摘要:
A method is disclosed for determining prognosis for a patient suffering from follicular lymphoma, that determines the amount of miR-31 in a biological sample taken from the body of the patient, and assigns the patient to a prognostic group based on the determined amount of miR-31, wherein the prognostic groups and the threshold values for assignment to the prognostic groups are obtained by analyzing the amount of miR-31 in biological samples of patients with known prognosis. In the biological sample taken from the patient, the miR-31 expression may be determined along with the expression of an endogenous control, which is a small nuclear RNA or stably expressed miRNA, and, in case of absolute quantification, the expression of synthetic standards of these miRNAs and endogenous controls of known number of molecules are determined. The method allows the assignment of patients to prognostic groups by determining miR-31 expression.
摘要:
Method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker, in combination with at least one miRNA selected from: (SEQ ID NO. 3) miR-23a-3p, having the sequence AUCACAUUGCCAGGGAUUUCC, (SEQ ID NO. 4) miR-27a-3p, having the sequence UUCACAGUGGCUAAGUUCCGC, (SEQ ID NO. 5) miR-142-5p, having the sequence CAUAAAGUAGAAAGCACUACU. The resulting method uses a body fluid as the input, is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective.
摘要:
Nanodiamonds having a positive ξ-potential of at least 1 mV for use in sequestration of at least one FGF family member in organisms in vivo and in vitro. It has been found that nanodiamonds with a positive ξ-potential show an extremely strong and selective binding to FGF family members, thus leading to their usability in the treatment of diseases related to aberrant FGF-FGFR signalling and/or interaction.
摘要:
The invention provides compounds represented by the structural formula (1): wherein R1, R2, R3 and R4 are as defined in the claims. The compounds are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.
摘要:
The invention relates to furo[3,2-b]pyridines substituted at least in position 5 as inhibitors of protein kinases, regulators or modulators, methods of preparation thereof, pharmaceutical compositions containing the compounds, and pharmaceutical use of the compounds and compositions in the treatment of the diseases such as, for example, cancer or neurodegenerative diseases.
摘要:
A method of plasma treatment of an internal and/or external surface of a hollow electrically non-conductive body. The internal surface of the body and/or its external surface acts a layer of electrical plasma of a surface dielectric barrier discharge generated in a volume of gas by alternating or pulse voltage with an amplitude higher than 100 V from a pair of liquid electrodes formed by an internal electrically conductive liquid situated inside the body and by an external electrically conductive liquid situated outside the body. The electrical plasma is generated above the surface of the electrically conductive liquid, where in the volume of the gas forms a layer of electrical plasma forming a ring copying the shape of the surface of the body wherein the electrical resistance between the liquid electrodes is greater than 10 kΩ. The invention also is a device for carrying out the aforementioned method.
摘要:
The present invention includes polynucleotides that encode novel coelenterazine-utilizing luciferases as well as fragments and mutants thereof having at least 85% sequence identity. The sequences were generated by ancestral sequence reconstruction combined with single-point mutations and transplantation of important regions from the related Renilla reniformis luciferase protein. The luciferases according to the present invention exhibit modulated properties including at least one of: increased bioluminescence emission stability and half-life; increased affinity towards substrate over the product (suppressed product inhibition); increased thermostability; increased glow-type effectivity; and modulated emission maximum. The present invention also includes polypeptides that are encoded by the provided polynucleotides as well as fragments and mutants thereof having at least 85% sequence identity, vectors, kits and expression cassettes containing thereof, cells transfected with thereof, and methods of producing and using thereof.
摘要:
Compounds represented by the structural formula (1) where R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.
摘要:
Compounds represented by the structural formula (1) R1, R2, R3, R4, R5, R6 are inhibitors of nucleases, and are useful in particular in a method of treatment and/or prevention of proliferative diseases, neurodegenerative diseases, and other genomic instability associated diseases.