315) which in the first stretch (322) is substantially rectilinear and tangential to a circle with centre on the central axis (324) of said burner (300) while in the second stretch (323) gradually bends substantially as a spiral towards the same central axis (324), leads, downstream of said diffuser (315), to a converging channel (327) which gradually bends vertically upwards and which, in turn, leads to one or more diffusion chambers (328) to which one or more flame spreading caps (318) act as a cover.
US11098885B1
A lighting apparatus includes a first light source, a first light housing, a second light source and a second light housing. The first light housing is for disposing the first light source to emit a first light from a first direction via a first light opening. The second light housing is for disposing the second light source to emit a second light from a surrounding lateral wall of the second light housing. An angle between the first light direction and a radial direction of the surrounding lateral wall is between 60 degrees to 150 degrees. An inner wall of the second housing is surrounding and fixed to a neck portion of the first light housing.
US11098883B2
A lamp base includes a lamp body, a ring frame and a circumferential projection component. The lamp body includes an illuminating component, a ring frame and a circumferential projection component. The ring frame surrounds the lamp body. Such that the lamp body is seated within the ring frame. The ring frame also rotates relative to the lamp body along a rotational axis of the lamp base. The circumferential projection component has an inner circular through hole to allow the lamp body to pass through. The circumferential projection component detachably and rotatably engages with the ring frame. The lamp body rotates relative to at least one of the ring frame and the circumferential projection component along the rotational axis, so as to adjust an illumination angle of the illuminating component.
US11098880B2
A luminaire assembly includes a frame and a back plate. In some examples, the frame includes a lip, and the back plate includes a tab. The back plate is positionable within a housing area of the frame such that the tab is engaged with the lip and the back plate is retained within the frame. In other examples, a luminaire assembly includes a wireless module with an antenna positioned adjacent to a module opening of the back plate. The antenna provides wireless transmissions above the top side of the back plate and below the bottom side of the back plate. A luminaire support clip for a luminaire assembly includes a base and a tab. The tab and the base define a receiving area, and the luminaire support clip receives a portion of an edge of a back plate of the luminaire assembly within the receiving area.
US11098879B2
A lighting fixture for use in a security detention facility. The lighting fixture includes a unitary housing adapted to be mounted to a surface in the security detention facility, a first bracket disposed within the unitary housing, and a light source coupled to the first bracket, the light source including a plurality of light-emitting diodes (LEDs). When the unitary housing is mounted to the surface in the security detention facility, the internal components of the lighting fixture (e.g., the light source) are not accessible, such that inmates of the security detention facility are unable to damage the internal components of the lighting fixture or access the internal components of the lighting fixture to hide weapons or contraband therein or use those components to harm themselves, other inmates, and/or security personnel.
US11098875B2
A diffuser and an Indication panel are provided. The diffuser includes: a plurality of light-transmitting regions; and a light-shielding region located between adjacent ones of the plurality of light-transmitting regions, and each of the light-transmitting regions corresponds to an icon symbol on the indication panel. The diffuser is employed to avoid a phenomenon of light leakage between adjacent icon symbols, thereby improving the display effect of the indication panel.
US11098863B2
The Multiple functions LED nigh light not only offer LED illumination under predetermined colors, functions, effects including at least one of color-changing, color selection, functions selection with preferred switch, sensor, PIR sensor, radar sensor, rechargeable battery, power fail light, USB charging or be-charged system, outlets, audio device, surge/over heat/over charge/short-circuit protection, function selection between motion or non-motion or dust-to-dawn, or other preferred additional-functions list inside text below. The said multiple functions not only offer LED illumination but also offer at least one of additional-functions such As LED motion sensor night light have color-changing, color-selection, functions selection and the said additional-functions including power fail light and/or USB-charger or other preferred additional-functions such as outlets, or camera with wifi incorporate with download APP for wireless or remote control, adjustment, setting to offer people safety and multiple functions.
US11098854B2
A robotic vehicle for traversing surfaces is provided. The vehicle is comprised of a front chassis section including a magnetic drive wheel for driving and steering the vehicle and a front support point configured to contact the surface. The vehicle also includes a rear chassis section supporting a follower wheel. The front and rear chassis sections are connected by joints including a hinge joint and a four-bar linkage. The hinge is configured to allow the trailing assembly to move side-to-side while the four-bar linkage allows the trailing assembly to move up and down relative to the front chassis. Collectively, the rear facing mechanism is configured to maintain the follower wheel in contact with and normal to the surface and also maintains the front support in contact with the surface and provides stability and maneuverability to the vehicle while traversing surfaces regardless of surface curvature and vehicle orientation.
US11098852B1
A vapor cooled insulation structure includes at least one vapor sealed layer, created with discrete spacers between two layers. A vapor transport layer is created within these layers through which a cold fluid may flow to intercept and remove heat from an underlying structure. In one example, the vapor cooled system carries cold vapor which is in direct contact with an underlying cryogenic tank structural support.
US11098848B2
A system for distributing semisolid lubricant, including a semisolid lubricant tank and a high pressure pumping system that intermittently feeds, during a lubrication cycle, at least one first duct, the at least one first duct feeding a plurality of distributors adapted to sort the semisolid lubricant to a plurality of users; a controlled suction/delivery device, fluidly associated with the first duct, for controlled suction/delivery of a part of the semisolid lubricant conveyed by the first duct. The controlled suction/delivery device configured to suck a volume of semisolid lubricant from the first duct during a step of inactivity of the pumping system on the first duct, and to introduce the previously suctioned semisolid lubricant in the first duct during a step of activity of the pumping system on the first duct.
US11098839B2
A fastener structure includes a body portion, a control portion and a fastening portion. The control portion is movably fitted to the body portion. The control portion has a head portion and a limiting portion. The fastening portion is movably disposed at the body portion. The limiting portion is adapted to limit the fastening portion. Therefore, the body portion is disposed at the second object, and the control portion causes the fastening portion to be coupled to or separated from the first object, so as to couple together and separate at least two objects repeatedly and rapidly.
US11098837B2
A fitting element for use in rehabilitation of pipelines with a liner. The fitting element is a composite article of reinforcing fibers and a resin composition. A first part of the fitting element has reinforcing fibers and a substantially fully cured resin composition, and a second part has dry reinforcing fibers that can accept a curable resin composition that optionally originates from the liner to form a functional joint between the fitting element and the liner. An interface layer of the fitting element structurally connects the first and the second part. A method for manufacturing the fitting element, as well as a method for rehabilitation of a pipeline with a tubular liner and a joined assembly of the fitting element and a liner for use in rehabilitating a pipeline.
US11098834B2
An assembly includes a tubular body having an axis, an axial end, a bore that is axial an aperture and a retainer groove formed in the bore and contiguous with the aperture. The assembly also includes a retainer mounted in the retainer groove. The retainer has a debris shield located external to the tubular body. The retainer includes a nominal configuration wherein the debris shield is configured to close off access to the aperture and the retainer groove to prevent debris from accumulating therein. In addition, the retainer includes an expanded configuration wherein the debris shield is not configured to completely close off access to the aperture and the retainer groove.
US11098832B2
A pipe seal assembly includes a stiffener having an axis, an inner diameter (ID) and an outer diameter (OD). The seal assembly also includes an elastomer that is coupled to and extending though the stiffener, such that the elastomer is located on both the ID and the OD of the stiffener. A method of manufacturing a tubular member includes forming the tubular member with a female end; locating a seal assembly having an extension inside the female end, pressing the seal assembly into the female end to form a seal groove, belling the tubular member using the seal assembly to form a belled shape, and pressing the extension into the interior of the female end to form a spline groove inside the female end adjacent the seal groove; and then sacrificially removing the extension, but leaving the seal assembly to form a final assembly.
US11098831B2
A fluid coupling includes a male element and a female element, which has a gear reduction member and a main body defining a main inner channel, a plunger, and a slide valve movable between a closed configuration and an open configuration. The slide valve has an outer slide valve and an inner slide valve. In the closed configuration, the outer slide valve is in a forward position and the inner slide valve is in a forward position contacting the outer slide valve and the plunger. In the open configuration, the outer slide valve is in a withdrawn position and the inner slide valve is in an offset position. The gear reduction member is disengaged from a front stop surface on the main body, a rear stop surface on the outer slide valve, or a front stop surface on the inner slide valve during a coupling phase.
US11098829B2
Swivel joints comprise a male sub, a female sub, annular races, ball bearings, a replaceable sleeve, and first and second pressure seals. The male sub is rotationally coupled to the female sub at, respective, generally tubular joint ends thereof. A passage extends through the subs. The female joint end and male joint end are rotationally coupled by ball bearings in the annular races. The replaceable sleeve is received in enlarged inner diameter portions of the male joint end and the female joint end. The first pressure seal ring is mounted between the replaceable sleeve and the enlarged diameter portion of the male joint end. The second pressure seal ring is mounted between the replaceable sleeve and the enlarged diameter portion of the female joint end.
US11098828B2
An apparatus includes first and second electrically conductive tubes, first and second electrical isolators, and a nut. The first electrical isolator has a central passageway. The first electrically conductive tube has a flared end disposed around the first electrical isolator. The flared end includes external threads. The second electrically conductive tube has an outer flange. The second electrical isolator is disposed around the second electrically conductive tube and engages the outer flange. The nut is disposed around the second electrically conductive tube and engages the second electrical isolator. The nut includes internal threads corresponding to the external threads of the flared end of the first electrically conductive tube.
US11098824B2
A fluidic valve device intended to be arranged in a fluidic circuit, the device notably including a first switching assembly including a first compartment defining a first internal space and a first permanent magnet arranged with the freedom to slide in the first internal space, a second switching assembly including a second compartment defining a second internal space and a second permanent magnet arranged with the freedom to slide in the second internal space, the first permanent magnet and the second permanent magnet being arranged relative to one another in such a way as to be in a first state of magnetic interaction, making it possible to obtain a first stable mechanical configuration or in a second state of magnetic interaction, it possible to obtain a second stable mechanical configuration.
US11098813B2
Fluid control valves including single-opening, binary fluid control valves that are initially closed and can be opened one time only to allow a fluid transfer between two spaces separated by a fluid impermeable barrier. Applications of valves of this type include inflatable devices, including but not limited to medical device balloons, in particular gastric balloons for weight loss.
US11098811B2
A valve system includes a bellows-type pressure relief valve and an attachment assembly. The bellows-type pressure relief valve includes a main housing defining a main chamber, an inlet opening, and an outlet opening, a bonnet housing defining a bonnet chamber and a bonnet vent in the bonnet housing, and a bellows structure defining a bellows chamber fluidly connected to the bonnet chamber. The attachment assembly is coupled to the bonnet vent to selectively plug the bonnet vent. The attachment assembly include a coupling to couple to the bonnet vent, a pressure sensor to detect a pressure in the bonnet chamber, and a vent structure including a vent valve to selectively open in response to an applied force or in response to the pressure sensor detecting a pressure in the bonnet chamber reaching a pressure threshold.
US11098810B2
A hammer actuates a piston in a rapid response trigger to depressurize a control chamber, opening a path from a high pressure chamber to an exit conduit. The hammer acts in line with, but in opposition to, a spring biasing the control chamber closed using a centrally disposed piston. By aligning the spring, piston, and hammer in the same line of force, the response to the hammer is both more reliable and faster that prior triggers.
US11098794B2
A locking angle gear box is provided. The locking angle gear box includes a torque transfer assembly, a ring gear, at least one connection drive assembly and an actuator. The torque transfer assembly is configured to communicate torque between the torque transfer assembly and a pair of outputs to halfshafts. The ring gear is rotationally supported on the torque transfer assembly. The ring gear is configured to transfer torque between at least a portion of a driveline and the torque transfer assembly. The at least one connection drive assembly is configured to selectively lock rotation of the torque transfer assembly with the rotation of the ring gear to selectively couple torque between the torque transfer assembly and the ring gear. The actuator is in communication with the at least one connection drive assembly to selectively manipulate the at least one connection drive assembly.
US11098792B2
A transmission system for a machine is coupled to an engine of the machine that is adapted to generate power. The transmission system includes a hydraulic power path including a variator coupled to the engine. The transmission system also includes a mechanical power path. The mechanical power path includes a first gear arrangement including a plurality of gears. The mechanical power path also includes a second gear arrangement including a plurality of gears. The second gear arrangement is coupled with the first gear arrangement to receive the variable rotational power from the first gear arrangement. The mechanical power path further includes a first clutch assembly and a second clutch assembly. Further, the second gear arrangement directs the variable rotational power received from the first gear arrangement towards a final output member of the machine in a selected direction.
US11098785B2
A mount for supporting a power train in the vehicle, may include a stopper assembly combined on an internal surface of a housing to be disposed in an annular shape along the vicinity of the outsides of insulators combined with the housing, wherein the stopper assembly may include: an external ring combined on the internal surface of the housing; and a plurality of stopper members fixed on an internal surface of the external ring to be positioned along the vicinity of the outsides of the insulators, each of the a plurality of stopper members being spaced from each other to be in contact with an internal insulator of the insulators.
US11098780B2
A suspension includes: a cylinder; a piston rod including a piston provided at one end-side, and inserted in the cylinder together with the piston; an outer tube part opened at the one end-side, a position of which relative to the piston rod is fixed at the other end-side, and configured to receive therein at least a part of the cylinder; and a tubular rolling diaphragm having one end disposed at the cylinder and the other end fixed to the outer tube part, and configured to roll in conjunction with displacement of the piston rod with respect to the cylinder. The rolling diaphragm becomes convex toward the other end-side of the outer tube part and is accommodated in the outer tube part, upon contraction of the suspension.
US11098767B2
A clutch for use in actuating an aircraft wing tip device is disclosed. The clutch includes first and second friction members each having a frusto-conical friction surface, and a third friction member arranged coaxially with, and between, the first and second friction members. The third friction member has first and second frusto-conical friction surfaces. When the clutch is engaged, the first and second friction surfaces of the third friction member are brought into contact with the friction surfaces of the first and second friction members, respectively. The clutch also includes spacer means operable to separate the friction surfaces from one another when the clutch is in a disengaged state.
US11098762B1
A bearing cage assembly is disclosed that includes two sub-assemblies. Both cage sub-assemblies include a shell half formed from plastic, and defining a plurality of rolling element pockets and openings. Each sub-assembly also includes a frame half formed from metal, and including a rim and a plurality of crossbars. The shell halves are overmolded with the frame halves. The first cage sub-assembly and the second cage sub-assembly are connected to each other via insertion of the crossbars into the openings of the other sub-assembly, such that free ends of the crossbars engage the other rim.
US11098761B2
A sliding member incudes a back-metal layer and a sliding layer made of a copper alloy. The back-metal layer is made of a hypoeutectoid steel including 0.07 to 0.35 mass % of carbon, and has a structure including a ferrite phase and pearlite. The back-metal layer includes a pore existing region including a plurality of closed pores having an average size of 1 to 10 μm. The pore existing region extends from the bonding surface toward an inner portion of the back-metal layer and having a thickness of 2 to 20 μm. At least a part of the plurality of closed pores has contour that is partially formed by the bonding surface in a cross-sectional view. A ratio V2/V1 of a total volume V2 of the closed pores to a volume V1 of the pore existing region is 0.02 to 0.08.
US11098755B2
Systems and methods related to hydrodynamic bearings are provided. One example hydrodynamic bearing system includes a sleeve assembly including a cross-member fluidically dividing a first interior cavity from a second interior cavity, a first shaft positioned in the first interior cavity, and a second shaft positioned in the second interior cavity. The hydrodynamic bearing system further includes a first journal bearing including a first fluid interface surrounding at least a portion of the first cantilever shaft and configured to support radial loads and a second journal bearing including a second fluid interface surrounding at least a portion of the second cantilever shaft and configured to support radial loads.
US11098752B2
The ball joint includes a housing that has an inner bore. A ball stud is partially received in the inner bore. The ball stud has a ball portion and a shank portion which are separate pieces from one another and which are in threaded engagement with one another. At least one bearing is disposed in the inner bore and slidably supports the ball portion of the ball stud for allowing the ball stud to rotate and articulate relative to the housing. The ball portion is shaped through a forging operation, and the shank portion is shaped through a process which includes machining and does not include forging.
US11098743B2
Screws are provided which have a longitudinal axis and include a threaded shank and a head wherein a socket is formed to be engaged by a wrench and having a pluri-lobed outer profile comprising a series of lobes circumferentially offset and separated by a series of circumferentially offset protrusions of the head. Each protrusion is delimited by two flanks and a front length joining the radially inner ends of the flanks and is convex and symmetrical with respect to a center axis radially oriented with respect to the longitudinal axis. The front length is formed by a center face and two inclined side faces each of which joins the radially inner end of the respective flank with a respective end of the center face, which is oriented orthogonally with respect to the center axis of the protrusion. Pluri-lobed wrenches adapted for use with such screws are also provided.
US11098742B2
A blind tacking rivet includes a stem and a sleeve. The stem includes a body and a stem head. The stem head is removable from the body. The stem head deforms a portion of the sleeve during removal of the stem head. The stem head may be discarded or may be embedded within the sleeve.
US11098725B2
A hydrodynamic heater pump may include a housing and a stator fixed relative to the housing. A rotor may be coaxially aligned with and positioned adjacent the stator. The rotor and the stator define an interior region of a hydrodynamic chamber operable for heating a fluid present within the interior region of the hydrodynamic chamber. The rotor may be attached to a drive shaft for concurrent rotation therewith. The rotor may be moved axially along an axis of rotation of the drive shaft between a pumping mode position and a heating mode position. The rotor may be located a first distance from the stator when arranged in the heating mode position and a second distance from the stator when arranged in the pumping mode position. The second distance may be greater than the first distance.
US11098716B2
The scroll-type compressor comprises a fixed scroll and an orbiting scroll engaged with each other; a back pressure control valve 50 inserted from the large-diameter side of the stepped-shaped pressure release passage L4 which communicates between a suction chamber H1 and a back pressure chamber H3 which applies a back pressure for pressing the orbiting scroll against the fixed scroll. The scroll-type compressor further comprises an O-ring 60 fitted in a circumferential groove 53a formed in the outer peripheral surface of the valve 50, and a ring member 61 press-fitted into the large-diameter side of the pressure release passage L4, and holds the valve 50 between the ring member 61 and the stepped portion. Then, the compressive stress is unlikely to be applied to the valve 50, and the deformation of the valve 50 is reduced to prevent the reduction in the control accuracy of the back pressure.
US11098714B2
The invention relates to a pump, having a contour ring, having a rotor, having vanes, having side plates, having a housing and a housing cover, having under-vane grooves for supplying the lower vane faces with pressure, the vanes being arranged radially displaceably in the rotor and extending under the vanes as a result of the pressure and being pressed against the contour ring. Furthermore, the invention relates to a system for supplying oil to a consumer.
US11098712B2
A gear pump comprises an internal gear (10), a first external gear (20) and a second external gear (30), a case member (50) having a one end side accommodation portion (52) for retaining these gears (10,20,30), an other end side accommodation portion (53) at other end side and a partition wall portion (54) therebetween, a cover member (70) and a plate member (80). A pump chamber (P) defined inside the internal gear (10) is divided into a first pump chamber (P1) which has a first intake-discharge space (L1) and a first discharge-intake space (H1), and a second pump chamber (P2) which has a second intake-discharge space (L2) and a second discharge-intake space (H2). The plate member has a first communication path (81) and a second communication path (82) between the plate member (80) and the cover member (70). The one side communication passage (57) is communicated with the first communication path (81). Two penetrating holes (82b,82c) are formed on the plate member (80). An other side communication passage (82a), which communicate the two penetrating holes (82b,82c) with each other, is formed between the plate member (80) and the cover member (70).
US11098710B2
The disclosed inlet check valve is used in a high pressure fuel pump and is comprised of a valve member integrally connected to a valve stem which is coupled to an inlet valve armature. The valve member has a stroke along an axis between an open position and a closed position. An inlet valve solenoid generates a magnetic field in an inlet valve pole to attract the inlet valve armature and move the valve member from the open position to the closed position. In the open position, the valve member contacts an inlet valve stop and a gap greater than the stroke of the valve member is defined along the axis between the inlet valve armature and the inlet valve pole. In the closed position, an inlet valve seat mates with the valve member and an armature gap remains between the inlet valve armature and the inlet valve pole.
