摘要:
The present disclosure relates to methods of treating a patient suffering from or at risk of developing an ocular disease, disorder or injury, and includes treatment regimens using a double-stranded RNA compound that down-regulates CASP2 expression, or a pharmaceutically acceptable salt thereof.
摘要:
The present invention relates to means and methods for determining neurotoxin activity. Specifically, it relates to a polypeptide having caspase activity comprising a large subunit and a small subunit wherein the caspase further comprises a neurotoxin cleavage site which upon cleavage activates the caspase activity. Also encompassed are polynucleotides encoding the polypeptides as well as vectors or host cells comprising the polynucleotides. The present invention further relates to a method for determining neurotoxin activity in a sample based on the polypeptide of the invention as well as the use of the polypeptide for determining neurotoxin activity in a sample, in general.
摘要:
The present invention relates to means and methods for determining neurotoxin activity. Specifically, it relates to a polypeptide having caspase activity comprising a large subunit and a small subunit wherein the caspase further comprises a neurotoxin cleavage site which upon cleavage activates the caspase activity. Also encompassed are polynucleotides encoding the polypeptides as well as vectors or host cells comprising the polynucleotides. The present invention further relates to a method for determining neurotoxin activity in a sample based on the polypeptide of the invention as well as the use of the polypeptide for determining neurotoxin activity in a sample, in general.
摘要:
T cell immune responses are enhanced by presentation of antigen to CD8+ T cells using a chimeric nucleic acid immunogen or vaccine that links DNA encoding an antigen with DNA encoding a polypeptide that targets or translocates the antigenic polypeptide to which it is fused (immunogenicity-potentiating polypeptides or “IPP”). By inhibiting apoptosis in the vicinity of a T cell responses to such a nucleic acid immunogen, even more potent immune responses are attained. The present strategy prolongs the survival of DNA-transduced cells, including dendritic cells (DCs), thereby enhancing the priming of antigen-specific T cells and increase potency. Co-delivery of DNA encoding an inhibitor of apoptosis, including (a) BCL-xL, (b) BCL-2, (c) XIAP, (d) dominant negative caspase-9, or (e) dominant negative caspase-8, or (f) serine protease inhibitor 6 (SPI-6) which inhibits granzyme B, with DNA encoding an antigen, prolongs the survival of transduced DCs and results in significant enhancement of antigenspecific T cell immune responses that provide potent antitumor effects. Thus, co-administration of a DNA vaccine encoding antigen linked to an IPP along with one or more DNA constructs encoding an anti-apoptotic protein provides a novel way to enhance vaccine potency.
摘要:
Disclosed herein are methods and kits useful for providing neuroprotection to neurons in the inner ear and to methods of treating inner ear diseases and disorders, including tinnitus and Mnire's disease.
摘要:
The present invention relates to means and methods for determining neurotoxin activity. Specifically, it relates to a polypeptide having caspase activity comprising a large subunit and a small subunit wherein the caspase further comprises a neurotoxin cleavage site which upon cleavage activates the caspase activity. Also encompassed are polynucleotides encoding the polypeptides as well as vectors or host cells comprising the polynucleotides. The present invention further relates to a method for determining neurotoxin activity in a sample based on the polypeptide of the invention as well as the use of the polypeptide for determining neurotoxin activity in a sample, in general.
摘要:
Disclosed herein are methods and kits useful for providing neuroprotection to neurons in the inner ear and to methods of treating inner ear diseases and disorders, including tinnitus and Mnire's disease.
摘要:
Disclosed herein are compositions and methods of use thereof for treating diseases, disorders and injuries of the nervous system, comprising a combination of a RTP801 or RTP801L inhibitor, and a Casp2 inhibitor.
摘要:
The present invention provides for an antisense oligonucleotide having the sequence 5nullGCTCGGCGCCGCCATTTCCAG3null. The invention also provides for an antisense oligonucleotide having the sequence 5nullGTCAGCGGCCATCAGCTT3null. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5nullGCTCGGCGCCGCCATTTCCAG3null and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5nullGCTCGGCGCCGCCATTTCCAG3null effective to inhibit death of the cell.
摘要:
Provided are a method of screening an inhibitor of caspase activity by lipopolysaccharide and a method of screening a therapeutic agent for inflammatory diseases or sepsis using the same. Accordingly, it is possible to develop a caspase-4-specific inhibitor.