US11098700B2
An enclosure and a dynamic heat dissipation method for a heat source inside the enclosure and a dynamic heat dissipation system are provided. The dynamic heat dissipation method includes: acquiring a relatively low temperature area of the enclosure; and driving the heat source to move to the relatively low temperature area. A heat source, which is conventionally at a relatively fixed position, is artificially and actively transformed into a mobile heat source, so as to allow the heat source to be self-adapted to the temperature field; a relatively low temperature area inside the enclosure is searched, taking advantage of the characteristics of temperature differences, the position of the heat source is adjusted and the heat dissipation layout is adjusted, thereby providing the heat source with an optimal heat transfer direction from inside to outside and an enclosure environment where the heat is dissipated at a maximum rate.
US11098697B2
Equipment for handling a wind turbine component includes a lifting cable and a mounting block having a block main body with a cable passage and a pair of bushings coupled to the mounting block. Each bushing has an aperture defined by an aperture wall and the lifting cable extends through the aperture of each of the bushings. At least an outer region of the aperture wall forms a closed loop about the lifting cable and is substantially circumferentially continuous. This allows the lifting cable extending the bushings to move in a circumferential direction along the aperture wall relative to the bushings during use. A method of assembling such handling equipment and a method of using such equipment for handling a wind turbine component is also disclosed.
US11098688B2
Systems and methods for operating a vehicle that includes an engine that may be automatically stopped and started are described. In one example, an amount of time to start an engine and a rate of engine acceleration are adjusted in response to what type of event triggered an automatic engine start.
US11098684B2
A fuel supply device includes a fuel pump, a pump case, a cap, an O-ring, and a connection assembly. The pump case includes a case main body configured to receive the fuel pump and a discharge port connector. The cap includes a suction port connector. The O-ring is interposed between a fuel discharge port of the fuel pump and discharge port connector. The connection assembly includes a plurality of engagement projections and a plurality of engagement pieces configured to mate and engage with the engagement projections. The fuel discharge port of the fuel pump is configured to reach the O-ring coupled to the discharge port connector of the pump case simultaneous with the engagement between the engagement projections and the engagement pieces when the fuel suction port of the fuel pump and the suction port connector of the cap are connected together.
US11098674B2
Various implementations include a combustion engine piston, including a skirt in a counter-part and including a first contact area of the piston in the counter-part, a head which extends transverse to a central axis, and a ring carrier which comprises at least two lands and at least two grooves for receiving the rings, including a first land adjoining the head and a second land situated between the first land and the skirt, wherein the lands include at least one contact land having a diameter greater than a minimum diameter of the skirt to form a second contact area of the piston in the counter-part, and wherein at least one contact land comprises a friction-reducing surface coating, formed at least on a radial sector covering an angle of at least 30 degrees, and up to on a single sector covering an angle of 360 degrees.
US11098673B2
A cylinder head arrangement for an internal combustion engine is provided. The cylinder head includes an integrated exhaust manifold having first and second exhaust passages to collect exhaust gas from respective cylinders to direct the exhaust gas to respective outlets of the cylinder head. The cylinder head includes a flange where the first and second outlets exit the cylinder head for connection with a turbocharger.
US11098672B2
A method of forming an engine component includes providing a cylinder liner main body having a curved interior wall forming a cylinder bore extending along a bore axis and a curved exterior wall formed circumferentially about the curved interior wall. The method includes disposing a coating layer onto the interior wall and the exterior wall. A cylinder liner is provided that includes a main body and a coating layer disposed on an exterior wall and on an interior wall of the main body.
US11098671B2
A timing computation unit determines whether to execute compression latter-half injection to inject fuel in a latter half of a compression stroke of an internal combustion engine based on an operation state of the engine and computes an injection timing and an ignition timing of fuel. A timing correction unit corrects the computed injection timing to an advance side and corrects the computed ignition timing to a retard side, in a case where a detected fuel pressure is lower than a target fuel pressure. The timing correction unit corrects the computed injection timing to the retard side and corrects the computed ignition timing to the advance side, in a case where the detected fuel pressure is higher than the target fuel pressure. A combustion control unit controls a fuel injection device and an ignition device based on the injection timing and the ignition timing.
US11098666B1
A system includes a three-way catalyst (TWC) sulfur load module, a cylinder/fuel cutoff module, a fuel control module, and a valve control module. The TWC sulfur load module is configured to determine an amount of sulfur deposited on a three-way catalyst of an engine in a vehicle. The cylinder/fuel cutoff module is configured to determine whether to enable deceleration cylinder cutoff (DCCO) based on the amount of sulfur deposited on the three-way catalyst. The fuel control module is configured to control a fuel injector to selectively stop fuel injection in the engine when DCCO is enabled. The valve control module is configured to selectively maintain intake and exhaust valves of the engine in a closed position when DCCO is enabled.
US11098659B2
A method for continuous variable valve duration (CVVD) startup control may include a duration time delay control to prevent an engine revolutions per minute (RPM) variation through applying of a delay time with respect to a startup duration in the case where the startup duration at an initial startup is switched to a driving region duration after the startup lapse by a CVVD controller.
US11098657B2
A method and a system for stopping a gas turbine comprising a gas generator provided with rotary members and a combustion chamber. The gas turbine includes a fuel circuit controlled by calculation means in communication with a selector. The method includes a step of closing of the fuel circuit on order of the calculation means when the selector is positioned in a first position for causing the gas turbine to stop. If the gas turbine was not idling prior to the closure, or if it was idling, but for a length of time shorter than a threshold, then an electrical machine automatically rotates the rotary members for a limited duration.
US11098653B2
A gas turbine engine component assembly is provided. The gas turbine engine component assembly comprising: a first component having a first surface and a second surface opposite the first surface wherein the first component includes a cooling hole extending from the second surface to the first surface through the first component; a second component having a first surface and a second surface, the first surface of the first component and the second surface of the second component defining a cooling channel therebetween in fluid communication with the cooling hole for cooling the second surface of the second component; and a deflector forming a passageway with the second surface of the first component, the passageway configured to direct airflow into the cooling channel in a lateral direction parallel to the second surface of the second component such that a cross flow is generated in the cooling channel.
US11098652B2
Isolation seals for gas turbine engines are described. The isolation seals include a first interface member configured to be fixedly attached to a first case structure, the first interface member being a full-hoop structure, a housing configured to be mounted to a second case structure, a connector pin arranged within the housing and moveable relative to the housing, and a second interface member located on an end of the connector pin, the second interface member being a full-hoop structure. The first interface member and the second interface member are engageable to form a seal therebetween.
US11098651B1
A mobile fracking system and methods may include a gas turbine housed at least partially inside a trailer and an exhaust attenuation system configured to receive exhaust gas from the gas turbine. The exhaust attenuation system may include a lower elongated plenum configured to receive exhaust gas from the gas turbine and an upper noise attenuation system that is movably connected relative to a distal end of the lower elongated plenum.
US11098650B2
There is disclosed a diffuser pipe assembly having: a plurality of diffuser pipes circumferentially distributed around the central axis and configured for diffusing a flow of compressed air received from an impeller, the diffuser pipes having a diffuser conduit for directing the flow of compressed air, the diffuser conduit curving between an inlet end and an outlet end along a conduit axis, the diffuser conduit having a baseline surface, a first subset of the diffuser pipes having aero-dampers protruding from the baseline surfaces of their diffuser conduits such that the diffuser pipes of the first subset have a natural vibration frequency different than a natural vibration frequency of at least a second subset of the diffuser pipes.
US11098649B2
High-pressure fan duct bleed air is used to pressurize a cavity between the fan duct inner wall and the inner wall thermal insulation blankets. The cavity is pressurized to prevent hot air from the nacelle core compartment from flowing under the insulation blankets and degrading the fan duct inner wall. Pressure regulating valves (PRV) allow better control of the cavity pressure during different phases of the flight profile and under different levels of insulation blanket seal degradation by passively controlling exit area from the cavity based on an established pressure limit. Moreover, the pressurization system can be implemented as a passive cooling system by increasing the mass flow rate into the cavity and then the core compartment to a level suitable for core compartment cooling. The cooling air can be vented at the forward end of the insulation blanket assembly to provide core compartment ventilation flow, or vented through dedicated ports in the insulation blanket for targeted core compartment component cooling.
US11098647B2
A system for managing thermal transfer in at least one of an aircraft or a gas turbine engine includes a first engine system utilizing an oil for heat transfer. The oil of the first system has a temperature limit of at least about 500° F. The system additionally includes a fuel system having a deoxygenation unit for deoxygenating fuel in the fuel system, as well as a fuel-oil heat exchanger located downstream of the deoxygenation unit. The fuel-oil heat exchanger is in thermal communication with the oil in the first engine system and the fuel in the fuel system for transferring heat from the oil in the first engine system to the fuel in the fuel system.
US11098640B2
A method for determining a basic boost pressure of a gas conducting system of an internal combustion engine with a turbocharger that has a compressor, a turbine, a shaft connecting the compressor and the turbine, and a turbocharger actuator for varying a flow velocity through the turbine or a pressure ratio across the turbine. The method comprises calculation of an exhaust gas back pressure at the open turbocharger actuator position, wherein the flow velocity through the turbine or the pressure ratio across the turbine is minimal in the open turbocharger actuator position, and determination of the basic boost pressure as a function of the calculated exhaust gas back pressure at the open turbocharger actuator position. An engine controller for carrying out a method for determining a basic boost pressure is also provided.
US11098633B2
The invention relates to an exhaust gas aftertreatment system for an internal combustion engine comprising a first catalytic converter that has a first exhaust gas inlet to admit the exhaust gas into the first catalytic converter and has an exhaust gas outlet positioned on the opposite side, also comprising a second catalytic converter that is arranged downstream from the first catalytic converter and that is flow-connected to the first catalytic converter in order to allow the exhaust gas to pass from the first catalytic converter into the second catalytic converter and that likewise has a second exhaust gas inlet that is at a physical distance from the exhaust gas outlet of the first catalytic converter. The exhaust gas aftertreatment system also comprises a particulate filter that is arranged downstream from the second catalytic converter and that is flow-connected to the second catalytic converter in order to allow the exhaust gas to pass from the second catalytic converter into the particulate filter. A flow-around area is formed adjacent to an outer surface of the first catalytic converter in which the exhaust gas flows from the exhaust gas outlet to the second exhaust gas inlet into the second catalytic converter.
US11098628B2
A clogging determination device includes a first antenna disposed at one of a side of a first end and a side of a second end of a filter disposed internally of a case, a second antenna disposed at the other of the side of the first end and the side of the second end of the filter, a multi-tone signal generator that has an output terminal coupled to the first antenna, outputs from the output terminal a multi-tone signal obtained by compositing a plurality of signals having different frequencies, and moves a position of an envelope of the multi-tone signal emitted to the filter from the first antenna, a detector that is coupled to the second antenna, and detects an intensity of the multi-tone signal received by the second antenna, and a determinator that determines a degree of clogging of the filter based on an intensity of the multi-tone signal.
US11098626B2
A fluid injection device includes a valve body of a cylindrical shape and a valve member, which is movably accommodated in the valve body and which has a valve surface portion to be seated on or separated from a valve seat portion formed in an inside of the valve body. The valve member has an inside passage through which urea aqueous solution flows and a communication port, which is opened at an outer peripheral surface of the valve member and at a position of an upstream side of the valve surface portion in a flow direction of air. An annular fluid passage, through which the air flows, is formed between an inner peripheral surface of the valve body and the outer peripheral surface of the valve member. The communication port is connected to the annular fluid passage at a connecting passage portion. A cross-sectional passage area of the annular fluid passage at the connecting passage portion is smaller than a cross-sectional passage area of the annular fluid passage at an upstream-side passage portion thereof.
US11098617B2
A hydraulic camshaft adjuster for adjusting the control times of gas exchange valves of an engine is provided. A stator is rotatable synchronously with a crankshaft of the engine. A rotor is arranged so as to be rotatable relative to the stator, and is rotatable synchronously with a camshaft. A plurality of ribs are provided on the stator, dividing an annular chamber between the stator and the rotor into a plurality of pressure chambers. A rotor hub and a plurality of blades extend radially outward from the rotor hub, dividing the pressure chambers into two working chambers having different effective directions. An additional connectable pressure booster is provided at least in an effective direction of the hydraulic camshaft adjuster. The pressure booster can boost the rotor when active.
US11098612B2
A gas turbine engine includes a compressor, a combustor fluidly connected to the compressor via a core flowpath, and a turbine fluidly connected to the combustor via the core flowpath. The turbine includes at least one stage having a plurality of rotors and a plurality of vanes. An outer diameter of the core flowpath at at least one stage is at least partially defined by a set of circumferentially arranged blade outer air seals. Each blade outer air seal includes a platform. An internal cooling cavity is defined within the platform. At least one mateface of the platform includes a cooling trench, and a first set of cooling holes connecting the internal cavity to the cooling trench.
US11098607B2
An air-fire seal designed to be attached to a first tubular member of a turbomachine, such as a bleed duct, and to rest against a second member of the turbomachine, such as an intermediate casing hub, includes an attachment base having an annular shape around a reference axis (Y); a first annular fire-stop lip extending from the attachment base over a first length (L1); and a second annular air-sealing lip extending from the attachment base over a second length (L2) lower than the first length and facing the first lip.
US11098604B2
An engine component for a gas turbine engine may include a radial channel and an axial channel disposed in the engine component. The radial channel may be configured to direct a cooling air in a radial direction. The axial channel may be configured to direct the cooling air in a direction substantially perpendicular to the radial direction. A cross-section area of the axial channel is greater than a cross-section area of the radial channel, such that the radial channel remains the metering channel, independent of the relative location due to radial movement of the engine component with respect to an adjacent engine component.
US11098596B2
A turbine airfoil includes a leading edge, a trailing edge, a pressure side wall extending between the leading edge and the trailing edge, a suction side wall extending between the leading edge and the trailing edge, a cooling air supply cavity disposed within the turbine airfoil, and a near wall cooling cavity disposed within the turbine airfoil and fluidly coupled to the cooling air supply cavity to receive cooling air. In addition, the near wall cooling cavity partially extends along the suction side wall from adjacent the leading edge to a location more proximal the trailing edge. Moreover, the near wall cooling cavity provides near wall cooling to a high heat load region along the suction side wall.
US11098592B2
A turbomachine includes a spool; and a turbine section including a turbine and a turbine center frame. The turbine includes a first plurality of turbine rotor blades and a second plurality of turbine rotor blades alternatingly spaced along an axial direction and rotatable with one another. The turbomachine also includes a first support member, the first plurality of turbine rotor blades coupled to the spool through the first support member; a second support member, the second plurality of turbine rotor blades supported by the second support member; and a bearing assembly including a first bearing and a second bearing, the first bearing and the second bearing each rotatably supporting the second support member and each being supported by the turbine center frame.
US11098587B2
A rotary piston engine comprises a housing (10), which forms an interior space (11), and at least two rotary pistons (20, 30), which are arranged in the interior space (11). Formed on the interior space (11) are an inlet opening (13) and an outlet opening (15) to guide a fluid through the interior space (11). The rotary pistons (20, 30) are thereby driven by fluid flowing through. Each rotary piston (20, 30) has on its outer circumference at least two sealing strips (21, 31). According to the invention each rotary piston (20, 30) comprises at least two cavities (27, 37), in each of which a tube (38B) or an elastic solid rod is arranged. The sealing strips (21, 31) project into the cavities and against the tube (38B) received therein or the elastic solid rod. Through the tube (38B) or the rod, the sealing strips (21, 31) are pushed radially outwards.
US11098586B2
A crank and connecting rod mechanism, comprising at least one piston, which reciprocates within at least one cylinder, comprising: at least one connecting rod, comprising: a piston end pivotally connected to the at least one piston, a crank end; at least one gear set, comprising: a crankpin, the crank end pivotally connected to the crankpin; a crank gear; a crank gear shaft, the crank gear rotatably mounted on the crank gear shaft, the crankpin located between centerline of the crank gear shaft and radius of the pitch circle of the crank gear; a stationary gear, the crank gear meshing with the stationary gear, the crank end driving the crankpin, which drives the crank gear and the crank gear shaft about the stationary gear; the crank pin and the crank end rotating about the stationary gear and following the path of a roulette of a centered trochoid about the stationary gear.
US11098584B2
A cutter bit for a work tool on a machine includes a leading end, conical-shaped tip portion, a rearward, frustoconical-shaped tip portion extending axially rearwardly from the leading end, conical-shaped tip portion, an annular ledge extending radially outwardly from a trailing edge of the rearward, frustoconical-shaped tip portion, a frustoconical-shaped body portion extending axially rearwardly from an outer circumferential edge of the annular ledge, a cylindrical collar portion extending axially rearwardly from a trailing edge of the frustoconical-shaped body portion, and a trailing end, cylindrical-shaped shank portion extending axially rearwardly from the cylindrical collar portion. The cutter bit may also include a plurality of circumferentially-spaced ribs projecting radially outwardly from an outer peripheral surface of at least one of the leading end, conical-shaped tip portion, the rearward, frustoconical-shaped tip portion, or the frustoconical-shaped body portion.
US11098559B2
The device is designed for borehole reaming during casing—casing reamer shoes mounted in the conductor guide hole of a string or liner. The casing reamer shoe has a sub connected via a sleeve with a spiral mandrel having at least one screw groove, and a mandrel with a drill shoe located at one end thereof, and a pipe with at least one pin at the other end. The mandrel is mounted movably on the spiral mandrel inside a case being rigidly connected to the sub. The pin is arranged in the groove. The cross section of the screw groove has a shape of a trapezoid expanding in the direction of the longitudinal axis of the shoe. The pin has a stepped cylindrical shape with a conical transition. The device increases reliability and lifetime of the casing reamer shoe due to the shape of the grooves and pins.
US11098558B2
An embodiment of an injection arrangement including a principal fluid pathway having a first check valve; a bypass pathway fluidly connected to the principal fluid pathway upstream of the first check valve and connected to the principal fluid pathway downstream of the first check valve. Also a method for injecting a fluid including supplying an injection fluid to an injection arrangement as in any prior embodiment; flowing fluid through the bypass pathway; preventing fluid flow through the bypass pathway; and then flowing fluid through the principal fluid pathway.
US11098554B2
The invention provides an expanding and/or collapsing apparatus and a method of use. The apparatus comprises a plurality of elements assembled together to form a ring structure oriented in a plane around a longitudinal axis. The ring structure is operable to be moved between an expanded condition and a collapsed condition by movement of the plurality of elements. The plurality of elements is operable to be moved between the expanded and collapsed conditions by sliding with respect to one another in the plane of the ring structure, in a direction tangential to a circle concentric with the ring structure. Applications of the invention include oilfield devices, including anti-extrusion rings, plugs, packers, locks, patching tools, connection systems, and variable diameter tools run in a wellbore.
US11098547B2
An apparatus includes a tubular, pressure sensors, expandable pads, a hydraulic chamber, and a computer system. The apparatus can be run in a wellbore. The apparatus is configured to detect whether the tubular is stuck within the wellbore. In response to determining that the tubular is stuck within the wellbore, the apparatus can determine a local of sticking of the tubular in the wellbore and can transmit a signal to the hydraulic chamber to pressurize one or more of the expandable pads, thereby causing the one or more expandable pads to expand and exert a force necessary to free the tubular.
US11098543B2
A hydraulic pressure converter with a force multiplier converts fluid pressure pumped down a work string from the surface into a multiplied linear force. The multiplied linear force can be used to operate downhole tools to perform tasks requiring the application of linear force.
US11098542B2
An anchor including a tubular body having a longitudinal axis, a number of wedges defined in the tubular body, the wedges having edges defined by surfaces at least one of the edges at a point along that edge having a first angle and at the same or another point along that edge having a second angle.
US11098536B2
An apparatus for mounting one or more transducers to a drill pipe. The apparatus comprises a sub-pipe having a bore and a transducer-holding assembly, wherein the transducer-holding assembly is insertable into the bore of the sub-pipe from an axial end of the sub-pipe. The apparatus further comprising a tension collar connected to the bore-defining surface of the sub-pipe and bearing upon the transducer-holder.
US11098535B2
A system and method for transferring tubular elements may include a first structure having a first horizontal platform attached to the first structure on a bottom side and a monorail attached to the first structure on a top side, a second structure having a second horizontal platform attached to the second structure. The first structure and the second structure may be located proximate to each other, while the monorail can extend from the first structure to the second structure. The monorail can have a motion controlled assembly to move a tubular element or assembly of tubular elements.
US11098529B2
A curtain may include a blind shade stretched or contracted in a first direction to adjust transmittance of light, a base coupled to one end portion of the blind shade in the first direction thereof, and a transmittance adjusting device to adjust the transmittance of the light passing through the blind shade by pulling outward or releasing inward an other end portion of the blind shade in the first direction thereof, in the state that spacing from the base in the first direction is fixed.
US11098518B2
A power tailgate assembly for a vehicle includes a tailgate configured to rotatably couple to the vehicle, the tailgate having an inner panel, an outer panel, a bottom panel, and first and second side panels defining an inner cavity. An opening is defined in at least one of the first side panel and the bottom panel, and a motor mount cartridge assembly is disposed in the inner cavity at least partially within the opening to at least partially conceal the motor mount cartridge assembly within the tailgate. When installed, the motor mount cartridge assembly covers the opening without need for a discrete cover for the opening.
US11098515B2
Mechanism for opening of a flap door of an item of furniture, including a part extensible telescopically under the action of a spring, hinged to a lateral side of an item of furniture and acting on a door by way of a thrust fulcrum, wherein a unit is provided, apt to move continuously the thrust fulcrum during the phases of opening and closure of the door.
US11098505B2
A compartment assembly includes a housing, a door movable relative to the housing between an open position and a closed position, an arm extending from the door having a first engagement surface and a second engagement surface, and an actuation system. The actuation system includes a prime mover and a pin connected to the housing and operably coupled to the door. The pin is movable by the prime mover. A biasing mechanism is coupled to the pin to bias the pin into engagement with the arm. When the door is in the closed position, engagement between the first engagement surface and the pin restricts movement of the door. Engagement between the second engagement surface and the pin opposes the biasing force of the biasing mechanism to allow movement of the door.
US11098497B2
A ventilated tent includes a tent cloth, a tent frame, a cloth rope and a buttonhole; the tent cloth is set on the tent frame fixedly connected with the tent frame; the tent cloth includes a top cloth, a front cloth, a back cloth, a left side cloth and a right side cloth; left and right ends of the top cloth cover top of the left side cloth and the right side cloth; the buttonhole is fixed at an edge of the tent cloth, the cloth rope connects the top end of the left side cloth and the top end of the right side cloth through the buttonhole, and a ventilation gap is formed when top end of the left side cloth and right side cloth go away from left end and tight end of the top cloth by tightening and relaxing the cloth rope.
US11098495B2
An urban transformation and construction method is disclosed that creates a tropical style swimming lagoon at vacant and/or abandoned sites. The transformation includes demolishing at least part of the vacant or abandoned site, excavating material from within the site; forming a basin for a large water body having a surface area of at least 3,000 m2, and constructing water containment walls on a first section of the basin to form a waterfront perimeter. The shape of the waterfront perimeter is mainly curved, the basin has a maximum width of 300 meters, and the bottom is covered with a non-permeable material. A sloped access area is constructed in a second section of the basin to form a beach. A barrier is constructed to control access into the area including the beach. At least one recreational facility is constructed including restaurants, bars, kiosks, stores, and/or cafes about the waterfront perimeter.
US11098492B2
A rebar tying tool configured to tie plural rebars using a wire is disclosed herein. The rebar tying tool may include a reel supporting mechanism configured to switch between a first state of detachably supporting a reel on which the wire is wound and a second state of undetachably supporting the reel; a wire feeding mechanism configured to feed the wire from the reel; and an openable cover that at least partially covers at least one of the reel supporting mechanism and the wire feeding mechanism. The reel supporting mechanism may switch from the first state to the second state by a user operation of closing the cover, and/or may switch from the second state to the first state by a user operation of opening the cover.
US11098490B2
A forming system includes a frame and two forming walls. The two forming walls are positioned at a distance from each other to define a first vertical wall course. One forming wall is supported by the frame such that the one forming wall can be translated toward or away from the respective other forming wall. The frame can be raised to raise the two forming walls to be positioned to pour a second vertical course on top of the first vertical course. The translation of the one forming wall allows for the pouring of the first vertical course with horizontally extending rebar that extends through the one forming wall outside of the first vertical wall course, to tie in to a subsequently poured floor slab. The translation permits the vertical raising of the one forming wall, without striking the extending rebar, to pour the second vertical course on the first vertical course. A worker's platform is provided that is supported by the frame and vertically movable by raising the frame. The worker's platform is located below the one forming wall on a side of the one forming wall opposite the respective other forming wall and is rollable or pivotal to also clear the extending rebar during raising of the frame.
US11098487B1
A rebar chair with a gravel particle affixed to each distal tip of the chair for providing a concealing offset between each distal tip and a support surface.
US11098485B2
Methods and processes for depositing a fire resistant barrier on a construction material involve coating exposed webbing of, for instance, an I-joist with a fire-resistant material using a wetting layer and a thickening layer. A time period between depositing the wetting layer and thickening layer is controlled to facilitate complete wetting of the exposed webbing. Filler such as fiberglass may be included in the thickening layer. The wetting and thickening layers may be deposited on the webbing in the same application. The construction material, such as the I-joist, may then be subjected to a curing treatment and additional curing period followed by coating the second side using a similar methodology.
US11098481B2
A ceiling system for use in an interior building environment. In one aspect, the invention may be a ceiling system comprising: a frame comprising a plurality of struts; a plurality of modules, each of the modules comprising a panel and a plurality of hook members coupled to and extending from a top surface of the panel; each of the hook members comprising: an upstanding section; a hook portion at a top end of the upstanding section, the hook portion defining a downwardly-facing open slot; and an attachment flange at a bottom end of the upstanding section that couples the hook member to the top surface of the panel; and the modules mounted to the frame, and wherein for each of the modules, the hook portions of the hook members fit over and rest upon the struts, the struts located in the downwardly-facing open slots of the hook portions.
US11098478B2
A connection between a connector, a fastener and one or more structural members is disclosed. The connector can be formed with a fastening and alignment member. The fastening and alignment member includes a projecting member and a protruding member in close proximity to a predetermined location for the fastener.
US11098472B2
An above grate based inlet filter system for erosion and sediment control comprises a filter mat configured to extend beyond the perimeter of the grate and a securing mechanism, such as magnets, configured to securing the filter mat around the perimeter of the grate. The system may include a filter berm secured in vicinity to the mat, and a rectangular array of magnets coupling the filter mat to the grate. The natural fiber filter mat may effectively be formed of vertically aligned coir fibers or alternatively of reticulated foam. Multiple side edges of the mat are undulating having a pattern of repeating recesses. The mat includes a plurality of high flow holes extending into the mat and which are closed at a bottom surface thereof. The mat includes at least one removable dewatering plug configured to allow for selective mat bypass.
US11098470B2
The invention is related to an article for daily use. It provides a tankless water-saving seated toilet body and its fabrication method. The tankless water-saving seated toilet body comprises a seated toilet main body, which further comprises a bowl, a drainage pipe, a flushing pipe, a flushing device installation space and a body shell. The upper periphery of the sidewall of the bowl has a water loop. The bottom of the bowl has a drainage pipe inlet and a drainage main flushing nozzle. The outside of the bottom of the water loop is attached to the upper periphery of the toilet bowl and the body shell. The flushing device installation space is placed in the back of the main body. The flushing device installation space has a flushing pipet inlet. The flushing device installation space is connected to the water loop and the drainage main flushing nozzle through a flushing pipe. This tankless water-saving seated toilet body features efficient flushing and draining, water-saving, resistance to clogging without the utilization of a traditional water tank, therefore reducing the manufacturing cost. Users can experience a clean and organized toilet space without the material and installation cost of a concealed water tank. The fabrication method is simple yet the finish effect is good.
US11098465B2
Disclosed is a friction ring including a body and a contact member. The body is configured to couple the friction ring to at least one of a faucet assembly or a faucet valve assembly. The contact member is disposed on the body. The contact member is configured to slidably engage with a valve stem of the faucet valve assembly. The contact member is further configured to press against the valve stem to increase a frictional force between the contact member and the valve stem over a full range of movement of the valve stem.
US11098452B2
The invention relates to a method of manufacturing a heat-sealable packaging material, the method comprising the steps of: providing a paperboard substrate comprising a top ply, applying a first dispersion barrier layer on the top ply, wherein the first dispersion barrier layer comprises a latex having a first glass transition temperature, and applying a second dispersion barrier layer on the first barrier layer, wherein the second dispersion barrier layer comprises a latex having a second glass transition temperature, wherein the second glass transition temperature is higher than the first glass transition temperature, wherein the grammage of the second dispersion barrier layer is lower than the grammage of the first dispersion barrier layer, and wherein the second dispersion barrier layer comprises pigments. The invention further relates to a respective heat-sealable packaging material.
US11098446B2
A process for preparing cloth for bookbinding with gloss or matte finish, in cotton or viscose, suitable for digital printing, includes: A) preparing an unfinished cloth for bookbinding by desizing, washing, treating with optical white, sizing and drying; B) pretreating the cloth by applying, on at least one of the two sides, at least one composition closing pores of the cloth to make the surface planar; C) on the side intended for printing, applying by coating a layer of a paste having a viscosity of at least 7500 cps, and drying this layer; the paste being the mixture of at least one aqueous composition containing a 35% (dry) acrylic resin and components that at temperatures of around 200° C. for less than one minute initiate the state of polymerization, and of at least one nonionic thickener; and D) calendering at ambient temperature the cloth obtained from step C).
US11098445B2
A polymeric linear substrate is provided with one or more active agents infused into the linear material to a depth less than the 100 micrometers, optionally where the polymeric linear substrate has a cross sectional dimension that does not exceed 2 centimeters. The polymeric material may include a polyamide, a polyester, polyvinylchloride, or polycarbonate. Also provided are systems for infusing a linear substrate with one or more active agents that includes a dye supply providing a dye; a process tank connected to the dye supply and providing a reservoir of a liquid infusion solution including the dye through the linear substrate infusion system; and a process chamber fluidly connected to the process tank for contacting the liquid infusion solution with a linear substrate effective to infuse the dye into a surface of the linear substrate.
US11098444B2
Performance fabrics and methods of manufacturing them where the fabric is knit or woven cotton and cotton elastane blends to which a moisture-management treatment of wax or wax emulsion is applied to one side of the woven or knitted fabric. The treated fabric is wicking, absorbent and not water repellant or water resistant.
US11098437B1
A method for cleaning a ventilation system of a clothes dryer includes operatively connecting an open proximal end of a hollow duct cleaning tool to a portable airstream appliance adapted for generating a pressurized airflow. A lint screen is first removed from a screen housing opening at the lint exhaust of the clothes dryer. An open distal end of the hollow duct cleaning tool is then placed over the screen housing opening of the clothes dryer, such that the distal end closely engages the clothes dryer to operatively air-seal the screen housing opening. The portable airstream appliance is then activated to direct the pressurized airflow through the duct cleaning tool, lint exhaust and ventilation system of the clothes dryer, thereby evacuating lint and debris collected inside the ductwork of the ventilation system.
US11098430B2
Techniques are described controlling and managing machines to provide laundry services. A request may be received from a mobile device of a user, the request indicating that the mobile device is in proximity to a laundry machine such as a washer or dryer. In some cases, the request is sent by the mobile device based on detecting, at the mobile device, a wireless signal transmitted from the laundry machine. In some cases the request may include a code that identifies the laundry machine, the code being displayed by the machine and/or encoded in a scannable code displayed by the machine. In response to the request, a signal may be sent to activate the laundry machine and enable the user to use the laundry machine for a predetermined period of time (e.g., a cycle). In some cases, the activation signal is sent if the user's payment is successfully processed.
US11098421B2
A knitted fabric panel, composed of a knitted base fabric embroidered as a circular knitted fabric from at least one knitted base fabric thread, wherein at least one zone having a reduced thread volume is provided, the zone being knitted by further threads which by way of the two ends thereof are fixed in the knitted base fabric, at least part of the further threads being thinner than the knitted base fabric thread. The threads instead of the knitted base fabric thread are knitted in a plurality of separate loop forming courses that in the circumferential direction extend by less than 360°.
US11098420B2
A method for producing a textile product (I), (II), comprising at least two synthetic pile threads (P1), (P2) having a different pile height, so that a predetermined design is formed, in which the synthetic pile yarns (P1), (P2) are manufactured by extrusion from the same raw material, according to production processes which only differ from each other by a different setting of one or several process parameters of their respective extrusion processes, so that they have a different shrinking capability, and in which the textile product (I), (II) is subjected to a heat treatment which causes the pile yarns (P1), (P2) to shrink differently. Also such a method for producing synthetic textile yarns (P1), (P2) having a different shrinking capability.
US11098418B2
A process and system for manufacturing twisted and textured yarns are provided. The process includes drawing a first material yarn from a first supply source under predetermined tension; heatingly extending the first material yarn through at least one first heating godet; drawing a second material yarn from a second supply source under predetermined tensions; heatingly extending the second material yarn through at least one second heating godet; feeding at least one of the first material yarn and the second material yarn in an Air Textured Unit (ATY) to obtain a third material yarn; winding the third material yarn exiting from the ATY, wherein the winding is a pirn winding process; twisting the first material yarn, the second material yarn and the third material yarn; and rewinding the twisted third material yarn.
US11098416B2
A Group VB element doped with a β-gallium oxide crystalline material, and a preparation method and application thereof. The series doped with the β—Ga2O3 crystalline material is monoclinic, the space group is C2/m, the resistivity is in the range of 2.0×10−4 to 1×104Ω·cm, and/or the carrier concentration is in the range of 5×1012 to 7×1020/cm3. The preparation method comprises steps of: mixing M2O5 and Ga2O3 with a purity of 4N or more at molar ratio of (0.000000001-0.01):(0.999999999-0.99); an then performing crystal growth. The present invention can prepare a high-conductivity β-Ga2O3 crystalline material with n-type conductivity characteristics by conventional processes, providing a basis for applications thereof to electrically powered electronic devices, optoelectronic devices, photocatalysts or conductive substrates.
US11098412B2
An apparatus and a method for the metallization of an object including placing the object in an electrolyte, placing an anode in contact with the electrolyte, placing a metallization contact of a cathode in contact with the object, applying an electrical tension between the anode and the cathode, wherein the metallization contact is displaced in relation to the object during the metallization of the object to achieve a complete and continuous metallization of the object's surface.
US11098410B2
Provided are a photocatalyst electrode, an artificial photosynthesis module, and an artificial photosynthesis device that have low electrical resistance, even in a case where the area is increased, in a case where a transparent conductive layer is used. The photocatalyst electrode is a photocatalyst electrode that has a substrate, a transparent conductive layer, a photocatalyst layer, and a linear metal electrical conductor, and splits water with light to produce a gas. The substrate, the transparent conductive layer, and the photocatalyst layer are laminated in this order, and the linear metal electrical conductor is in contact with the transparent conductive layer. The artificial photosynthesis module has the oxygen evolution electrode that splits the water with the light to produce oxygen, and a hydrogen evolution electrode that splits the water with the light to produce hydrogen. The oxygen evolution electrode and the hydrogen evolution electrode are disposed in series in a traveling direction of the light. At least one of the oxygen evolution electrode or the hydrogen evolution electrode has the configuration of the above-described photocatalyst electrode. The artificial photosynthesis device has the artificial photosynthesis module, and circulates and utilizes water.
US11098407B2
Method for no-silane electroless metal deposition using high adhesive catalyst and product therefrom
A method for electroless metal deposition and an electroless metal layer included substrate are provided. The method for electroless metal deposition includes steps as follows. a) cleaning a substrate, applying a hydrofluoric acid onto the substrate; and then applying a modifying agent onto the substrate to form a chemical oxide layer on the substrate; b) a catalyst layer is formed on the chemical oxide layer, wherein, the catalyst layer includes a plurality of colloidal nanoparticles, and each of the plurality of colloidal nanoparticles includes a palladium nanoparticle and a polymer which encapsulates the palladium nanoparticle, and c) depositing a metal on the catalyst layer through an electroless metal deposition to form an electroless metal layer.
US11098405B2
A shower head includes a face plate having an outer peripheral portion and a plurality of gas injection holes disposed inside the outer peripheral portion, a movable portion facing the face plate and having a gas introduction passage, and a seal interposed between the outer peripheral portion of the face plate and the movable portion. The movable portion is arranged to move, in the first direction, between a first position in which the movable portion is coupled to the face plate by interposing the seal between the movable portion and the face plate, and the gas introduction passage communicates with the inside of the chamber via the gas injection holes, and a second position in which the movable portion is separated from the face plate, and the gas introduction passage communicates with the inside of the chamber via a gap between the movable portion and the face plate.
US11098403B2
A method for preparing a high entropy alloy thin film coating includes preparing a melt alloy by arc melting raw materials including five or more elements, casting the melt alloy into a mold to form a target, placing the target inside a vacuum chamber of a magnetron sputtering system, and rotatably fixing a substrate inside the vacuum chamber, spaced apart from the target. A high entropy alloy thin film is deposited on the substrate by high vacuum radio frequency sputtering inside the vacuum chamber.
US11098391B2
An aluminum alloy including aluminum, about 2.5 to about 17.4 weight percent by weight magnesium, about 50 to about 3000 ppm calcium, and at least one of chromium up to about 0.2 percent by weight, zirconium up to about 0.2 percent by weight and manganese up to about 0.3 percent by weight.
US11098387B2
The present disclosure relates to a duplex stainless steels strip manufactured from a duplex stainless steel, wherein the duplex stainless steel comprises the following composition, in weight %: C less than or equal to 0.02; Si 0.05 to 0.40; Mn 0.5-3.0; Cr 30.0 to 33.0; Ni 5.0-10.0; Mo 2.0-4.0; N 0.40-0.60; Al 0.010-0.035; B 0.0020-0.0030; Ca 0.0006-0.0040; 5 Cu 0-0.60; V0-0.15; W 0-0.05; Co 0-0.60; Ti 0-0.03; Nb 0-0.03; P less than or equal to 0.03; S less than or equal to 0.02; balance Fe and unavoidable impurities; and wherein the duplex stainless steel consists of 30-70 vol % austenite phase and 70-30 vol % ferrite phase; and wherein the strip has alternating layers of ferrite phase and austenite phase, said alternating layers are essentially parallel with the plane of the object and said alternating 10 layers have an average layer thickness less than or equal to about 10 μm. The present disclosure also relates to a method of producing a strip comprising said duplex stainless steel.
US11098386B2
Steel sheet for cans high in strength and excellent in formability and appearance comprising C: 0.0010 to 0.0035%, Si: 0.050% or less, Mn: 0.10 to 0.50%, P: 0.040% or less, S: 0.040% or less, Al: less than 0.005%, N: 0.0050% or less and a balance of Fe and unavoidable impurities, wherein an average value of a ratio of length of crystal grains in a sheet thickness direction to length in a sheet width direction is 0.70 or more, a yield strength is 500 MPa or more, and, in a range of 0 to 90° of the rolling direction, a minimum value of an r-value is 1.50 or more, an average value of the r-value is 1.70 or more, and a difference of the maximum value and minimum value of the r-value is 0.50 or less.
US11098382B2
The present invention relates to a agave syrup product having a low water content. The agave syrup product retains the physical and palatable properties of untreated agave syrup while having a prolonged shelf-life. It can be advantageously used to sweeten beverages (such as hot beverages) and in the manufacture of pharmaceutical compositions (such as throat lozenges) and/or confectionary.
US11098380B2
The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5′-3′) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5′-3′) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples.
US11098374B2
Genetic characterisation of closely related inbreds is at present only possible by means of whole genome sequencing. This is however a time-consuming process. The invention addresses the need for a method to differentiate between closely related substrains of inbreds. The method involves analysis of at least two tandem repeat loci per chromosome. Said tandem repeat loci are characterised by high mutation rates. The amplified fragments are subsequently used to determine the alleles that are present at each amplified locus within the DNA sample.
US11098372B2
Disclosed is a gene expression panel that can be used to predict prostate cancer (PCa) progression. Some embodiments provide methods for predicting clinical recurrence of PCa. Some embodiments provide a method for treating a patient with prostate cancer, the method comprising: detecting expression levels of a collection of signature genes from a biological sample taken from said patient, wherein said collection of signature genes comprises at least NKX2-1; and correlating expression levels of said collection of signature genes with prostate cancer-related mortality to identify whether the patient is at risk of prostate cancer-related mortality.
US11098370B2
A group of inventions belongs to medicine, specifically to the laboratory diagnostics, and concerns the diagnostics of diseases accompanied by the increased cell death and a kit for its performance. The human blood plasma sample is taken, then the real-time polymerase chain reaction is performed. Coefficient is calculated on basis value of polymerase chain reaction and it is compared with reference value. A disease accompanied by the increased cell death is diagnosed when value of coefficient is less than the reference value. The invention group allows to carry out the minimal invasive diagnostics of diseases accompanied by the increased cell death with high sensitivity, at any stages of disease including the early stages, at which the clinical signs are absent.
US11098366B2
The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons.
US11098360B2
Methods and compositions are described herein for primer extension target enrichment of immune receptor (BCR or TCR) sequences.
US11098358B2
Disclosed herein are methods for single-cell sequencing. In some examples, the methods include enriching a sample comprising a plurality of cells for cells of interest to produce an enriched cell sample; isolating one or more cells of interest in the enriched cell sample; and obtaining sequence information of one or more polynucleotides from each of the one or more isolated cells. Obtaining sequence information may include generating a molecularly indexed polynucleotide library from the one or more isolated cells. Enriching the sample may include focusing cells of interest in the sample using acoustic focusing.
US11098357B2
The present invention provides methods, compositions and kits for detecting duplicate sequencing reads. In some embodiments, the duplicate sequencing reads are removed.
US11098353B2
Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
This invention provides a process for sequencing single-stranded DNA employing modified nucleotides.
US11098351B2
Methods and devices for forming droplets are provided. In certain embodiments, the methods and devices form droplets having different diameters. In particular embodiments, the device includes a fluid supply channel, a collection chamber, and one or more nozzles disposed between the fluid supply channel and the collection chamber. Each nozzle may include an inlet portion with a channel height, a first step with a first step height and a first tread length, and a second step with a second step height and a second tread length. In certain embodiments, the first step height is greater than the channel height, and the second step height is greater than the first step height.
US11098339B2
A method for testing enzyme based electrochemical sensors wherein an electrochemical sensor is provided. A measurement setup is provided, which is operatively coupled to the electrochemical sensor, providing an output signal Z, e.g. a measured signal current, of the electrochemical sensor; and the electrochemical sensor is suitably contacted with a test solution comprising a certain concentration of the primary analyte. The electrochemical sensor is subjected to a certain swept range of temperatures T; an output signal Z is measured for different temperature values T; a derivative Z′ of the output signal Z as a function of temperature T, or inverse temperature 1/T, is determined; and a relative derivate Z′/Z at a temperature T, or inverse temperature 1/T, is determined as the ratio between derivative Z′ and output signal Z.
US11098337B2
The disclosure relates to the field of glyco-engineering, more specifically, to eukaryotic cells wherein both an endoglucosaminidase and a glycoprotein are present. These cells can be used to deglycosylate or partly deglycosylate the (exogenous) glycoprotein, in particular, without the need for adding an extra enzyme. Methods are also provided for the application of these cells in protein production. According to one specific aspect, the eukaryotic cells are glyco-engineered yeast cells in which, additionally, at least one exogenous enzyme needed for complex glycosylation is present, e.g., allowing easier separation of differentially glycosylated glycoproteins.
US11098334B2
Compositions are disclosed herein comprising a graft copolymer that comprises: (i) a backbone comprising dextran that has been modified with about 1%-25% alpha-1,2 branches, and (ii) one or more alpha-1,3-glucan side chains comprising at least about 50% alpha-1,3 glycosidic linkages. Further disclosed are reactions for producing such graft copolymers, as well as their use in derivatives, films and various other applications.
US11098324B2
The present invention relates to novel adenovirus strains with a high immunogenicity and no pre-existing immunity in the general human population. The lack of pre-existing immunity is due to novel hypervariable regions in the adenoviral capsid protein hexon. The novel adenovirus strains also have an improved capacity for reproduction. The present invention provides nucleotide and amino acid sequences of these novel adenovirus strains, as well as recombinant viruses, virus-like particles and vectors based on these strains. Further provided are pharmaceutical compositions and medical uses in the therapy or prophylaxis of a disease, and methods for producing an adenovirus or virus-like particles utilizing the novel sequences, recombinant viruses, virus-like particles and vectors.
US11098321B2
The invention provides recombinant DNA molecules that are unique to the maize MON 87419 event and transgenic maize plants, plant parts, seeds, cells, and agricultural products containing the MON 87419 event as well as methods of using and detecting the maize MON 87419 event. Transgenic maize plants containing the MON 87419 event exhibit tolerance to dicamba and glufosinate herbicides.
US11098315B2
The present invention relates to the production of steviol glycoside rebaudiosides D4, WB1 and WB2 and the production of rebaudioside M from Reb D4.
US11098310B2
Recombinant expression vectors are disclosed that include a control sequence for recombinant expression of proteins of interest; the control sequence combines a mCMV enhancer sequence with a rat EF-1alpha intron sequence. Some of the vectors are useful for tetracycline-inducible expression. Some of the vectors contain a 5′ PiggyBac ITR and a 3′ PiggyBac ITR to promote genomic integration into a host cell chromosome. A method of selecting a stable production cell line for manufacturing a protein of interest is also disclosed. Also disclosed are mammalian host cells comprising the inventive recombinant expression vectors and a method of producing a protein of interest, in vitro, involving the mammalian host cell.
US11098308B2
Self-delivering PTEN RNA and methods of reducing PTEN expression are provided herein. Also provided are methods of treating spinal cord injury (SCI) and other neurotrauma with PTEN sdRNA.
US11098305B2
Methods, compositions, and kits for high throughput DNA assembly reactions in vitro. Modular CRISPR DNA constructs comprising modular insert DNA parts flanked by cloning tag segments comprising pre-validated CRISPR protospacer/protospacer adjacent motif sequence combinations.
US11098303B2
The present invention generally relates to systems and methods for imaging or determining nucleic acids, for instance, within cells. In some embodiments, the transcriptome of a cell may be determined. Certain embodiments are directed to determining nucleic acids, such as mRNA, within cells at relatively high resolutions. In some embodiments, a plurality of nucleic acid probes may be applied to a sample, and their binding within the sample determined, e.g., using fluorescence, to determine locations of the nucleic acid probes within the sample. In some embodiments, codewords may be based on the binding of the plurality of nucleic acid probes, and in some cases, the codewords may define an error-correcting code to reduce or prevent misidentification of the nucleic acids. In certain cases, a relatively large number of different targets may be identified using a relatively small number of labels, e.g., by using various combinatorial approaches.
US11098300B2
The present invention relates to a method for the preparation of nanoscale nucleic acid-encircled lipid bilayers, the nanoscale nucleic acid-encircled lipid bilayers and their use.
US11098299B2
A mutant nitrile hydratase that is derived from Pseudonocardia thermophila and has an α subunit and a β subunit, wherein a specific amino acid residue has been substituted for the amino acid residue in at least one position selected from the group consisting of the 40th and 43rd residues from the N terminal of the α subunit, and the 205th, 206th, and 215th residues from the N terminal of the β subunit.
US11098291B2
The present disclosure provides engineered transaminase polypeptides for the production of amines, polynucleotides encoding the engineered transaminases, host cells capable of expressing the engineered transaminases, and methods of using the engineered transaminases to prepare compounds useful in the production of active pharmaceutical agents.
US11098283B2
Provided is an isolated or purified T cell comprising an antigen-specific receptor, wherein the antigen-specific receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR), wherein the T cell has been modified to express a transcription factor at a level that is higher than the level of the transcription factor expressed by a T cell that has not been modified to express the transcription factor, wherein the transcription factor is V-Myb Avian Myeloblastosis Viral Oncogene Homolog (c-Myb), a functional variant of c-Myb, or a functional fragment of c-Myb. Related populations of cells, pharmaceutical compositions, methods of treating a disease, and methods of inhibiting the differentiation of T cells are also provided.
US11098277B2
A culture apparatus including: a heat-insulated casing including an inner case surrounding a culture space, and an outer case, the heat-insulated casing having an opening; a box-shaped heat-insulated door to open and close the opening; and, one or more heaters provided to one or more inner surfaces of the inner case and an inner surface of an inner wall surface of the heat-insulated door, the inner wall surface facing the culture space when the door is closed; the heaters including one or more first heaters turned on when the interior of the culture space is at a first temperature to incubate a culture in the culture space and when the interior of the culture space is controlled at a second temperature to make the interior of the culture space, and second heaters to be energized when the interior of the culture space is controlled at the second temperature to sterilize the interior of the culture space.
US11098276B2
The present invention relates to a photobioreactor 1 for cultivating phototrophic microorganisms, comprising a reactor element 2, which has a tube 3, a maintenance device 4, and a drive system 5, which can move the maintenance device 4 in the tube 3. The photobioreactor is designed such that liquid culture medium 6 containing the microorganisms flows through at least some of the tube 3 when the photobioreactor 1 is in the operating state. The invention is characterised in that the photobioreactor 1 is designed such that the maintenance device 4 can be used in the tube 3 when the photobioreactor 1 is in operating state and can be moved in the tube 3 at least counter to the flow of the culture medium 6 by the drive system 5. The invention also provides a method for cultivating phototrophic microorganisms in a photobioreactor having a movable maintenance device, a movable maintenance device for maintaining the inner surface of a tube of a photobioreactor for cultivating phototrophic microorganisms, and the use thereof during operation of the photobioreactor.
US11098274B2
Provided are a method for detecting a free rare tumor cell in a human biological fluid sample and assay kit. Specifically, the method of the invention determines the existence of an active tumor cell in a biological fluid sample of a cancer patient by detecting and confirming the existence of glucose absorption capability of a karyocyte and expression of a leukocyte marker (CD45).
US11098273B2
The present invention relates to the use of a yeast extract including at least 10 wt % of nucleic acids, preferably at least 15 wt %, and more preferably 30 to 95 wt %, relative to the total weight of said extract, said nucleic acids being formed from fragments of ribonucleic acid (RNA), for clarifying musts and liquids, in particular wines and teas.
US11098272B2
A washing product is provided, including a first powder comprising a camellia-seed powder, and a soybean powder with 55% to 95% by weight of a total weight of the washing product, a second powder such as sodium hydrogen carbonate with 5% to 25% by weight of a total weight of the washing product, and a third powder such as citric acid with 1% to 20% by weight of a total weight of the washing product. The washing product further includes a fourth powder comprising starch, protein, cellulose, and/or sodium carboxymethyl cellulose with 1% to 20% by weight of a total weight of the washing product. The washing product is made from plant-based materials with biodegradability, nontoxicity and low-carbon property.
US11098270B2
A fabric treatment composition having from about 2.5% to about 20% of a cationic polymer, from about 0.1% to about 20% of a perfume, and a surfactant system, the surfactant system having alkyl polyglucoside, and the composition having less than 5% by weight of an anionic surfactant.
US11098269B2
The present invention refers to a composition comprising two or more compounds of the general formula (I), a dry or liquid formulation comprising said composition as well as the use of said composition as surfactant or as anti-greying agent in a laundry process.
US11098266B2
The present invention refers to 3,7-dimethyloct-6-en-1-yl methyl carbonate and its use as fragrance ingredient. The invention further refers to fragrance compositions and fragranced articles including it.
US11098265B2
The present invention relates to a process for treating an oil comprising a chlorophyll derivative. In particular, the present disclosure relates to an improved process for removing impurities, including chlorophyll derivatives and/or trace metals, from an oil using an adsorbent comprising a silica treated with an alkali earth metal oxide, such as magnesium oxide. The process comprises contacting the oil with the adsorbent, wherein the pH of the silica is about 7 or greater, including from about 7 to about 10. The process may further comprise contacting the oil with a polypeptide having decolorase activity or a composition comprising the polypeptide, prior to contact with the adsorbent.
US11098260B2
Technologies for combusting hazardous compounds such as chemical warfare agents and related compounds are disclosed. In embodiments, the technologies include systems and methods for combusting such compounds in an internal combustion engine, such as a spark ignition internal combustion engine, a diesel engine, or the like. The technologies described herein further include components for treating an exhaust gas stream produced by combustion of hazardous compounds. In embodiments such components include a scrubber that utilizes a scrubbing media such as soil to removing acid gases from the exhaust stream.
US11098256B2
A process is provided for improving cold flow properties of distillates, the process comprises the step of contacting a hydrocarbon feedstock with a framework-substituted ultra-stable Y (USY)-type zeolite in which a portion of aluminum atoms constituting a zeolite framework thereof is substituted with zirconium atoms and/or titanium and/or hafnium atoms, thereby producing a dewaxed distillate product.
US11098254B2
A method for processing bitumen froth comprised of bitumen, water and solids to produce a final diluted bitumen product having a reduced water content is provided whereby demulsifier is added to the bitumen froth after a first separation stage and prior to a second separation stage to produce the final diluted bitumen product having reduced water content.
US11098250B2
Disclosed are a liquid crystal composition, a liquid crystal display element, and a liquid crystal display, said liquid crystal composition comprising one or more compounds represented by formula I, one or more compounds represented by formula II, one or more compounds represented by formula III and one or more compounds represented by formula IV, The liquid crystal composition of the present invention has a good stability to light and heat and a lower viscosity, and can attain a wider refractive index and a high clearing point (a wide service temperature range), and in particular, the liquid crystal composition has a high light transmittance, thus allowing a display device to have a high brightness or an energy saving effect.
US11098243B2
A process of manufacturing a free-flowing solid encapsulated drag reducing additive comprises: forming a solid drag reducing additive from one or more C5-20 olefin monomers; dispersing the solid drag reducing additive in a liquid medium to form a dispersion, the liquid medium comprising an encapsulant and a non-solvent; grinding the solid drag reducing additive in the liquid medium under non-cryogenic grinding conditions to form an encapsulated drag reducing additive in a particulate form; and removing the non-solvent by a drying technique including spray drying, flash drying, or rotating disc drying to form the free-flowing solid encapsulated drag reducing additive.
US11098242B2
Polymer coated proppants for hydraulic fracturing of oil and gas wells have an outer layer portion that comprises an organofunctional coupling agent, preferably an organofunctional silane coupling agent. The use of an organofunctional silane coupling agent in the outer layer portion of the proppant coating is preferably chosen to expose functionalities that will be reactive towards similar functionalities of adjacent and similarly coated proppants so that, when introduced downhole, these proppants form interparticle bonds at the temperatures and crack closure pressures found downhole in fractured strata. Such enhanced interparticle bonding helps keep the proppant in the fracture and maintains conductivity with reduced flowback. The invention also helps proppants designed for low temperature well to bond more firmly and allows proppants designed for high temperature wells to bond well even at lower downhole temperatures, thereby extending their useful range.
US11098240B2
Compositions and methods for treating a downhole environment are provided. The method includes introducing a treatment solution containing a cyclic orthoester and brine into a wellbore within the downhole environment and hydrolyzing the cyclic orthoester to produce an acid within the downhole environment.
US11098228B2
An adhesive composition, including at least polymer containing silane groups, between 15 and 35 wt.-% of at least one polymeric plasiticzer, between 0.5 and 2.5 wt.-% of at least one monomeric or oligomeric aminofunctional alkoxysilane S1 with a nitrogen content of between 4.5 and 14.5 wt.-%, and between 0.5 and 2.5 wt.-% of at least one oligomeric aminofunctional alkoxysilane S2 with a nitrogen content of between 15 and 20 wt.-%. The adhesive composition is particularly suitable to seal or bond thermoplastic substrates, such as polyolefins or bituminous materials, and shows fast adhesion build-up and low volatile organic carbon (VOC).
US11098227B2
The conductive adhesive includes a thermosetting resin (A) and a conductive filler (B), and has a loss modulus at 200° C. from 5.0×104 Pa to 4.0×105 Pa.
US11098217B2
A coating composition that provides a coating film having better abrasion resistance. The composition includes: a fluororesin; and inorganic particles, the inorganic particles having a new Mohs hardness of 10 or higher and a substantially spherical shape. Also disclosed is a coating film produced from the coating composition and a laminate such as a cooking utensil including a substrate and the coating film.
US11098202B2
Methods and systems for coating metal substrates are provided. The methods and systems include sequential application of low flow and high flow powder coatings followed by a single heating step to provide a cured coating. The methods and systems include a marker that allows coating uniformity to be monitored and assessed during application. The described methods provide coatings with optimal surface smoothness and edge coverage.
US11098200B2
The invention pertains to a process for the production of crystalline carbon structure networks in a reactor 3 which contains a reaction zone 3b and a termination zone 3c, by injecting a thermodynamically stable micro-emulsion c, comprising metal catalyst nanoparticles, into the reaction zone 3b which is at a temperature of above 600° C., preferably above 700° C., more preferably above 900° C., even more preferably above 1000° C., more preferably above 1100° C., preferably up to 3000° C., more preferably up to 2500° C., most preferably up to 2000° C., to produce crystalline carbon structure networks e, transferring these networks e to the termination zone 3c, and quenching or stopping the formation of crystalline carbon structure networks in the termination zone by spraying in water d.
US11098189B2
A resin composition includes an acrylonitrile-butadiene-styrene resin (A), a polyethylene terephthalate resin (B), a condensed phosphoric acid ester-based flame retardant (C), and a thermally expandable graphite (D).
US11098188B2
Disclosed herein is a foam composition comprising an olefin copolymer that comprises ethylene and an α-olefin or propylene and an α-olefin; an unneutralized carboxylated olefin copolymer; a crosslinking agent; and a blowing agent; where the foam composition is substantially free from neutralized carboxylated ethylene copolymer. Disclosed herein too is a method of manufacturing a foam composition comprising blending together an olefin copolymer that comprises ethylene and an α-olefin or propylene and an α-olefin; an unneutralized carboxylated olefin copolymer; a crosslinking agent; and a blowing agent to form the foam composition; where the foam composition is substantially free from neutralized carboxylated ethylene copolymer; heating the foam composition to activate the blowing agent to form a foam; and crosslinking the foam.
US11098184B2
A masterbatch composition made from or containing: 65 to 85 wt % of a propylene homopolymer or copolymer as component (1) containing 0 to 3 wt % of ethylene or one or more C4-C10-α-olefin-derived units; and 15 to 35 wt % of a propylene-ethylene copolymer as component (2) containing 25 to 35 wt % of ethylene-derived units, wherein the masterbatch composition has: 1) a melt flow rate (230° C., load: 21.18 N) of 5 to 30 g/10 minutes; 2) xylene insolubles with an Mw of 10×104 to 30×104 and an Mw/Mn of 6 to 20 as measured by GPC; and 3) xylene solubles with an intrinsic viscosity of 5.5 to 9.0 dl/g.
US11098181B2
The side-reinforcing rubber for run-flat tires of the present invention is a side-reinforcing rubber for run-flat tires, including a vulcanized rubber which is formed of a rubber composition containing a rubber component containing a dienic rubber, a vulcanizing agent, and a carbon black having a dibutyl phthalate oil absorption of 120 mL/100 g or more, and has a specific surface area according to a nitrogen adsorption method of 20 to 80 m2/g, with a ratio of an Sx bond (where x is 3 or more) to all sulfide bonds in the side-reinforcing rubber for run-flat tires being 40% or less. The side-reinforcing rubber for run-flat tires is excellent in durability life.
US11098155B2
The invention pertains to the technical field of urethane based materials, in particular to radiation curable urethane precursors that are cross-linkable in solid form and materials obtainable therefrom. In addition the invention pertains to methods for manufacturing these precursors and materials, and their uses. The invention is advantageous to the fields of i.e. coatings and biomedical applications.
US11098154B2
A process for preparing a phosphorus-functional polyethercarbonate polyol, comprising reacting a polyethercarbonate polyol having unsaturated groups with a phosphorus-functional compound of formula (Ia): wherein X=O or S; and wherein R1 and R2 are selected from the group consisting of C1-C22 alkyl, C1-C22 alkoxy, C1-C22 alkylsulfanyl, C6-C70 aryl, C6-C70 aryloxy, C6-C70 arylsulfanyl, C7-C70 aralkyl, C7-C70 aralkyloxy, C7-C70 aralkylsulfanyl, C7-C70 alkylaryl, C7-C70 alkylaryloxy, C7-C70 alkylarylsulfanyl, or wherein R1 and R2 are bridged to one another directly and/or via heteroatoms and are selected from the group consisting of C1-C22 alkylene, oxygen, sulfur, and NR5, wherein R5 is hydrogen, C1-C22 alkyl, C1-C22 acyl, C7-C22 aralkyl, or C6-C70 aryl radical. A process for preparing a phosphorus-functional polyurethane polymer is disclosed. Phosphorus-functional polyethercarbonate polyol, phosphorus-functional polyurethane polymer, flame-retardant adhesion promoter, filler-activator, flame retardant, flame-retardant coating, foam, sealing compound, thermoplastic, thermoset, rubber, and a moulded body are disclosed.
US11098151B2
The present invention relates to a hardenable polymer composition containing at least one acrylate compound, at least one silyl-terminated polymer and at least one photoinitiator, to the use of the polymer composition as or in an adhesive, a sealant, gasket, knifing filler or coating composition, and to an adhesive composition, a sealant composition, a gasket composition, a knifing filler composition or a coating composition comprising the polymer composition.
US11098143B2
A process for the polymerization of olefins in gas phase carried out in a reactor having two interconnected polymerization zones, a first zone (riser) and a second zone (downcomer), wherein growing polymer particles: a) flow through the riser under fast fluidization conditions established by feeding a mixture of gas and liquid; b) leave the riser and enter the downcomer, through which the growing polymer particles flow downward in a densified form; and c) leave the downcomer and are reintroduced into the riser, thereby establishing a circulation of polymer between the riser and the downcomer; the reactor is operated at a temperature between 0° C. and 5° C. above the dew point of the riser gas at the operating pressure, and in the riser, besides the growing polymer particles and gas flow, an amount of liquid is present.
US11098140B2
A system and method for producing 1-butene and ultra-high-molecular-weight polyethylene (UHMWPE), including feeding a catalyst, an antifouling co-catalyst, and ethylene to a reactor, and dimerizing ethylene into 1-butene and polymerizing a relatively small portion of the ethylene into UHMWPE. A product slurry including 1-butene and UHMWPE is discharged from reactor and UHMWPE is removed from the product slurry as a coproduct of the product 1-butene. The coproduct UHMWPE may be a byproduct that is a relatively small amount of the product slurry. The quantity of UHMWPE produced may be small in comparison to the quantity of 1-butene produced.
US11098136B2
A method for producing a modified polymer latex includes: adding a carboxyl group-containing compound, an anionic surfactant having a weight-average molecular weight of less than 500, and an anionic surfactant having a weight-average molecular weight of 500 or more to a polyisoprene latex; and reacting the polyisoprene with the carboxyl group-containing compound in a presence of the anionic surfactant having a weight-average molecular weight of less than 500 and the anionic surfactant having a weight-average molecular weight of 500 or more.
US11098135B2
The invention relates to a novel methylated cyclodextrin and to a novel method used for the production thereof. The invention also relates to the use of said methylated cyclodextrin for the solubilisation of lipophilic compounds, or carriers of at least one lipophilic group. The invention further relates to a composition comprising said methylated cyclodextrin, particularly a pharmaceutical composition.
US11098124B2
Disclosed is CD31shed for use as a molecular imaging target in the molecular imaging of an inflammatory condition. Administering the radiolabeled peptide P8RI as CD31shed ligand in different rat models of inflammation indeed showed that CD31shed is present on activated cells in a quantity allowing a detectable signal, whereas the noise signal corresponding to CD31shed present on activated circulating cells and on other organs or cells not involved in inflammation was little. Also disclosed is a labeled CD31shed ligand and the use thereof as a molecular imaging agent in the molecular imaging of an inflammatory condition. The molecular imaging of inflammatory sites particularly allows determining whether a subject suffers from or is at risk of having an inflammatory condition or is at risk of recurrence of an inflammatory condition after an anti-inflammatory treatment.
US11098122B2
Disclosed are isolated monoclonal antibodies, comprising a CD152-binding domain, wherein the antibodies bind specifically to human CD152. Methods of making and using the antibodies to treat diseases including cancers and autoimmune diseases are also provided.
US11098120B2
Methods of modulating the immune systems of patients suffering from cancers that do not bear, or do not uniformly bear, surface CD3 are provided. The methods involve administering an anti-CD3 immunotoxin (e.g. A-dmDT390-bisFv(UCHT1)), to the patient so as to cause the patient's immune system to recognize and destroy non-CD3 cancer cells.
US11098117B2
The instant disclosure provides antibodies that specifically bind to CD137 (e.g., human CD137) and increases CD137 function. Also provided are pharmaceutical compositions comprising these antibodies, nucleic acids encoding these antibodies, expression vectors and host cells for making these antibodies, and methods of treating a subject using these antibodies.
US11098109B2
Disclosed herein are a monoclonal antibody that specifically binds to human CD133 and single-chain variable fragments thereof. Also disclosed herein is a hybridoma that produces the monoclonal antibody that specifically binds to human CD133.
US11098107B2
The present disclosure relates to antibodies and antibody conjugates having one or more site-specific mutations in the CH2 domain of the heavy chain. The antibody variants disclosed herein can have improved characteristics (e.g., thermal stability, antibody yields, antibody titers, cell-killing) relative to a parent or wild type antibody, including aglycosylated parent or wild type antibodies. Pharmaceutical compositions, diagnostic compositions and kits comprising the same, as well as methods of using these compositions and kits for therapeutic and diagnostic purposes, are also described.
US11098106B2
The invention provides unique therapeutic and diagnostic antibodies, as well as their fragments, portions, derivatives, and variants thereof, that bind regions of the tau protein that contribute to the initiation and propagation of pathological tau-tau interactions, as well as methods of making them. The invention also relates to methods of using those antibodies for diagnostics, prevention, and treatment of Alzheimer's disease and related tauopathies. The present invention also provides a method for a prophylactic and therapeutic treatment of Alzheimer's disease and other neurodegenerative tauopathies. This method entails the injection of antibodies and/or peptide vaccines that elicits an immune response directed to pathological tau proteins and tau deposits in the brains of patients. Suitable vaccines represent a tau peptide carrying one or more of the tau therapeutic epitopes provided herein.
US11098105B2
Provided herein are heteromultimer constructs with reduced or silenced effector function. In an embodiment is provided a heteromultimer construct comprising an IgG Fc construct having a first and a second Fc polypeptide, each Fc polypeptide comprising a modified lower hinge region wherein: the modified lower hinge region of said first Fc polypeptide comprises at least one amino acid modification, the modified lower hinge region of said second Fc polypeptide comprises at least one amino acid modification which is different from at least one amino acid modification of said first Fc polypeptide, and the IgG Fc construct displays reduced binding to all Fcγ receptors and to C1q protein as compared to a corresponding parent IgG Fc construct. Also provided are methods of producing such heteromultimer constructs, and methods of reducing ADCC for an antibody construct by reducing effector function.
US11098100B2
This disclosure describes engineered compounds that engage NK cells and methods of using the compounds. Generally, the compound includes an NK engaging domain, a targeting domain that selectively binds to a target cell, and an NK activating domain operably linking the NK engaging domain and the targeting domain.
US11098095B1
Methods of inhibiting MMP-9 are provided. The methods of inhibiting MMP-9 include methods of inhibiting IL-6/TNF-α crosstalk mediated expression and/or secretion of MMP-9. The inhibition of the IL-6/TNF-α crosstalk pathway may be accomplished using an IL-6 signaling inhibitor, such as AG490 or SC-144. The methods may also include the treatment of dieses through the inhibition of IL-6/TNF-α crosstalk mediated production of MMP-9. In an embodiment the methods may include preventing the progression of cancer or cardiovascular disease through the inhibition of the IL-6/TNF-α crosstalk pathway.
US11098086B2
Compositions and methods of use are provided to boost a primed immune response to HIV. More specifically, the present invention relates to vaccine compositions comprising an HIV-protein boost or an MVA-expressed Env protein and methods of use. Exemplary HIV proteins for protein boosts include proteins such as gp120 proteins B.63521Δ11mutC and full-length single chain (FLSC), which has been modified to stabilize a CD4-induced Env structure. Exemplary MVAs expressing secreted Methods of administration and dosing regimens are also provided.
US11098080B2
The present invention provides compounds of formula (I) wherein X1 to X8 and R1 to R8 are as described herein, as well as pharmaceutically acceptable salts thereof. Further the present invention is concerned with the manufacture of the compounds of formula (I), pharmaceutical compositions comprising them and their use as medicaments for the treatment of diseases and infections caused by Acinetobacter baumannii.
US11098077B2
The present invention provides highly active locked nucleic acid cyclic-dinucleotide (LNA-CDN) immune stimulators that activate DCs via the cytoplasmic receptor known as STING (Stimulator of Interferon Genes). In particular, the LNA-CDNs of the present invention are provided in the form of a composition comprising one or more cyclic dinucleotides that induce human STING-dependent type I interferon production, wherein the cyclic dinucleotides present in the composition have at least one 2′, 4′ locked nucleic acids within the cyclic dinucleotide.
US11098070B2
Organotin clusters are described with the formula R3Sn3(O2CR′)5-x(OH)2+x(μ3-O) with 0≤x<2; R=branched or cycloalkyl with 1 to 31 carbon atoms; R′═H or alkyl with 1 to 20 carbon atoms. Three carboxylato ligands are bridging, and two OH ligands are bridging. The remaining two carboxylato ligands are in non-bridging configurations, and the non-bridging carboxylato ligands are exchangeable in solution. Solutions of these clusters are suitable for forming radiation sensitive coatings that can be used to pattern nanometer scale structures. The radiation sensitive coatings are particularly suitable for EUV patterning.
US11098068B2
A method of producing a halosiloxane, the method comprising: i) combining water, a halosilane, and a first solvent to form a reaction mixture, ii) partially hydrolyzing and condensing the halosilane to form a reaction product mixture comprising the halosiloxane, the solvent, unreacted halosilane, and hydrogen halide, iii) adding a second solvent, where the second solvent has a boiling point the boiling point of the halosiloxane, to the reaction mixture in i) or to the reaction product mixture in ii), and iv) recovering the halosiloxane from the reaction product mixture.
US11098062B2
The present invention relates to novel novel monocyclic and bicyclic ring system substituted carbanucleoside analogues of Formula (I) wherein the variables have the meaning defined in the claims. The compounds according to the present invention are useful as PRMT5 inhibitors. The invention further relates to pharmaceutical compositions comprising said compounds as an active ingredient as well as the use of said compounds as a medicament.
US11098056B2
Described herein is a compound of Formula (I), and pharmaceutically acceptable salts thereof. Also described herein are compositions and the use of such compositions in methods of treating a variety of diseases and conditions, in particular Krabbe's Disease (KD) and Metachromatic leukodystrophy (MLD).
US11098055B2
The present invention provides ester compounds useful as inhibitors of Acetyl CoA Carboxylase (ACC), compositions thereof, and methods of using the same.
US11098049B2
The disclosure discloses a synthetic method for benzimidazo[1,2-c]quinazolin-6-ones and belongs to the field of organic synthesis. In the disclosure, an α-ketoamide compound shown as Formula I and an o-phenylenediamine compound shown as Formula II are used as substrates and undergo a reaction under the action of a catalyst and a base to obtain benzimidazo[1,2-c]quinazolin-6-ones shown as Formula III. In the disclosure, benzimidazo[1,2-c]quinazolin-6-ones are prepared based on a novel and efficient action mechanism, and the disclosure has the advantages that the raw materials are cheap, the catalyst is cheap and easy to obtain, the reaction is efficient and environmentally friendly, the substrate range is wide, the yield is high, and the operation is simple.
US11098046B2
The present disclosure describes novel TRK kinase inhibitors and methods for preparing them. The pharmaceutical compositions comprising such TRK kinase inhibitors and methods of using them for treating cancer, infectious diseases, and other disorders are also described.
US11098026B2
Fused bicyclic compounds are inhibitors of GPR91. The compounds, their stereoisomers, tautomers, prodrugs, polymorphs, solvates, pharmaceutically acceptable salts, and pharmaceutical compositions containing them are useful in the treatment, prevention, prophylaxis, management, or adjunct treatment of all medical conditions related to inhibition of GPR91.
US11098023B2
A solvent-free method to extract THCA from cannabis, said method comprising: providing a source of THCA-containing cannabis plant; providing a source of natural oil; combining said source of THCA-containing cannabis and said source of natural oil into a blend; milling said blend; optionally, heating the blend during the milling; and extracting a THCA-containing liquid generated during the milling.
US11098019B2
Fluorene derivatives that are connected in one or more of the 1-, 1′-, 4-, or 4′-positions in any combination to a carbon atom of a diaryl substituted triazinyl or pyrimidinyl derivative. The fluorene derivatives are not spirobifluorene derivatives. The compounds are suitable for use in electronic devices, in particular organic electroluminescent devices, comprising these compounds. In some embodiments, the compounds are used as matrix materials for phosphorescent or fluorescent emitters as well as a hole-blocking or an electron-transport layer.
US11098018B2
A compound of the general formula (I). The compounds of formula I are useful for treatment of a cardiac disease, disorder or condition in a mammal.
US11098014B2
The present invention provides aryl isonitrile compounds that have antibacterial properties. More specifically, the aryl isonitrile compounds of the present invention are potent inhibitors of drug resistant strains of Staphylococcus aureus.
US11098008B2
Provided herein are compounds of the formulas: wherein: n, X2, R3, R3′, R4, R4′, R5, R5′, R6, and R6′ are as defined herein. Pharmaceutical compositions of the compounds are also provided. In some aspects, these compounds may be used for the treatment of diseases, including diabetic peripheral neuropathy or cancer.
US11097989B2
A combined fertilizer and humics soluble granule is provided that includes at least soluble fertilizer particles admixed with a plurality of humic particles without a binder. A combined fertilizer and humics soluble granule is also provided that includes at least one soluble fertilizer-rich domain fused to at least one humic-rich domain. A process of forming a combined fertilizer and humics soluble granule is provided that includes forming a mixture of particles of soluble fertilizer and humics, the particles of urea each having a urea particle surface. The soluble fertilizer particle surface is tackified in contact with the particles of humics to create adherence between the soluble fertilizer particle surface and the particle of humics to form a granule without resort to a binder.
US11097988B2
A strength enhancing admixture for cementitious and/or pozzolanic compositions including, based on the total dry weight of the admixture, calcium silicate hydrate in an amount of from about 0.5 to about 94 weight percent, and: i) at least one alkanolamine in an amount of from about 0.5 to about 55 weight percent; ii) at least one inorganic accelerator in an amount of from about 0.5 to about 85 weight percent; and iii) at least one carbohydrate in an amount of from about 0.5 to about 50 weight percent; wherein the calcium silicate hydrate includes a product of a reaction of a water-soluble calcium compound with a water-soluble silicate compound in presence of a water-soluble dispersant; and wherein the at least one inorganic accelerator includes any inorganic accelerator(s) other than calcium silicate hydrate.
US11097984B2
A composite ceramic with improved mechanical performance and a preparation method therefor. The composite ceramic comprises fluorescent powder, a ceramic matrix, and an optional sintering aid. The weight ratio of the fluorescent powder to the ceramic matrix is from 3:17 to 9:1, and the relative density of the composite ceramic is greater than 95%. The preparation method comprises using core shell-structured coated fluorescent powder as a raw material, and ball-milling and sintering the raw material to obtain the composite ceramic.
US11097978B2
A method for manufacturing a bent substrate, having a masking step of forming a masking member (M) on a bent substrate (10) and forming a predetermined pattern, and a printing step of forming a print layer (P) on a surface to be printed of the bent substrate (10) including the masking member (M). It is thereby possible to perform printing on a bent substrate having a curved surface part in a productive manner and at a high printing accuracy.
US11097970B2
Provided herein are lagoon systems and methods for industrial wastewater remediation.
US11097968B2
A method for inhibiting the formation, deposition and adherence of scale to metallic and other surfaces in the equipment, vessels and/or piping of facilities for the handling of oil and gas produced fluid is disclosed. An effective scale inhibiting amount of alginate is added to a produced fluid containing a scale-forming divalent cation. The alginate effectively cross-links with a scale-forming divalent cation, e.g., calcium, forming an alginate gel for subsequent separation and removal from the produced fluid.
US11097965B2
A multiple-bore solute cartridge carrier 10) for use in a sterile fluid delivery system. The carrier includes a rotary housing (12) adapted for connection to the sterile fluid delivery system. The rotary housing has one or more bores (30) configured to receive a solute cartridge. The rotary housing, when connected to the sterile fluid delivery system, is selectively rotatable to facilitate creation of a desired sterile solution when sterile water from the fluid delivery system is flowed through the solute cartridge.
US11097956B2
A surface-modified iron-based oxide magnetic particle powder has good solid-liquid separation property in the production process, has good dispersibility in a coating material for forming a coating-type magnetic recording medium, has good orientation property, and has a small elution amount of a water-soluble alkali metal, and to provide a method for producing the surface-modified iron-based oxide magnetic particle powder. The surface-modified iron-based oxide magnetic particle powder can be obtained by neutralizing a solution containing dissolved therein a trivalent iron ion and an ion of the metal, by which the part of Fe sites is to be substituted, with an alkali aqueous solution, so as to provide a precursor, coating a silicon oxide on the precursor, heating the precursor to provide e-type iron-based oxide magnetic powder, and adhering a hydroxide or a hydrous oxide of one kind or two kinds of Al and Y thereto.
US11097951B2
Provided herein are carbon-based oxide (CBO) materials and reduced carbon-based oxide (rCBO) materials, fabrication processes, and devices with improved performance and a high throughput. In some embodiments, the present disclosure provides materials and methods for synthesizing CBO and rCBO materials. Such methods avoid the shortcomings of current synthesizing methods to facilitate facile, high-throughput production of CBO and rCBO materials.
US11097948B2
To provide an aluminum nitride particle having a hexagonal columnar barrel part and bowl-like projection parts at both ends of the columnar part, wherein the long diameter (D) of the barrel part is 10 to 250 μm, the ratio (L1/D) of the distance (L1) between the apexes of the two projection pars to the long diameter (D) of the barrel part is 0.7 to 1.3, and the percentage of the length or thickness (L2) of the barrel part to the distance (L1) between the apexes of the two projection parts is 10 to 60%. The aluminum nitride particle can provide high heat conductivity and excellent electric insulation to a resin when it is filled into the resin.
US11097945B1
A method for making an aqueous hypochlorous acid (HClO) solution includes electrolyzing a solution of sodium chloride to produce a solution of sodium hypochlorite; and producing the aqueous hypochlorous acid solution by adjusting a pH of the solution of sodium hypochlorite to a value within a range of 3 to 8 by adding a selected weak acid to the solution of sodium hypochlorite to produce a buffer including the selected weak acid and a salt of the selected weak acid.
US11097933B2
A swivel base is provided on a trolley so as to be able to swivel around a vertical axis, and a fork can be slid in a horizontal direction between an advanced position and a retracted position by a sliding mechanism capable of moving up and down along a pillar erected on the swivel base. Thus, it is possible to realize a configuration in which an empty-box skid is loaded in one direction and unloaded in another direction by means of the swiveling swivel base, without employing a configuration in which a plurality of members is supported so as to be able to swivel around different vertical axes. A movable range of the sliding mechanism (a movable range of the fork) in a vertical direction is therefore not significantly limited, and a transfer position of the empty-box skid in the vertical direction can be set to a lower position.
US11097932B1
A grapple truck with side loader having a generally J-shaped scoop in a lateral recess of the truck bed sidewall. Sometimes loader is longitudinally truncated forming an adjacent debris-bin vertical transport. The power lift system is either a direct lift-pivot with cylinder lifters or a channel-guided lifter with candy-cane shaped channels. Side loader rises from a low, manual loading position to an upper inverted dump position whereat loader displaces debris into truck bed box. Scoop's loader edge is planarly coextensive or inboard truck sidewall, and at or beneath the truck wheel axis line. A chassis mounted, articulated boom, with longitudinally extending arm segments, terminates in a grapple jaw. The articulated boom and grapple jaw has a longitudinally foreshortened stored position in and above the truck bed. In multiple operative positions, the arm extends beyond the truck bed and rear bed wall and laterally over and beyond truck sidewalls.
US11097931B2
A material handling vehicle comprises an upper loading surface for loading of objects thereon, a control unit, a power source, a drive motor, at least one vehicle drive wheel powered by the drive motor, at least one vehicle support wheel, a first chassis and a second chassis, each of which comprises at least one wheel of the vehicle. The first and second chassis are pivotally coupled to each other by means of at least one coupling means, wherein said coupling means is arranged intermediate the first chassis and the second chassis at a position where the first chassis is arranged above the second chassis, wherein the coupling means extend at least partly vertically between the first and second chassis at said position. Further there are two drive wheels that are independently controllable. Further, a material handling system comprising at least one such material handling vehicle.
US11097925B2
A device for cage jamming buffer of large-tonnage hoisting system of ultra-deep shaft is provided. End cage jamming buffer mechanisms are added at both ends of an automatic wire rope tension balancing mechanism, wherein the end cage jamming buffer mechanisms include an end buffer module and an end fixing module, and the end buffer module and the end fixing module are respectively mounted on shafts of the automatic wire rope tension balancing mechanisms at two ends. The end buffer module mainly consists of a buffer bearing pedestal, a limit block, a buffer block, and a stop block sequentially mounted on the shaft of the automatic wire rope tension balancing mechanism at one end. The end fixing module mainly consists of a fixing bearing pedestal and a fixing block mounted on the shaft, wherein the fixing bearing pedestal is connected to a transmission gear by an adjusting bolt.
US11097905B2
A transport device including a support body having an upper part on which a plurality of articles can be arranged; an unloading device which pushes the plurality of articles arranged on the support body; a belt conveyor which transports the articles pushed out from the support body; a slider which moves the articles arranged on the support body and also moves the articles arranged on the conveyor belt, thereby separating the articles; and a lift which is disposed between the support body and the conveyor belt and which rises to a higher position than the upper surfaces of both the support body and the conveyor belt when the articles arranged on the support body and the articles arranged on the conveyor belt have been separated.
US11097894B2
A container having a receptacle with an open upper end for receiving material, and an edge cap that is movably supported relative to the receptacle. The edge cap has a sidewall that is spaced outwardly from a camming surface of the receptacle, and a lid support member that projects inwardly from the sidewall. A lid panel is pivotably mounted to the lid support member for pivoting between a closed position and an open position. An actuation portion of the lid panel has a cam surface that is positioned between the camming surface and the sidewall. The cam surface is configured to engage with the camming surface to pivot the lid panel towards the open position when the sidewall is moved towards the camming surface.
US11097879B1
A cable tie including a belt, a base, a restricting part, and a controlling part is provided. The belt has a contacting side. The base is connected to a first end of the belt and has a through-hole. The restricting part is connected to the base and is located in the through-hole. The controlling part has a connecting portion, and a protruding portion and a pressing portion away from the connecting portion, and the connecting portion is connected to the base. When the belt passes through the through-hole, the contacting side defines a tying area for accommodating a tied object, and the protruding portion protrudes into the tying area. When the tied object pushes the protruding portion towards outside the tying area, the pressing portion presses the restricting part to restrict a movement of the belt.
US11097875B2
A dual ball valve straw lid assembly for a closed container is provided. The dual ball valve straw lid assembly includes one or more of a lid, a liquid ball, a vent ball, and a tube. The lid includes a top and a bottom, and the bottom is configured to attach to the closed container. Each of the liquid and vent balls are pivotably coupled to the lid top and each configured to rotate between open and closed positions. The vent ball is configured to rotate in response to the liquid ball rotates. The tube extends from the lid bottom to within the closed container, and allows liquid in the closed container to be accessed by suction force applied to the liquid ball in the open position. When open, the vent ball allows air to pass between outside and inside the closed container when in the open position.
US11097874B2
Pouring aid device for pouring a liquid, for example wine, from a container such as a bottle into a recipient such as a glass including a neck part which is configured to fit on an opening of the container, for example on a bottle neck; a pouring tube in fluid connection with a liquid channel of said neck part; an air tube in fluid connection with an air channel of said neck part, arranged to extend into the container for letting air into and out of the container.
US11097868B2
The present invention relates to a laminated liquid food packaging material, comprising a bulk layer of paper or carton or other cellulose-based material and outer layers of thermoplastic polymers on both sides, having a decorative print pattern arranged beneath one of the outer thermoplastic polymer layers. The invention further relates to the method for manufacturing the laminated packaging material and to a packaging container for liquid food packaging, comprising the laminated packaging material.
US11097866B2
The invention relates to the storage and transportation of liquid products, and specifically to a plastic bottle. The challenge which this invention is designed to address is to increase the performance characteristics of a bottle, i.e. to create a lightweight design of bottle which is easy to manufacture and enables said bottle to be securely attached to items of clothing etc. The challenge in question is addressed by the fact that the plastic bottle, comprising a hollow thin-walled body ending with a neck, and a holder which is designed in the form of an open groove, molded in the body, parallel to the central axis of the bottle and extending for more than half the height of the bottle, is characterized by the fact that the projections of the walls of the groove on the plane, which is perpendicular to the transverse axis of the groove, are in the form of zigzag-shaped lines. Furthermore, each zigzag-shaped line may consist of sections of straight lines and/or sections of curved lines.
US11097861B1
There is described a packaging machine for producing sealed packages of a pourable product from a web of packaging material, which may include conveying means for advancing the web of packaging material along a web advancement path at least to a tube forming station at which the web of packaging material is formed into a tube and for advancing the tube along a tube advancement path, an isolation housing having a main chamber and an auxiliary chamber arranged downstream of the main chamber along the tube advancement path, a tube forming and sealing device at least partially arranged within the main chamber and being configured to form and longitudinally seal the tube within the main chamber, a filling device for filling the tube with the pourable product and a pressure control device configured to control a first pressure within the main chamber and a second pressure within the auxiliary chamber such that the first pressure is higher than the second pressure and the first pressure and the second pressure are both higher than the ambient pressure.
US11097856B1
A vibrometric signature for a vehicle, or a set of one or more frequencies where vibration of the vehicle is naturally observed in the presence of excitation, may be generated and used to make one or more determinations regarding the integrity or suitability of the vehicle for one or more missions. When the vehicle is subjected to excitation over a range of frequencies, images of the vehicle are captured, and power levels of vibrations of the vehicle are calculated based on the images. A vibrometric signature is generated based on the power levels of the vibrations, and compared to vibrometric signatures previously generated for the aerial vehicle, or to vibrometric signatures associated with one or more other vehicles, or anomalies experienced by such other vehicles, to determine whether the vehicle may be cleared for the performance of one or more missions, or whether maintenance or inspections are required.
US11097852B2
In an example, an acoustically powered sensor unit for obtaining sensor data indicative of flight characteristics of an aircraft is described. The acoustically powered sensor unit includes a housing having a first portion comprising a diaphragm and a second portion coupled to an exterior of an aircraft and. The diaphragm is configured to receive acoustic energy from an engine of the aircraft. The acoustically powered sensor unit further includes a voice coil actuator disposed within the housing and coupled to the diaphragm. The voice coil actuator is configured to receive kinetic energy by way of a vibration of the diaphragm and responsively generate an electrical power signal. The acoustically powered sensor unit further includes one or more sensors disposed within the housing and powered using energy from the electrical power signal. The one or more sensors are configured to obtain the sensor data indicative of flight characteristics of the aircraft.
US11097841B2
An unmanned autonomous vehicle assessment and reporting system may implement a boustrophedonic flight pattern for capturing images of a structure to develop a three-dimensional model of the same. A crisscross boustrophedonic flight pattern may include two or more boustrophedonic flight patterns that are at angles relative to one another.
US11097839B2
A first power source, a second power source, and a power controller are provided, where a vehicle that includes the first power source, the second power source, and the power controller is capable of flying in a transitional mode between a hovering mode and a forward flight mode. The power controller selects one or more of the first power source and the second power source to power a rotor included in the vehicle during the transitional mode.
US11097831B2
A nosecone assembly having an axially extending centerline is provided. The assembly includes a nosecone body and at least one access panel. The nosecone body has at least one wall that defines an interior cavity. The wall has an interior surface contiguous with the interior cavity, and at least one window aperture extending through the wall. The access panel has first and second face surfaces. The access panel is attached to the wall interior surface within an attachment region that includes first and second attachment region portions partially contiguous with one another. The first and second attachment region portions define an interior unattached region, and the interior unattached region is aligned with the window aperture.
US11097825B2
A system for maneuvering a boat including a hull and an outboard motor includes a left tilt shaft, a right tilt shaft, a steering shaft support, and a hydraulic cylinder. At least a portion of the hydraulic cylinder is between the left tilt shaft and the right tilt shaft. The hydraulic cylinder exerts a steering force on the outboard motor to rotate the outboard motor about a steering shaft. A hydraulic pump supplies hydraulic fluid to the hydraulic cylinder. One of the left tilt shaft and the right tilt shaft includes a first hole. A portion of the stroke range of the hydraulic cylinder is located within the first hole.
US11097819B1
An inflatable hand-held snorkeling float supports a see-through underwater viewing module having a top glass and a bottom glass joined by a collapsible sidewall. A pneumatic chamber surrounds the viewing module. The chamber has a top deck and a bottom deck symmetrically pitched about a central longitudinal axis to form a wedge-shape having an included angle between about 5° and 15°. The top and bottom glasses are also wedge-shaped symmetrically about the longitudinal axis. Handles extend from the sides of the chamber, and are generally centered along a central transverse axis. An optional accessory mount may be affixed to one of the decks adjacent the bow. The accessory mount can be configured with a pair of dedicated connection pads to hold a dive flag and a camera, or two cameras, etc. The configuration of the float provides flotation symmetry when roll-inverted but flotation asymmetry when pitch-inverted.
US11097818B2
The disclosure relates to a diving mask, including: a mask having a breath cavity corresponding to a mouth and a nose of a user; a vent tube connected to the mask and provided with an inlet passage, the inlet passage communicating the breath cavity with external air; and an exhaust device communicating the breath cavity, the exhaust device including an exhaust fan configured to discharge air in the breath cavity into an external environment, thereby enabling the external air to flow into the breath cavity through the inlet passage.
US11097815B2
The invention relates to a boat (1) for servicing shallow canals, lakes, and rivers configured for extracting, cutting, grinding, and casting plant waste, solid waste, or agricultural plantation harvest and sending what is harvested to shore, and comprising an extractor belt (3) configured for extracting the plant waste which is deposited on a horizontal conveyor belt (9) to a grinding mill (4); and further comprising at least one drive turbine (5) and a directional stack (6).
US11097808B2
A bicycle sprocket comprises a sprocket body, a plurality of sprocket teeth, at least one shifting facilitation area, at least one driving facilitation area, and at least one bump portion. The at least one shifting facilitation area is to facilitate at least one of a first shifting operation in which a bicycle chain is shifted from the bicycle sprocket toward a smaller sprocket adjacent to the bicycle sprocket in an axial direction parallel to a rotational center axis of the bicycle sprocket without another sprocket between the bicycle sprocket and the smaller sprocket, and a second shifting operation in which the bicycle chain is shifted from the smaller sprocket toward the bicycle sprocket. The at least one bump portion is provided in the at least one driving facilitation area.
US11097803B2
A shock absorbing and height adjusting structure includes an inner tube, a lower piston assembly and an upper piston assembly. The inner tube includes an upper end, a lower end opposite to the upper end, and an inner space for accommodating a gas. The lower piston assembly includes a lower piston movably inserted into the inner tube, and a lower passage disposed at the lower piston. The upper piston assembly includes an upper piston movably inserted into the inner tube. When the lower passage is opened, the lower piston is moved relative to the lower end, and when the upper piston is forced, the upper piston has movement relative to the upper end toward the lower end to compress the gas.
US11097797B1
A wheel securing apparatus includes a first tube having a plate positioned at a first end; a second tube engaged with the first tube such that the second tube is to extend away from the first tube; a cuff attached to a first end of the second tube and to engage with the wheel; a brace engaged with the first tube; a ratcheting wheel having teeth to engage with a openings associated with the first tube, the ratcheting wheel supported by the brace; and a handle engaged with the ratcheting wheel and to extend the second tube away from the first tube via movement of the teeth with the openings; the plate secures within a wheel guard and the cuff secures to the wheel via pressure created by extending the first tube away from the second tube.
US11097796B2
An unmanned aerial vehicle (UAV) for landing and perching on a curved ferromagnetic surface is provided. The UAV includes a plurality of articulated legs. Each articulated leg includes: a magnet configured to magnetically attach to the curved ferromagnetic surface; and a magnetic foot for housing the magnet and configured to magnetically articulate towards and attach to the curved ferromagnetic surface using the magnet in a perpendicular orientation with respect to the curved ferromagnetic surface, in response to the UAV approaching the curved ferromagnetic surface, in order to land the UAV on the curved ferromagnetic surface and for the UAV to perch on the curved ferromagnetic surface after the landing. The magnetic foot is configured to remain magnetically attached to the curved ferromagnetic surface while the UAV is perched on the curved ferromagnetic surface.
US11097794B2
A suspension system for a tracked vehicle includes a track roller configured to contact and roll relative to an inner surface of a track. In some examples, the track roller includes an axle member, a roller mounting bracket mechanically connected to the axle member, a frame mounting bracket configured to attach to a frame of the tracked vehicle, and a plurality of coil springs disposed between the roller mounting bracket and the frame mounting bracket. The plurality of coil springs is configured to reduce an impact force transferred from the track roller to the frame of the tracked vehicle.
US11097793B2
A track assembly to be mounted on a vehicle. The track assembly has a frame, a drive wheel rotationally mounted to the frame, a front idler wheel assembly mounted to the frame, a rear idler wheel assembly mounted to the frame, and a track mounted around the front idler wheel assembly, the rear idler wheel assembly, and the drive wheel, and being in driving engagement with the drive wheel. The track has a plurality of traction lugs distributed along an outer surface of the track. Each traction lug of the plurality of traction lugs has a height in a range of 1.6 inches to 2.5 inches. A distance between a foremost point on the outer surface of the track and a rearmost point on the outer surface of the track is between 54 inches and 65 inches.
US11097789B2
A structural member for automobiles to be disclosed includes a press formed product. The press formed product includes two vertical wall sections and a top plate section that joins the two vertical wall sections to each other. At least part of the top plate section is provided with a protruding section that is a steel sheet extending from the top plate section and so folded over against itself as to protrude. The protruding section protrudes from the top plate section toward the interior of the press formed product and extends along the longitudinal direction of the press formed product. With the thus configured structural member, a structural member for automobiles that has a good characteristic in a three-point bending test is provided.
US11097788B2
An electric-propulsion car includes: a main frame, a front axle unit, a rear axle unit, wherein the axle units each have an auxiliary frame for supporting the axle units and two suspension units that connect two respective wheel supports to the supporting auxiliary frame, wherein at least one of the axle units is a motorized axle with steering wheels including, mounted on said auxiliary frame, an electric motor for actuating the rotation of the wheels, a control unit for controlling said electric motor, a transmission unit for connecting the electric motor to the wheels, and a steering device for steering the wheel supports, and wherein each one of the main frame and auxiliary frames includes a reticular lattice structure including boxed elements made of steel, each one of the main frame and auxiliary frames being adapted to be pre-assembled separately and then assembled together. The main frame and auxiliary frames include elements made up of multiple segments connected together and derived from at least one boxed element made of high-tensile steel, wherein the at least one boxed element has at least one notch formed on at least one side of the boxed element without involving an ulterior side of the boxed element, the notch being made on the at least one side at the point where said ulterior side of the boxed element has to be bent to obtain the configuration of the finished boxed element.
US11097780B2
Each rear side member (4) of a vehicle body rear structure includes a first deformable portion (41), a second deformable portion (42), a third deformable portion (43), and a fourth deformable portion (44) in that order from a rear end thereof on an inboard side and an outboard side in an alternating manner and in a mutually spaced apart relationship, and the distances between the adjacent deformable portions are substantially 1:2:1:1 in ratio as measure from the rear end of the rear side member.
US11097773B2
The present disclosure relates to an apparatus and a method for controlling steering of a vehicle and, more particularly, for steering independently each of the vehicle wheels by using respective steering controller based on the target steering angle information for each vehicle wheel, determining the normal steering controller among a plurality of the steering controllers, re-determining the target steering angle information of the vehicle wheel connected to the normal steering controller by using a driving information of the vehicle, and steering the vehicle wheels based on the re-determined target steering angle information.
US11097767B2
A steering system includes a steering column, a column bracket, a distance bracket, a rod, and an elastic member. The steering column supports an input shaft coupled to the steering wheel. The column bracket has a long hole therethrough and supports the steering column. The distance bracket includes: two vertical plates provided on an outer circumferential surface of the steering column and extending along the column bracket; and a horizontal plate coupling together the two vertical plates. The rod penetrates the long hole and the vertical plates. The elastic member is positioned between the horizontal plate and the rod and presses the rod toward the steering column.
US11097765B2
A steering wheel configured to be rotated around a central axis of rotation includes a boss section that is located in a lower portion of the steering wheel and in a vicinity of the central axis of rotation, an outer peripheral portion that is disposed in an outer edge of the steering wheel in a circumference of the boss section, and a central portion that covers an entirety of a region located farther towards the boss section than the outer peripheral portion including a region above the boss section. The outer peripheral portion includes a grip portion to be gripped by the driver. The central portion includes a raised portion that protrudes farther upward than the outer peripheral portion along the central axis of rotation. The raised portion includes, in the upper portion, a cushion portion having such a resiliency that makes the cushion portion restorably dentable.
US11097764B2
A system for hand detection on a steering wheel includes a signal line extending from a first point to a second point and being disposed along at least a portion of a surface of the steering wheel; and a detection unit coupled to the first point. The detection unit is configured to send a time-dependent detection signal over the signal line, receive a reflected signal from the signal line and detect the presence of a hand on the surface based on the reflected signal.
US11097761B2
Disclosed is a wagon having improved convenience of use, wherein the wagon includes a main frame, a seat frame, a canopy frame, and a wheel assembly, wherein a foldable structure of each frame is conveniently manufactured such that the wagon can be unfolded and folded within a short time when the wagon in a stored state is installed, whereby portability and mobility of the wagon are improved, wherein the overall frame is easily folded and unfolded, whereby it is possible to conveniently use the wagon, wherein attachment and detachment of the canopy and the driving wheels are easy, whereby carrying and storage of the wagon are easy, and wherein the wagon is easily folded and unfolded without separation of the seat frame and the canopy, whereby it is possible for everyone to easily install and store the wagon.
US11097754B2
A system that allows an electronically controlled pneumatic (ECP) railcar to be optionally selected as the ECP End of Train (EOT) device when that car is positioned at the end of a train regardless of its physical orientation. This eliminates the requirement to use and install a traditional End of Train (EOT) device at the end of an ECP train while maintaining the same train integrity monitoring functionality that is typically provided for train brake-in-two detection and closed cut-out cock detection. The system also eliminates the requirement for a dedicated EOT device at the end of the train for ECP “RUN” Mode operation, and allows any ECP car to function normally as part of the train or act as the EOT device when selected.
US11097745B2
A driving support method for a vehicle includes: acquiring a sound of a sound source placed outside the vehicle; and displaying, on a display portion, driving support information corresponding to an utterance content of the sound, the utterance content of the sound being recognized by a sound recognition process, in a display mode suggesting a relative position of the sound source from the vehicle, the relative position being specified based on the sound.
US11097740B2
A four-wheel drive vehicle comprises: a dog clutch; an electronically controlled coupling; and a control device switching a drive state to the four-wheel drive state when the control device determines that a running road surface is a low friction road and switching the drive state to the two-wheel drive state when the control device determines that the running road surface is a high friction road. In the case of switching the drive state from the four-wheel drive state to the two-wheel drive state, the control device temporarily releases the electronically controlled coupling to redetermine whether the running road surface is the low friction road or the high friction road before releasing the dog clutch and prohibits switching from the four-wheel drive state to the two-wheel drive state when it is redetermined that the running road surface is the low friction road.
US11097739B2
Technical solutions are described for estimating tire-road friction in a vehicle pro-actively, prior to safety systems of the vehicle are engaged. An example method includes computing a slip for the vehicle based on one or more wheel speeds, acceleration, and tire pressure measurement. The method further includes determining a slope (α) as indicator of tire-road friction for the vehicle based on the acceleration and the slip. Further, the method includes sending the slope to an autonomous controller of the vehicle for adjusting vehicle kinematics according to the estimated friction using the slope.
US11097737B2
A vehicle control apparatus calculates a target speed value of an engine rotational speed that is required to provide a required torque value of an engine brake torque, and controls shifting of an automatic transmission such that the engine rotational speed is approximated to the target speed value of the engine rotational speed. The vehicle control apparatus determines whether the target speed value exceeds a predetermined threshold value. When the target speed value exceeds the predetermined threshold value, the vehicle control apparatus controls the shifting of the automatic transmission such that the engine rotational speed is held not higher than the predetermined threshold value, and controls a throttle valve such that the throttle valve is opened.
US11097734B2
A vehicle control device includes: an operation detection unit that detects an operation input of a user for an operation input unit; a speed setting unit that sets travel speed of a host vehicle on the basis of the operation input that is detected by the operation detection unit; and a lane change control unit that controls lane change. If the operation input that decreases, by more than or equal to a predetermined degree, setting travel speed that is the speed set by the speed setting unit, or the operation input that decreases the setting travel speed to be lower than current travel speed of the host vehicle, is performed after the lane change is started, the lane change control unit cancels the lane change.
US11097728B2
A longitudinal driver assistance system, in a hybrid vehicle equipped with at least one electric drive motor, one internal combustion engine and one electronic drive control unit which actuates said motor and engine, includes: a detection system for the predictive detection of an event which, starting from an actual speed, leads to the specification of an increased setpoint speed at a specified location-dependent time, and a function unit which is configured to specify a setpoint acceleration profile to the increased setpoint speed and to output it to the drive control unit for generating a motor/engine torque which is necessary to reach the setpoint acceleration profile. The function unit is also configured to receive, when a defined condition applies, a limiting maximum possible motor/engine torque from the drive control unit, which motor/engine torque is not sufficient to reach the setpoint acceleration profile, and to specify a changed setpoint acceleration profile on the basis thereof.
US11097726B2
A lane keeping assist system and method for increasing safety in preceding vehicle follower longitudinal control are disclosed. The lane keeping assist system for performing lane keeping using information about a lane and peripheral vehicle includes an image sensor configured to detect a forward lane and a preceding vehicle with respect to a host vehicle, and an electronic control unit (ECU) configured to control a traveling direction of the host vehicle in a manner that the host vehicle follows a traveling route within the detected lane, perform a preceding vehicle follower control to control the traveling direction of the host vehicle in a manner that the host vehicle follows the preceding vehicle if the lane is not detected, and restrict a follower longitudinal control if the preceding vehicle deviates from an expected path of travel. Thus, the ECU controls a vehicle to safely enter an entrance of a highway service station nearest to a current highway in which the vehicle is traveling, resulting in greater driver convenience.
US11097718B2
A hybrid vehicle includes: an internal combustion engine; a motor generator; an electric storage device electrically connected with the motor generator; and a control device configured to set a control mode of an electric storage level of the electric storage device, to one of a charge depleting mode and a charge sustaining mode. The control device is configured to expand a permissible fluctuation band of the electric storage level during the charge sustaining mode, when the control device is performing a first switching control, compared to when the control device is not performing the first switching control, the first switching control being a control in which the control device automatically performs switching between the charge depleting mode and the charge sustaining mode, at least partly based on a predicted load on a planned traveling route for the hybrid vehicle.
US11097712B2
A control device is provided for a vehicle including a drive source and an automatic transmission having a park lock mechanism for locking an output shaft and an engaging element to be engaged at the start of running. Output rotation of the drive source is input to the automatic transmission. The control device includes a control unit to limit a torque of the drive source until the release of locking by the park lock mechanism is completed in response to an instruction being given to change from a parking range to a travel range. The control unit is configured to limit the torque of the drive source from after the instruction is given to change from the parking range to the travel range until the release of locking by the park lock mechanism is completed.
US11097711B2
An electric machine and internal combustion engine are coordinated to provide traction control for an automotive vehicle. A propulsive torque limit is set by a controller during a loss of traction. When the machine torque limit is greater than the propulsive torque limit, the engine is pulled down. When the machine torque is less than the propulsive torque limit, the engine is pulled up. The controller coordinates the pulled up engine with the machine such that the engine is subordinated to the machine.
US11097705B2
An electric parking brake system includes a wheel driven by an electric motor to move a vehicle, a parking brake maintaining the wheel stopped, a parking brake actuator operating the parking brake, and a drive controller controlling the parking brake actuator. The drive controller controls the electric motor to maintain the wheel of the vehicle stopped while the vehicle is parked, and calculates a parking torque based on a control amount of the electric motor that maintains the wheel stopped. The drive controller calculates a necessary braking force for the parking brake to maintain the wheel stopped based on the calculated parking torque, and controls the parking brake actuator so that the necessary braking force is generated.
US11097691B2
A heating system for use with a vehicular camera assembly including a heater bracket having a first surface and a second surface, the first surface having a plurality of adjacent ridges and a valley being defined between at least two of the adjacent ridges; a heating assembly disposed adjacent the second surface of the heater bracket; and at least one through opening in the valley between the at least two adjacent ridges, the at least one through opening extending from the first surface to the second surface of the heater bracket.
US11097689B2
A system includes a communication module configured to establish a first secure communications link with a portable device and a second secure communications link with a contactless smartcard. The contactless smartcard includes a unique identification (ID). A memory module configured to store information associated with the portable device and the contactless smartcard. A temporary key module configured to store the ID of the contactless smartcard and vehicle operation limitations associated with the ID of the contactless smartcard in the memory module. An authentication module configured to (i) authenticate the portable device and (ii) authenticate the contactless smartcard. A passive entry/passive start (PEPS) module configured to receive authentication of at least (i) the portable device or (ii) the contactless smartcard from the authentication module, and perform a vehicle operation based on at least (i) the received authentication and (ii) the vehicle operation limitations stored in the memory module.
US11097686B1
Apparatus and system for an adjustable seatbelt guide are disclosed. The seatbelt guide is attached to a mechanical stop associated with a seat. The mechanical stop, such as a striker, is adapted to limit reclining movement of a seatback, especially with respect to a rear seat of a vehicle. The mechanical stop and attached seatbelt guide may move positions with or without the seat in order to maintain seatbelt geometry. When the seat is folded down, the seatbelt guide may maintain the seatbelt in the parked position.
US11097681B2
A vehicle seat having an airbag unit for protecting a passenger sitting rear of the vehicle seat. The deployed airbag (30) extends from the rear side of the backrest of the vehicle seat into the vehicle rear direction. A support surface (32) of the airbag (30) is positioned above the attachment between the airbag unit (20) and the backrest and an impact surface (34) of the airbag (30) is located in front of a rear seated passenger. The airbag is relatively small and high positioned such that the impact surface (34) is positioned to exclusively contact the head of the passenger. In the state in which the airbag (30) is fully deployed but free of outer forces, the impact surface (34) defines an impact plane (IP) and a support surface (32) defines a support plane (SP). The impact plane (IP) and the support plane (SP) enclose a first angle (a) between 5° and 90°.
US11097664B2
An attachment device for a load carrier includes a housing, a first attachment member, a second attachment member, an actuation member, and a locking system. The first and second attachment members apply a clamping force to an elongate member (such as a cross bar of a roof rack) between the first attachment member and the second attachment member. The actuation member is configured to apply a closing force to the first attachment member and is maneuverable from an open position to a closed position. The locking system is configured to resiliently accumulate a portion of the closing force when the closing force applied to the actuation member or the first attachment member exceeds a predefined load, regardless of the size of the elongate member but within a range of motion of the first and second attachment members, during the transition from its open position to its locked position.
US11097662B2
A side view mirror incorporating a plurality of cylinders, each cylinder having a mirrored rear wall, a lateral wall and an oppositely lateral wall; an air scoop having lateral and oppositely lateral walls, the air scoops' lateral wall including one of the cylinders' oppositely lateral walls and the air scoop's oppositely lateral wall including another cylinder's lateral wall; the side view mirror further incorporating an air nozzle having an intake end communicating with the air scoop, wherein the air scoop has front and rear walls, wherein the air scoop's front wall includes the one of the cylinders' mirrored rear walls, and wherein the air scoop's rear wall includes the another cylinder's mirrored rear wall; the side view mirror further incorporating a brace interconnecting the one of the cylinders and the another cylinder.
US11097659B1
The vehicle rear occupant alert system provides alerts corresponding to occupancy of rear seats. The system comprises a door position sensor, an ignition sensor, and an alert system. Further, the alert system comprises a processor and a memory. The door position sensor determines a rear door status between an ajar position and a closed position. The ignition sensor determines an ignition state between an ON state and an OFF state. The alert system is coupled with the sensors. The processor adjusts status of the alert system as armed if the rear door transitions from ajar to closed position and the ignition transitions from OFF to ON state. The alert system notifies and alerts a driver to check the rear seat when the ignition transitions to OFF state. The processor rearms the alert system after the ignition transitions from OFF to ON state within a predefined time.
US11097645B2
A tie down assembly includes a clasp, a ring that is rotatably coupled to the clasp, and a support coupler that is coupled to the ring. The support coupler frictionally controls rotation of the ring with respect to the clasp.
US11097637B2
A vehicle seat includes an internal support member for supporting a seat occupant. The internal support member includes a main body in plate or sheet form positioned within a seat cushion frame, a pair of inclined portions extending laterally from a part of either lateral side of the main body with an upward slant, and front and rear mounting portions engaged by front and rear cross members of the seat cushion frame. A pressure sensor is mounted on a part of an upper surface of the internal support member located ahead of the inclined portions. The main body of the internal support member is provided with a pair of openings located on either side of the pressure sensor, and a connecting portion connecting the pressure sensor with a part of the front mounting portion. The pressure sensor and the openings are spaced from the front edge of the main body.
US11097636B2
A fuel cell vehicle includes a fuel cell, an oxygen-containing gas supply apparatus, and an ECU. A pump of the oxygen-containing gas supply apparatus is a shaft floating type air pump having a rotatable element. The rotatable element floats from a wall around the rotatable element, as a result of rotation of the rotatable element. The ECU includes a travel permission determination instruction unit. The travel permission determination instruction unit determines whether or not a predetermined condition indicative of a floating state of the rotatable element is satisfied, and if the predetermined condition is satisfied, permits traveling of the fuel cell vehicle, and if the predetermined condition is not satisfied, restricts traveling of the fuel cell vehicle.
US11097630B2
The invention relates to a method for managing the energy demand of a charging station for an electric vehicle having an energy storage device, a charging power being supplied and controlled conductively via a charging connection line with the aim of providing a largest possible (current) control potential in order to attain grid stability for the power supply system. An anticipated parking duration and a desired energy amount are recorded as power-specific vehicle data and customer-specific data. Based on the aforementioned data, a charging plan is established which can follow different charging strategies according to the invention which dictate the temporal progress of the charging power while parking.
US11097627B2
Some embodiments include an energy source supply appliance. The energy source supply appliance can comprise an appliance energy source supply system, and the appliance energy source supply system can comprise a first thermal control device and a second thermal control device. The appliance energy source supply system can be configured to receive a hydrogen fuel energy source and to make available the hydrogen fuel energy source to a receiver vehicle, and the receiver vehicle can comprise a drive system configured to use the hydrogen fuel energy source received by the receiver vehicle to motively power the receiver vehicle. Other embodiments of related systems, devices, and methods also are provided.
US11097622B2
A transmission device includes a pair of terminals connected to an electrical coupler via a pair of signal lines, a transmission unit connected to the pair of terminals via a pair of capacitor, and a DC power supply, a switch, and inductances, each connected in series between the pair of terminals without interposition of the pair of capacitors. A transmission device includes a pair of terminals connected to an electrical coupler via a pair of signal lines, a reception unit connected to the pair of terminals via a pair of capacitors, and a load resistor and inductances each connected in series between the pair of terminals without interposition of the pair of capacitors.
US11097618B2
A control architecture for electric vehicle wireless power transmission systems that may be segmented so that certain essential and/or standardized control circuits, programs, algorithms, and the like, are permanent to the system and so that other non-essential and/or augmentable control circuits, programs, algorithms, and the like, may be reconfigurable and/or customizable by a user of the system. The control architecture may be distributed to various components of the wireless power system so that a combination of local or low-level controls operating at relatively high-speed can protect critical functionality of the system while higher-level and relatively lower speed control loops can be used to control other local and system-wide functionality.
US11097615B2
A dashboard component assembly for a vehicle, including: a cover-panel; a main body and an auxiliary body, the auxiliary body being retained on the main body so as to be movable in at least one dimension relative to the main body prior to installation of the cover-panel, the cover-panel is configured to cover at least a portion of each of the main body and the auxiliary body; a primary datum included by one of the cover-panel or the main body; a primary datum retainer included by the other of the cover-panel or the main body, the primary datum is configured to engage at least one primary datum retainer to cause a predetermined alignment of the cover-panel with regard to the main body; a secondary datum included by one of the cover-panel or the auxiliary body; a secondary datum receiver comprised by the other of the cover-panel or the auxiliary body.
US11097613B2
A vehicle is disclosed. The vehicle may include a hydraulic system. The vehicle may include a sway bar. The sway bar may be positioned rearward of a hydraulic pump of the hydraulic system. A console having a first hydraulic input may be provided in an operator area of the vehicle.
US11097611B2
A vent control valve includes: a first case shaped in a tube that forms a passage for ventilation; a movable valve object arranged in the first case to open and close the passage; an inner case arranged in the first case to support the movable valve object; a second case disposed at a lower end of the first case; a first connection mechanism defined between the first case and the inner case, the first connection mechanism connecting the first case and the inner case with each other; and a second connection mechanism defined between the first case and the second case, the second connection mechanism connecting the first case and the second case with each other.
US11097610B2
The present invention relates to a cooling module for a vehicle, and more particularly, to a cooling module for a vehicle including a condenser, a first radiator through which coolant for an engine flow, a second radiator through which coolant for electrical components flows, and an intercooler, and capable of evenly distributing air resistance of the front surface of the first radiator to secure an overall balance of an air volume distribution by disposing the condenser, the second radiator, and the first radiator in a flow direction of air or disposing the second radiator, the condenser, and the first radiator in this order, and disposing the intercooler on lower sides of the condenser and the second radiator, and capable of minimizing a gap of each heat exchange period by disposing the condenser C and the first radiator R to be in closely contact with the second radiator L.
US11097605B2
A tonneau cover system, comprising: (a) one or more brackets secured to at least one of a pair of opposing sidewalls of a cargo box of a vehicle; (b) a foldable tonneau cover having a plurality of interconnected panels, at least one of the plurality of interconnected panels including: (1) one or more latch assemblies that engage the one or more brackets; and (2) an actuator assembly connected to each of the one or more latch assemblies by a cable, wherein actuation of the actuator assembly moves the cables that in turn release engagement of the one or more latch assemblies from the one or more brackets.
US11097601B2
An improved portable scent warmer having a modular or compartmentalized housing holding a scented member, a heating element imparting heat to the scented member to release its fragrance, a fan element for direct the dispersion of the fragrance, a input device for selectively controlling and actuating the heating element; a rotatable cover adjoined to the housing; and at least one power supply means for powering the heating element.
US11097599B2
There is provided a vehicle air conditioning device of a heat pump system which improves comfortability when changing to heating only by an auxiliary heating device. The device includes a heating medium circulating circuit 23 to heat air to be supplied from an air flow passage 3 to a vehicle interior, and when shifting to the heating of the vehicle interior only by the heating medium circulating circuit 23 in a heating mode, a controller executes a shifting control to increase a heating capability of the heating medium circulating circuit 23 prior to stopping a compressor 2 and decrease a heating capability of a radiator 4 in accordance with the increase of the heating capability of the heating medium circulating circuit 23.
US11097595B2
A remote air conditioning start system includes a terminal of a user, a center server, and a vehicle that includes an air conditioner and is configured to communicate with the center server. The remote air conditioning start system includes first and second transmission units, first and second reception units, a start controller provided in the vehicle and configured to, when the second reception unit receives a start request, start the air conditioner, a determination unit provided in one of the terminal, the center server, and the vehicle and configured to determine necessity of defrosting of a window of the vehicle, and a notification unit provided in the terminal and configured to, when the determination unit determines that defrosting of the window is needed, notify the user that defrosting of the window is needed.
US11097594B2
A heating, ventilation and/or air-conditioning device for a motor vehicle, including a first device component (10) which has a latching receptacle (12) with a receiving opening (14) for inserting a rigid latching tongue of a second device component which extends substantially along a mounting axis (24), wherein a first peripheral portion (16) of the receiving opening (14) is formed by a wall portion of the first device component (10) and wherein a second peripheral portion (18) of the receiving opening (14) that is opposite to the first peripheral portion (16) is designed to be substantially flexurally stiff, and third and fourth peripheral portions (20,22) which are situated peripherally between the first peripheral portion (16) and the second peripheral portion (18) are designed as a bending portions.
US11097592B2
An on-board electric compressor that comprises: a housing; a compression unit; an electric motor; and an inverter device. The inverter device comprises: an inverter circuit that converts direct current power to alternating current power; and a noise reduction unit that is provided on an input side of the inverter circuit and that reduces common mode noise and normal mode noise that are included in the direct current power. The noise reduction unit comprises: a common mode choke coil; and a smoothing capacitor that, in cooperation with the common mode choke coil, constitutes a low pass filter circuit. The common mode choke coil has: a core that has a first core part and a second core part; a first winding that is wound around the first core part; and a second winding that is wound around the second core part.
US11097591B2
A system for controlling movements of doors of an HVAC module includes an actuation gear and an intermediate cam. A main door includes a first portion and a second portion having a first guide. The first portion engages with actuation gear to enable linear movement of the main door. A slave door includes a second engagement element and moves between a blocking and unblocking position based on movement of main door. The intermediate cam moves angularly and includes a first engagement element and a second guide. The first engagement element interacts with the first guide, and the second guide interacts with second engagement element to facilitate angular movement of slave door in response to movement of the main door. The first guide includes a bend positioned to enable angular movement of the slave door after the main door moves a pre-determined distance.
US11097578B2
A trailer frame includes an axle-carrying portion and a tongue. The tongue includes first and second curved drawbars, each defining a convex surface. The convex surface of the first drawbar faces the convex surface of the second drawbar. The facing convex surfaces allow for an increased turning radius of a tow vehicle connected thereto by increasing the distance between the rear corners of the tow vehicle and the tongue.
US11097576B2
A wireless vehicle data communications device is adapted for mounting on a wheel hub assembly of a vehicle and incorporates a self-generating electrical power supply. The vehicle data communications device includes a housing, a microprocessor located inside the housing, a signal transmitting device, a signal receiving device, an electric generator, and an energy storage and supply medium. The housing is adapted to rotate simultaneously with the wheel hub assembly when the vehicle is in motion. Rotation of the housing relative to the components carrier induces an electric current.
US11097571B2
A tire having a tire frame, the tire frame comprising a thermoplastic elastomer as a resin material, and the thermoplastic elastomer having a value of orientation f, as measured by a small angle X-ray scattering method, of from −0.08 to 0.08.
US11097567B2
A paper stack S supplied between clamping plates 1a, 1b of a carriage clamp 1 is pushed toward a positioning bar 2b by an alignment bar 5. A nip head 7 of a paper stack supplying unit 3 has first and second nip plates 9, 10, and a nip plate drive mechanism 11 moving each nip plate from a protruding position at which the nip plate protrudes from the nip head and a retracted position at which the nip plate retracts into the nip head, and translating the second nip plate taking the protruding position relative to the first nip plate taking the protruding position between a first position at which the first and second nip plates receive the paper stack therebetween and a second position at which the second nip plate cooperates with the first nip plate to grip the paper stack.
US11097566B2
An object of the present invention is to provide a thermal transfer recording sheet that provides an image that is excellent in light fastness and has a satisfactory imbalance. The present invention relates to a thermal transfer recording sheet including a substrate and dye layers (a yellow dye layer, a magenta dye layer, and a cyan dye layer), in which one or more kinds of the dye layers each contain one or more kinds of specific compounds. The present invention also relates to a thermal transfer recording sheet including a substrate, dye layers, and a protective layer for protecting the surface of an image, in which the protective layer contains one or more kinds of specific compounds.
US11097555B2
The thermal printer includes a heating element, and a voltage supply circuit that supplies a drive voltage and a test voltage to the heating element. The voltage supply circuit includes a drive voltage supply circuit that is coupled to the heating element and that turns ON the supply of the drive voltage to the heating element, a test voltage supply circuit that is coupled to the heating element and that turns ON the supply of the test voltage to the heating element, a drive voltage stop circuit setting the supply of the drive voltage of the drive voltage supply circuit OFF, and a test voltage stop circuit setting the supply of the test voltage of the test voltage supply circuit OFF.
US11097544B2
Provided is a liquid discharging head including: a membranous member including a discharging port through which a liquid is discharged; and a displacement member disposed at membranous member's one side at which the liquid to be discharged through the discharging port is provided and configured to displace a position of the membranous member to cause the liquid to be discharged through the discharging port.
US11097543B2
In a substrate of a liquid ejection head, there are formed a first through-hole which constitutes a liquid supply path, and a second through-hole in which a through-hole electrode electrically connected to a wiring layer is formed on the inner surface. The first through-hole has a first hole having a first opening and a second hole having a second opening, and the second through-hole has a third hole having a third opening and a fourth hole having a fourth opening. When the minimum width of the first opening is represented by D1, the minimum width of the second opening is represented by D2, the minimum width of the third opening is represented by D3, and the minimum width of the fourth opening is represented by D4, the first to fourth openings satisfy a relation of D1>D3>D4>D2.
US11097539B2
A liquid ejection head includes a supply manifold, a return manifold, a plurality of individual channels, and a connecting throttle channel. The supply manifold includes a supply port through which liquid is supplied from an exterior. The return manifold includes a return port through which liquid is discharged to the exterior. Each individual channel is connected, at an upstream end thereof, to the supply manifold and, at a downstream end thereof, to the return manifold. Each individual channel communicates with a corresponding one of nozzles and includes an individual throttle channel. Through the connecting throttle channel, adjacent ones of the individual throttle channels communicate with each other. The connecting throttle channel has a channel resistance less than or equal to a channel resistance of each individual throttle channel.
US11097529B2
Methods for fabricating three-dimensional objects by 3D-inkjet printing technology are provided. The methods utilize curable materials that polymerize via ring-opening metathesis polymerization (ROMP) for fabricating the object. Systems suitable for performing these methods and kits containing modeling material formulations usable in the methods are also provided.
US11097527B2
A process for the formation of an assembly comprising a structured or compacted porous film (c) comprising a) application of a porous film (d) onto an elastic substrate (a) in a stretched state such that a reversible adhesion of the film on the stretched substrate (a) occurs, and b) relaxing the substrate (a) with the applied film thereon to obtain a structured or compacted porous film (c), c) applying a support material (e) to a part of the structured or compacted film (c) so that the structured or compacted film to which no support material (e) is attached is releasable.
US11097523B1
A method of making a laminated optically clear adhesive (OCA) assembly includes providing a first OCA component having a first thickness; providing a second OCA component having a second thickness; and laminating the first OCA component and the second OCA component using a roll to roll lamination process to form the laminated OCA assembly. The first OCA component and the second OCA component are laminated together at a nip roller assembly, the nip roller assembly using a nip roller pressure selected based on the total thickness of the first and second OCA components such that the nip roller pressure decreases as the total thickness of the first and second OCA components increases.
US11097510B2
A laminate having an easy-to-adhere layer on at least one face of a resin substrate film, and having a heat seal layer on a face, of at least one of the easy-to-adhere layer(s), which is on a side opposite the resin substrate film, wherein the resin substrate film has a glass transition temperature of not less than 90° C.; the easy-to-adhere layer is formed from easy-to-adhere agent containing 100 parts by weight of acrylic polymer resin and 3-40 parts by weight of crosslinking agent; the acrylic polymer resin has methylol groups in an amount of 7-20 mol % of all monomer units that make up this polymer; the crosslinking agent is at least one crosslinking agent selected from oxazoline-type crosslinking agents and glycidylamine-type crosslinking agents; and the heat seal layer is a polyolefin-type heat seal layer with a thickness of less than 300 μm.
US11097495B2
A method for manufacturing a composite structure. The method includes depositing a plurality of thermoplastic particles onto at least one of a surface of a filler member and a surface of a structural member. The method further includes assembling the filler member with the structural member such that the plurality of thermoplastic particles are disposed proximate an interface between the filler member and the structural member.
US11097494B2
A system and method for laser sealing an edge portion of a covering of an architecture-structure covering is disclosed. In one embodiment, after cutting a covering of an architectural-structure covering to an appropriate size, lasering the cut edge portions or surfaces of the covering to seal the cut edge portions or surfaces of the covering to prevent fraying. The beam of the laser may be positioned to contact the cut edge portions or surfaces of the covering in a plane of the fabric. Subsequently, the beam of the laser scans or moves across the surface of the cut edge portion of the covering. In use, the beam of the laser is arranged and configured to apply heat to the surface of the fabric material at discrete points or spots to vaporize any loose fibers located along the cut edge portion of the covering.
US11097492B2
Water-soluble thermoplastic polymer composites of water-soluble thermoplastic polyethylene oxide graft polymers, and nanoscopic particulate processing aids such nanoscopic titanium dioxide powders, or water-soluble polyethylene oxide graft polymers, structural reinforcement materials such as carbon or glass fibers, and plasticizers. These water-soluble thermoplastic polymer composites may be useful in preparing, for example, three-dimensional (3D) sacrificial supports, vapor sensors, as well as other three-dimensional (3D) articles, objects, or parts.
US11097490B2
Additive manufacturing systems using artificial intelligence can identify an anomaly in a printed layer of an object from a generated topographical image of the printed layer. The additive manufacturing systems can also use artificial intelligence to determine a correlation between the identified anomaly and one or more print parameters, and adaptively adjust one or more print parameters. The additive manufacturing systems can also use artificial intelligence to optimize one or more printing parameters to achieve desired mechanical, optical and/or electrical properties.
US11097486B2
A method of 3D print modelling includes: generating a point cloud representation of a target virtual object for 3D printing, generating a voxel representation of the point cloud by adding a respective first voxel when a respective first point from the point cloud representation is located in the notional volume occupied by that first voxel, assigning a first colour associated with the first point to the faces of the first voxel, and if a second point from the point cloud representation is located within the volume of the first voxel, assigning a second colour associated with the second point to a respective face of the new voxel corresponding to the normal of the second point; and thickening the voxel representation of the point cloud by generating a duplicate voxel adjacent to the first voxel along a first axis passing through two opposing faces of the first voxel respectively having the first and second colours.
US11097472B2
At least one agent distributor may be to selectively deliver coalescing agent onto portions of a layer of build material at a first density and at a second density lower than the first density. A controller may be to control the at least one agent distributor to selectively deliver the coalescing agent at the first and second densities onto respective first and second portions of the layer in respective first and second patterns derived from data representing the three-dimensional object to be generated, so that when energy is applied to the layer the build material may coalesce and solidify to form a slice of the three-dimensional object in accordance with the first pattern. The second portion may be in proximity to a boundary of the first portion. Presence of the coalescing agent in the second portion may be to prevent at least some heat from flowing away from the first portion when the energy is applied.
US11097464B2
Devices and methods are described that provide printing of three-dimensional objects using reactive materials such as materials that result in a polyurethane formulation. Three-dimensional printing in accordance with the present disclosure can be performed using an inkjet printer or other systems that deposit or dispense material. A formulation made up of two or more reactive materials and, optionally, one or more UV-curable materials is also provided. The materials can be jetted based on a desired configuration to achieve a maximum reaction between materials, and can be based on desired jetting or molar ratios. By heating or applying energy on the jetted materials, their reaction and related solidifying can be accelerated. Corrective printing is also provided for, and can be used at desired intervals to eliminate printing errors relative to the object as modeled. Systems and methods used in conjunction with all of the same are provided.
US11097463B2
An improved device for the uniaxial or biaxial stretching of plastics material portions. The device includes a stretching frame with two pairs of mutually perpendicular guide rails with clips for stretching a plastics material portion, which clips are movable away from or towards each other. The device is constructed such that in addition to the starting position at the beginning of a stretching process and the end position after performing a stretching process, the guide rails and thus the clips seated thereon are additionally movable into a loading position. The loading position is arranged so that it lies asymmetrically within the stretching frame and is thus closer to at least one longitudinal side of the stretching frame than to the opposite side of the stretching frame.
US11097460B2
A balloon wrapping apparatus is disclosed by which a balloon can be accurately positioned and inserted in relation to a pleating section. The balloon wrapping apparatus for wrapping a balloon provided at a distal portion of an elongated shaft includes: a pleating section that forms the balloon with wing shapes; a folding section that folds the wing shapes formed in the balloon along a circumferential direction; a support base that supports a portion other than the distal portion of the shaft, and that makes the distal portion of the shaft insertable into the pleating section and the folding section; and a core metal member to be inserted in the shaft. The core metal member is inserted in the shaft from a distal end position of the balloon to at least the proximal side of a proximal end position of the balloon.
US11097455B2
A method for producing a thermoplastic panel, including the steps of providing a rotary injection tool exhibiting a die cavity and featuring at least one lifter component within the cavity. The tool is positioned to orient the cavity in a first configuration during which a first shot injection molding of a doghouse is conducted onto a receiving location of the lifter component. The cavity is open and the tool rotated to reposition the cavity in a second configuration, following which a second shot injection molding operation is conducted for forming a skin of the panel in communication with the first shot doghouse clip. Following this, the mold is opened and the finished part removed.
US11097454B2
A system and method for manufacturing a part in a mold having a mold cavity including a printhead for depositing a first material within the mold cavity, and an injection head for depositing a second material within the mold cavity. A part can be made in the mold cavity by the cooperative use of both injection molding and additive manufacturing steps.
US11097443B2
A pusher for a planer contains: a body, a planer, a movable control portion, and a push member. The planer includes a cutter, a drive shaft, a transmission portion, a horizontal rod, a reduction wheel, and a threaded portion. An upper belt is fitted on the lower belt, a wheel rod and an auxiliary rod. The wheel rod includes a second receiving portion, a guiding portion, and a pushing wheel. The guiding portion has a transmitting belt fitted on an actuation rod. The actuation rod has a driving portion and another pushing wheel. The auxiliary rod is supported on an auxiliary abutting block inserted onto a positioning rod, and a returning spring is fitted on the positioning rod. The movable control portion includes a rotary shaft and a movable pedestal. The press post has two pressing wheels, and a control wheel is biased against the transmitting belt.
US11097442B2
A portable power tool, in particular a hand-held planing machine, includes at least one workpiece contact unit and at least one handle unit. The workpiece contact unit has at least one workpiece contact surface, and the handle unit has at least one main handle. The main handle has at least one maximum distance point that, in a direction extending at least substantially perpendicularly to a workpiece contact surface, has a maximum distance from the at least one workpiece contact surface. The maximum distance is less than 150 mm.
US11097440B2
A cutting mechanism includes electrodes that are utilized to cut or score a non-conductive outer material of a filament or sheet. The electrodes contact a conductive reinforcing material of the filament or sheet to complete an electric circuit. Electric current flows through and heats the conductive material to oxidize or otherwise separate/cut the conductive material and any remaining non-conductive material.
US11097439B2
A method and apparatus for replacement of damages display shield (typically glass) covering a display screen on a device, typically a mobile phone. Mobile phones have an electronic display protected by a glass shield. Between the glass and the display is often a plastic polarizing or other intermediary sheet. Removal of a damage glass can be accomplished by cutting thru the polarizer with a moving wire or blade. This separates the glass from the sensitive display and allows replacement of the glass without damaging the more expensive display.
US11097438B2
Adjustable weight striking device can be selectively loaded with weighting material to temporarily increase striking force during use and unloaded to reduce weight while carrying. The tool has body made of low density material and working end for striking tool, handle extending from the body made of low density material, striking tool at working end, and apparatus for holding weighting material adjacent to the body. The weight holding apparatus can be platform with straps or other securing feature for temporarily holding weighting material and/or an interior chamber within the body for receiving weighting material. Weighting material can be sand, water, dirt, gravel, rock, or metal and can temporarily increase the weight of the striking tool by 50%, 100%, 200% 250%, 300%, 400%, 500% or more depending on volume and/or density of weighting material as compared to striking device.
US11097436B2
A friction control device (44) is adapted to induce a lateral strain (or stretching) within a human tissue surface to which the device is applied, in order thereby to reduce the static friction between the device and the human tissue surface. The strain is induced by means of an actuator arrangement adapted to effect a relative separation of a plurality of contact surface regions (40) of the device, such that when said regions are pressed onto the receiving surface, the relative separation induces a strain in at least the region of the receiving surface falling between the locations of the applied regions. The extent of separation matches or exceeds the minimum extent necessary to overcome static friction.
US11097426B2
A carrier system and method carries a plate-like object to an object mounting section. The system imparts vibration to the object that has been moved such that the object is vibrating when the object is placed onto the mounting section.
US11097420B2
An interference determination apparatus includes: an acquisition unit that acquires region information indicating regions set in a configuration space in which the angles of rotation of two or three specific joints of an articulated robot are indicated by coordinate axes, the regions including an interference region in which the robot is determined to interfere with itself or an obstacle based on the magnitudes of the angles of rotation of the specific joints, and a non-interference region in which the robot is determined to not interfere with itself or an obstacle based on the magnitudes of the angles of rotation of specific joints; and a determination unit that determines whether the robot interferes with itself or an obstacle, by determining whether coordinates indicating a posture determined by the angles of rotation of the specific joints belong to the interference region or the non-interference region indicated by the acquired region information.
US11097414B1
A system includes a robotic device, a sensor disposed on the robotic device, and circuitry configured to perform operations. The operations include determining a map that represents stationary features of an environment and receiving, from the sensor, sensor data representing the environment. The operations also include determining, based on the sensor data, a representation of an actor within the environment, where the representation includes keypoints representing corresponding body locations of the actor. The operations also include determining that a portion of a particular stationary feature is positioned within a threshold distance of a particular keypoint and, based on thereon, updating the map to indicate that the portion is to be cleaned. The operations further include, based on the map as updated, causing the robotic device to clean the portion of the particular stationary feature.
US11097413B2
The invention relates to a tool for transferring positions of a measuring reference from a construction frame (not shown) to a surface of a tile or a number of adjacent tiles (31) for making cut-outs in said tile or tiles (31), said tool (1) comprising a frame-like structure (3) and a grid structure (6) having openings in a raster pattern or a grid pattern made up by laser beams, said grid structure or pattern (6) extending between elements of the frame-like structure (3). The tool is distinctive in that the tool (1) further comprises at least one leg arrangement (2) with an end portion (7), said end portion (7) having spacer element (7b) having a width equal to normal spacing between two adjacently mounted tiles (31) or between a mounted tile and a construction element, such that when measuring the position (34) for the cut-out to be transferred, when transferring the cut out positions to the tile (31) or tiles (31) to be mounted, said end portion (7b) is adapted to rest against a mounted tile (31) or an end construction element at the opposite side of the spacer element (7b).
US11097403B2
A rotary power tool includes a main housing and a transmission housing coupled to the main housing. The transmission housing includes a bearing pocket open to a front of the transmission housing and defined at least partially by a radially inward-extending flange. The rotary power tool also includes an output shaft and a bearing positioned within the bearing pocket adjacent and in abutting relationship with the radially inward-extending flange for rotatably supporting the output shaft in the transmission housing. The rotary power tool also includes a radially outward-extending flange on the output shaft that radially overlaps at least a portion of the bearing on an opposite side of the bearing as the radially inward-extending flange. A line of action of an axial reaction force applied to the output shaft is directed to the transmission housing via the radially outwardly-extending flange, the bearing, and the radially inward-extending flange.
US11097389B2
An in-port sequencing valve configured to be utilized with a clamping device of a workpiece clamping system having a fixture plate, a number of fixture datums, and a number of clamping devices. The in-port sequencing valve includes a housing, a pre-load adjuster, a valve spring, and a valve piston. The pre-load adjuster is configured to be set to a selected valve activation setting. The valve spring is compressed an amount corresponding to the valve activation setting. The valve piston is configured to be shifted from a closed position to an open position when a force due to hydraulic fluid pressure overcomes a threshold spring force of the valve spring corresponding to the valve activation setting. The in-port sequencing valve can be set to a selected valve activation setting so that the clamping devices clamp the workpiece in a selected order according to the valve activation setting.
US11097387B2
A machining center configured for machining workpieces includes at least one column, a beam, at least one slider, a first driving member, a second driving member, a first main shaft and a second main shaft. The column can be configured for supporting the beam. The slider can be disposed on the beam and slidable along a length direction of the beam. Both the first main shaft and the second main shaft can be arranged on the slider and located on two opposite sides of the beam. The first driving member can be configured for driving the slider to slide relative to the beam. The second driving member can be configured for driving the first main shaft and the second main shaft to operate. The first main shaft and the second main shaft can be configured for synchronously or asynchronously machining the workpieces.
US11097386B2
A repositionable power wrench includes a housing, a motor arranged inside the housing, and an output shaft, which is rotationally connected to the motor and telescopically arranged with respect to the housing to allow axial movement of the output shaft with respect to the housing between a fully extended position (Emax) and a fully compressed position, with a resilient member being arranged to urge the output shaft towards the fully extended position (Emax). The power wrench also includes or is connectable to a positioning system arranged to monitor a position of the power wrench. The output shaft includes an output end arranged to interact with a fastener. A sensor is arranged to monitor a level of extension (E) of the output shaft with respect to the housing, such that the position of the output end of the output shaft may be determined.
US11097382B2
A welding screen includes a primary barrier made of a magnetic sheet. The welding screen enhances safety by halting or restricting the motion of magnetic and paramagnetic by-products, thereby preventing flame, light, magnetic material, sparks and dust from being scattered during welding or post-weld grinding. This improvement can be applied to various type of welding screens (welding curtain, welding windshield), by using a flexible magnetic sheet material as the primary barrier material.
